Extended Data Fig. 1: Infection of back skin with MmuPV1 in wild-type and T cell-deficient mice and the effect of MmuPV1 colonization on the outcomes of chemical carcinogenesis in wild-type C57BL/6J mice. | Nature

Extended Data Fig. 1: Infection of back skin with MmuPV1 in wild-type and T cell-deficient mice and the effect of MmuPV1 colonization on the outcomes of chemical carcinogenesis in wild-type C57BL/6J mice.

From: Immunity to commensal papillomaviruses protects against skin cancer

Extended Data Fig. 1

a, Wart burden in Cd4−/−Cd8−/− mice (right) compared with the absence of warts in wild-type mice (left) after infection of back skin with MmuPV1, at 10 weeks after infection. Note the confluent pattern of wart development in the T cell-deficient mouse. b, MmuPV1-induced wart in a Cd4−/−Cd8−/− mouse, stained with H&E (left), MmuPV1 L2 RNA ISH probe (middle) and negative-control RNA ISH probe (right). c, Left, representative images of the back skin of wild-type C57BL/6J mice on the day of MmuPV1 infection and 21 days after infection. Middle, MmuPV1 L1 PCR on 20 segments of the back skin. MmuPV1 L1 PCR bands are marked by arrows; PCR amplicon size, 339 bp. PCR primers, forward: GAGCTCTTTGTTACTGTTGTC; reverse: ATCCTCTCTTTCCTTGGGC. M, molecular-weight size marker; N, negative control; P1–P3, positive controls. Right, a typical wild-type C57BL/6J mouse five weeks after infection, highlighting the absence of warts, which was the case for 100% of the mice. d, Representative macroscopic images of wild-type C57BL/6J mice that were either infected with MmuPV1 on their back skin or sham-infected, and treated with DMBA–TPA. Papillomas and invasive skin cancers are highlighted with yellow and red circles, respectively. e, Left, Representative images of the back skin of wild-type FVB mice on the day of MmuPV1 infection and 31 days after infection, and MmuPV1 L1 PCR on 20 segments of the back skin. Mice were shaved for visualization of the skin and skin tumours. Scale bars, mouse, 1 cm (a, ce); tissue, 1 mm (b).

Back to article page