Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Mitochondrial fragmentation drives selective removal of deleterious mtDNA in the germline

Abstract

Mitochondria contain their own genomes that, unlike nuclear genomes, are inherited only in the maternal line. Owing to a high mutation rate and low levels of recombination of mitrochondrial DNA (mtDNA), special selection mechanisms exist in the female germline to prevent the accumulation of deleterious mutations1,2,3,4,5. However, the molecular mechanisms that underpin selection are poorly understood6. Here we visualize germline selection in Drosophila using an allele-specific fluorescent in situ-hybridization approach to distinguish wild-type from mutant mtDNA. Selection first manifests in the early stages of Drosophila oogenesis, triggered by reduction of the pro-fusion protein Mitofusin. This leads to the physical separation of mitochondrial genomes into different mitochondrial fragments, which prevents the mixing of genomes and their products and thereby reduces complementation. Once fragmented, mitochondria that contain mutant genomes are less able to produce ATP, which marks them for selection through a process that requires the mitophagy proteins Atg1 and BNIP3. A reduction in Atg1 or BNIP3 decreases the amount of wild-type mtDNA, which suggests a link between mitochondrial turnover and mtDNA replication. Fragmentation is not only necessary for selection in germline tissues, but is also sufficient to induce selection in somatic tissues in which selection is normally absent. We postulate that there is a generalizable mechanism for selection against deleterious mtDNA mutations, which may enable the development of strategies for the treatment of mtDNA disorders.

Main

To visualize germline selection, we designed fluorescently labelled DNA probes that bind specifically to unique regions of the D-loops of mtDNA from either Drosophila melanogaster or a closely related species, Drosophila yakuba (Extended Data Fig. 1a–e). We then transplanted mitochondria from wild-type D. yakuba into a strain of D. melanogaster in which the mtDNA contained a temperature-sensitive point mutation in cytochrome c oxidase subunit I (CoIts)3,5,7, thereby generating heteroplasmic animals that contained mixtures of wild-type and mutant mtDNA (Extended Data Figs. 1f, g, 4a, b). At the permissive temperature (18 °C) the mutation does not grossly affect cytochrome oxidase activity, and is consequently not selected against in the germline3,5,7. At the restrictive temperature (29 °C) cytochrome oxidase activity is greatly reduced, and the mutation is selected against when paired with wild-type mtDNA from either D. melanogaster3,5,7 or D. yakuba8. This heteroplasmic animal model and mtDNA-specific fluorescent in situ-hybridization (FISH) assay enable us to directly observe and analyse mtDNA selection in vivo.

Drosophila ovaries comprise two types of tissue: germline, which gives rise to eggs and the next generation; and somatic cells, which surround the germline (Fig. 1a). Because our heteroplasmic strain contained largely mutant D. melanogaster mtDNA (93%), at the permissive temperature the ovaries remained largely mutant in both the germline and the soma (Fig. 1b, Extended Data Fig. 1h–hʹʹ). At the restrictive temperature, the proportion of wild-type D. yakuba mtDNA relative to mutant D. melanogaster mtDNA increased markedly in the germline but not in the soma (Fig. 1c, Extended Data Fig. 1i–iʹʹ), which demonstrates that mtDNA selection is germline-specific. Male mtDNA is not inherited, and mtDNA FISH and quantitative PCR (qPCR) analyses of heteroplasmic Drosophila testes indicate that mtDNA selection is largely absent in the male germline (Fig. 1d, e, Extended Data Fig. 2). mtDNA selection is therefore female-germline-specific.

Fig. 1: Purifying mtDNA selection is female-germline-specific and manifests during cyst differentiation.
figure1

a, Schematic of an ovariole. The germarium is at the tip, followed by egg chambers surrounded by somatic follicle cells. b, c, Ovarioles of flies heteroplasmic (Het) for D. melanogaster mt:Co1ts (Mut) and D. yakuba (WT) genomes hybridized with fluorescent probes that detect either wild-type or mutant genomes. Selection against the mutant genome is observed in the germline at the restrictive (29 °C, c) but not at the permissive (18 °C, b) temperature (Extended Data Fig. 1h, i.) d, e, mtDNA FISH analysis of Het testes. No selection against mutant genomes is observed at either 29 °C or 18 °C (Extended Data Fig. 2). f, Schematic of the germarium: germline stem cells renew and produce cysts that mature into egg chambers. g, mtDNA FISH analysis of Het germarium at the restrictive temperature. Arrows point to wild-type mtDNA, which is first strongly detected in cyst cells (Extended Data Fig. 3a, b, e). h, mtDNA FISH analysis of Het germarium in which bam is knocked down (bam KD; resulting in reduced expression of Bam), arrested before cyst formation. No increase in wild-type mtDNA is observed (Extended Data Fig. 3c). i, mtDNA FISH of Het germarium co-reacted with anti-Orb antisera to mark cysts and oocytes (Extended Data Fig. 3d). b, c, gi, The dashed lines mark the boundary between somatic and germline cells. Images here and throughout are oriented with the stem cells towards the left. For mtDNA FISH, at least eight control and experimental ovarioles, germaria or testes were imaged for each experimental condition. Imaging parameters and methodology are presented in the Methods and in Supplementary Table 3.

mtDNA selection is thought to occur early during oocyte development1,2,3,4,5. In Drosophila, germline stem cells divide asymmetrically during this time to self-renew and to produce differentiating daughters that undergo four rounds of divisions with incomplete cytokinesis to form germline cysts (Fig. 1f). mtDNA FISH analysis showed no increase in wild-type D. yakuba mtDNA relative to mutant D. melanogaster mtDNA in germline stem cells. However, selection was observed when germ cells differentiated first into cysts and thereafter into egg chambers (Fig. 1g, i, Extended Data Fig. 3a–aʹʹʹ, b–bʹʹʹ, d–dʹʹʹ, e). Inhibition of cyst formation by reducing the expression of the key early differentiation factor, Bag of marbles (Bam), blocked selection (Fig. 1h, Extended Data Fig. 3c–cʹʹʹ, f). Our results show that mtDNA selection occurs after the stem cell stage, early in oogenesis, during germline cyst differentiation.

Germline selection could occur at the cellular level as a result of cell death. Cyst cells that inherit too many mutant mitochondrial genomes could die, and would therefore not be represented in subsequent progeny9. However, a previous study did not observe the death of cyst cells during selection in Drosophila3, and we found that inhibiting cell death by overexpressing the cell-death inhibitor p35 did not block selection (Fig. 2a). Alternatively, the unit of selection could be the mitochondrial genome. To investigate this, we tested whether expression of the Ciona intestinalis protein alternative oxidase (AOX)—which can partially complement loss of complex IV7,10—influenced selection (Extended Data Fig. 4a–c). In effect, we bypassed the function of complex IV while leaving the mutant gene in place. Expression of AOX largely blocked selection by rescuing the mutant mitochondria (Fig. 2b, Extended Data Fig. 4d), which indicates that the selection mechanism senses defects in the oxidative phosphorylation process. Consistent with previous reports11, our data show that the unit of selection is the mitochondrion itself.

Fig. 2: Germline cyst mitochondria undergo fragmentation.
figure2

a, b, Percentage of mutant mtDNA, as assayed by qPCR, in heteroplasmic ovaries with cell death blocked in the germline by expression of p35 (a), or with the function of the mutant complex IV bypassed by expression of the C. intestinalis alternative oxidase (AOX) (b; Extended Data Fig. 4). The mtDNA qPCR data throughout are presented as medians and interquartile range, and are compared by two-tailed unpaired t-tests. In Supplementary Table 2, we also present 95% confidence intervals of the difference between the control and experimental means for all datasets, and the number of biologically independent samples used to derive the statistics. c, d, Stills of live images illustrating the differing shapes of mitochondria in stem cells (c) and 4- to 8-cell cysts (d). Mitochondria, white; cell membranes, blue. Dashes outline the stem cell and 4- to 8-cell cyst (Supplementary Video 1). e, f, Time course of diffusion of the photoactivated mito-photoactivatable GFP (PAGFP) in stem cells (SC, e) and 4- to 8-cell cysts (f). Mitochondria (in the upper panels) are white; the red box marks the site of photoactivation. g, Quantification of the diffusion of photoactivated mito-PAGFP in stem cell and cysts. The standard deviation (s.d.) of the fluorescence intensity of GFP in the whole stem cell or the cyst at each time point was normalized to the initial post-activation value. PA, photoactivation. Data are mean ± s.e.m. of four biological replicates.

Source data

We therefore asked whether morphological changes in mitochondria could be observed during selection in differentiating cysts. Using a mitochondrially targeted enhanced yellow fluorescent protein (eYFP) and live confocal microscopy, we observed that cyst mitochondria were rounder and more discrete than stem-cell mitochondria, which were more often clustered, tubular and branched (Fig. 2c, d, Supplementary Video 1). In accordance with previous findings12, these results indicate that germline cyst mitochondria become fragmented. We propose that fragmentation enables mutant mitochondrial genomes to be distinguished from wild-type genomes. During the 2- to 8-cell cyst stage, mtDNA does not replicate3; consequently, fragmentation causes a reduction in the number of genomes per mitochondrion, which decreases the probability that both mutant and wild-type genomes reside in the same mitochondrion and improves the efficacy of selection. To facilitate selection it is also necessary for fragmentation to prevent mitochondria from sharing their contents. To assess this we targeted a photoactivatable GFP to the mitochondrial matrix and photoactivated a subset of mitochondria in stem cells and cysts. In stem cells, the photoactivatable GFP diffused rapidly throughout the mitochondrial network, which indicates that these mitochondria share contents (Fig. 2e, g). In cysts, the photoactivatable GFP rarely passed from one mitochondrion to another (Fig. 2f, g), indicating that, at this stage, mitochondria do not readily share contents. From these observations it can be suggested that germline cyst mitochondrial fragmentation generates functionally distinguishable units for selection.

To directly test whether the fragmentation that is observed in cysts is necessary for selection, we increased the interconnectedness of cyst mitochondria by overexpressing the pro-fusion protein Mitofusin13 (Extended Data Fig. 5a, b). Using mtDNA FISH analysis, we found that the overexpression of Mitofusin largely abolished selection (Fig. 3a, b, Extended Data Fig. 5e–eʹʹ). Consistent with our FISH data, qPCR analysis indicated that the overexpression of Mitofusin increased the amount of mutant mtDNA while not grossly affecting the amount of wild-type mtDNA (Fig. 3f, Extended Data Fig. 5h). To exclude the possibility that our results were influenced by the fact that both the nuclear and mutant mitochondrial genomes were from D. melanogaster whereas the wild-type mitochondrial genome was from D. yakuba, we repeated the experiment in a heteroplasmic strain in which both wild-type and mutant mtDNAs were from D. melanogaster. In this D.-melanogaster-only background, the overexpression of Mitofusin blocked selection in a similar manner (Extended Data Fig. 5i). Increasing the connectedness of cyst mitochondria by reducing expression of the pro-fission factor Drp114 (Extended Data Fig. 5c) also blocked the selective removal of mutant mtDNA (Extended Data Fig. 5f–fʹʹ). These findings indicate that promoting mitochondrial fusion or inhibiting fission enables mutant mtDNA to hide and to escape selection during oogenesis. Therefore, a sustained fragmented phase is necessary for mtDNA selection.

Fig. 3: Mitochondrial fragmentation is necessary and sufficient for germline mitochondrial DNA selection.
figure3

ac, mtDNA FISH analysis of heteroplasmic germaria: control (a), germline overexpression of Mitofusin (Mfn OE; selection for wild-type mtDNA is no longer observed) (b) and germline knockdown of mitofusin (mfn KD, resulting in reduced expression of Mitofusin; selection for wild-type mtDNA is observed in stem cells) (c). Dashed circles demarcate germline. Arrows mark selection for wild-type mtDNA (Extended Data Figs. 5d, e, 6c–cʹʹʹ). d, e, The reduction of expression of Mitofusin in somatic cells is sufficient to select against mutant mtDNA in those cells. f, Percentage mutant mtDNA, as assayed by qPCR, of embryos laid by control heteroplasmic females and of embryos of heteroplasmic females in which Mitofusin was overexpressed (Mfn OE) or its expression was reduced in the germline (mfn RNAi) (Extended Data Figs. 5h, 6d, e). g, Germarium expressing haemagglutinin-tagged Mitofusin (Mfn), under its endogenous promoter, and mitochondrially target eYFP (mito-eYFP) reacted with anti-haemagglutinin and anti-GFP antisera. Pseudocolouring depicts the ratio of Mitofusin to mito-eYFP levels. For ratios, see the pseudocolour bar. The dashed circle indicated by the arrow outlines the cysts (Extended Data Fig. 7a–aʹʹʹ). h, mitofusin RNA levels decrease in cysts compared to stem cells. The RNA levels were determined by RT–qPCR and are presented as arbitrary units (AU). Data presented are median and interquartile range of four biological replicas, and were analysed using unpaired one-tailed t-tests (Extended Data Fig. 7b).

Source data

To test whether mitochondrial interconnectedness could underlie the absence of mtDNA selection in germline stem cells, we promoted fragmentation in stem cells by reducing the expression of Mitofusin (Extended Data Fig. 6a, b). This induced selection in germline stem cells (Fig. 3c, Extended Data Fig. 6c–cʹʹʹ). A marked reduction in mutant mtDNA was observed, which suggests that—once fragmented—an elimination pathway acts to degrade mutant mtDNA. Although the reduction in expression of Mitofusin also caused defects in germline development (Fig. 3c, Extended Data Fig. 6c–cʹʹʹ), qPCR analysis of mtDNA from the few young embryos obtained (Fig. 3f) and of whole ovaries (Extended Data Fig. 6d, e) confirmed that it enhanced germline selection. The overexpression of Drp1 similarly enhanced selection (Extended Data Fig. 6d, e). Control experiments indicated that Mitofusin and Drp1 do not regulate selection through processes other than fusion and fission (Extended Data Fig. 6f–h, Supplementary Note 1). Together, these data show that mitochondrial fragmentation is not only necessary but is also sufficient for germline mtDNA selection.

There is no robust selection against mutant mtDNA in most somatic tissues15,16. Given that a prolonged fragmented phase is sufficient to induce selection in the germline, we asked whether it might also be sufficient in the soma. Notably, reducing Mitofusin expression induced strong selection against mutant mtDNA in somatic follicle cells (Fig. 3d, e), which demonstrates that sustained fragmentation is sufficient to induce mtDNA selection in somatic cells. Our data indicate that the key determinant, which permits selection in the germline but not the soma, is the marked decrease in fusion of germline mitochondria during early oogenesis that results in an extended phase of mitochondrial fragmentation.

To test whether this fragmented phase is caused by a decrease in Mitofusin expression, we measured the amounts of Mitofusin protein and RNA and found that both were selectively reduced in cyst mitochondria (Fig. 3g, h, Extended Data Fig. 7). Downregulation of Mitofusin was not affected by reducing the expression of known posttranslational regulators Pink1, Parkin, VCP117 or Mul118 (Extended Data Fig. 8). Mitofusin expression is therefore downregulated in germline cysts, which drives mitochondrial fragmentation and—in turn—germline mtDNA selection.

It is not known how mutant mitochondria are recognized and selected against once they are fragmented. The mitochondrial genome encodes proteins that are required for the generation of a proton motive force (PMF) and the synthesis of ATP. Mutations in mtDNA would therefore be expected to directly affect the PMF, the amount of ATP or both. Indeed, both the PMF and the amount of ATP were reduced in germline cysts, in predominantly mutant heteroplasmic flies (Fig. 4a, b, d, e). Inhibition of mitochondrial fragmentation by overexpressing Mitofusin blocked this reduction, further highlighting the importance of sustained mitochondrial fragmentation in exposing mutant genomes (Extended Data Fig. 9a–d). To determine whether a reduction in PMF marks mutant mitochondria for selection, we tested the effect of restoring the PMF in mutant mitochondria. Normally, the ATP synthase inhibitory factor 1 (IF1) prevents ATP synthase from working in reverse to restore the PMF in mutant mitochondria19,20. Therefore, to restore the PMF, we reduced expression of IF1 (Fig. 4c). We observed no effect on selection (Fig. 4g) and no increase in the amounts of wild-type or mutant mtDNA (Fig. 4h), which indicates that a loss of PMF is not necessary for selection against mutant mitochondria. We then explored whether a reduction in the amount of mitochondrial ATP could provide a signal to select against mutant mitochondria. It is not possible to restore ATP levels in mutant heteroplasmic animals without also restoring the PMF; therefore, we tested whether reducing ATP was sufficient to make wild-type mitochondria appear mutant and promote their elimination. We generated a transgenic strain that conditionally expressed a dominant negative form of ATP synthase in both mutant and wild-type mitochondria (Fig. 4f, Extended Data Fig. 9e–g). Reduction in the amount of mitochondrial ATP reduced mutant mtDNA and, notably, wild-type mtDNA (Fig. 4g, h), which indicates that a reduction in mitochondrial ATP is sufficient to induce selection.

Fig. 4: A decrease in mitochondrial ATP reduces both mutant and wild-type mtDNA.
figure4

ac, Pseudocoloured images of germaria of wild-type (a; w1118), heteroplasmic (b) and heteroplasmic females with reduced expression of ATP synthase inhibitory factor 1 (CG13551, IF1 KD) in germline (c) reacted with tetramethylrhodamine methyl ester to measure mitochondrial membrane potential. df, Germaria of wild-type (d; w1118), heteroplasmic (e) and heteroplasmic females expressing a dominant negative inhibitor of complex V (CV DN) in the germline (f) reacted with antibodies to phosphorylated pyruvate dehydrogenase (PDH-P) and pyruvate dehydrogenase (PDH). Pseudocolouring depicts the ratio of PDH-P to PDH and is a measure ATP levels (Extended Data Fig. 9). g, h, Percentage mutant mtDNA (g) and the amount of mutant and wild-type mtDNA (h), as assayed by qPCR, of control heteroplasmic ovaries, of heteroplasmic ovaries in which the expression of ATP synthase inhibitory factor 1 was reduced in the germline (IF1 KD), and of heteroplasmic ovaries in which a dominant negative inhibitor of complex V (CV DN) was expressed in the germline. In h, the amounts of mutant and wild-type DNA were normalized to the amounts in control ovaries.

Source data

We next sought to determine how mutant mitochondria are selected against once they have been fragmented and their ATP has been depleted. Mitophagy would seem to be a good candidate for the mechanism, as it is the main pathway for the elimination of dysfunctional mitochondria from somatic tissues21. However, Parkin-mediated mitophagy has little effect on the clearance of mutant mtDNA in somatic tissues15 or in the germline5. Nevertheless, because mitochondrial fragmentation in stem cells caused a marked reduction in mutant mtDNA (Fig. 3c), we asked whether other mitophagy pathway components are required for germline mtDNA selection. Notably, we found that reduction in the expression of Atg1—the master regulator of autophagy21—blocked selection, whereas reduced expression of Atg8—a key structural component of the autophagosome that interacts with selective autophagy receptors21—did not (Fig. 5a–c, f, Extended Data Fig. 10a–cʹʹ). Instances of Atg1-dependent, Atg8- and Parkin-independent mitophagy have previously been described, notably in the clearance of mitochondria during the maturation of red blood cells22,23,24, which also requires the outer mitochondrial membrane protein BNIP3L (also known as NIX)25. Given these parallels, we assessed whether BNIP3 (also known as CG5059)—the Drosophila protein that is most homologous to BNIP3L—was required for selection in the germline. Reducing the expression of BNIP3 inhibited selection (Fig. 5d, f, Extended Data Fig. 10d–dʹʹ). Consistent with these findings, BNIP3 is upregulated in differentiating cysts26, in which it is associated with mitochondria (Fig. 5e).

Fig. 5: The mitophagy proteins Atg1 and BNIP3 are necessary for germline mitochondrial DNA selection.
figure5

ad, mtDNA FISH analysis of control heteroplasmic germaria (a) and of heteroplasmic germaria in which the expression of Atg1 (b), Atg8a (c) or BNIP3 (d) was reduced. The dashed circles demarcate the germline, and arrows point to wild-type mtDNA (Extended Data Fig. 10). e, BNIP3 protein localization in a heteroplasmic germarium; the right panel also shows mitochondria (blue) as visualized with anti-ATP5a antibody. f, Percentage of mutant mtDNA, as assayed by qPCR, of control heteroplasmic ovaries (Ctrl) and of ovaries in which the expression of Atg1 (Atg1 KD), Atg8a (Atg8a KD) or BNIP3 (CG5059 knockdown (BNIP3 KD1 and BNIP3 KD2)) was reduced. g, The amount of mutant and wild-type mtDNA, as assayed by qPCR, in ovaries in which the expression of Atg1 or BNIP3 was reduced, normalized to the amount of mutant and wild-type mtDNA in control ovaries.

Source data

Bypassing mutant complex IV (Extended Data Fig. 4d) or preventing mitochondrial fragmentation by overexpressing Mitofusin (Extended Data Fig. 5h, i) blocked selection, primarily by preventing the elimination of mutant mtDNA. However, we found that, instead of preventing the elimination of mutant mtDNA, reducing the expression of Atg1 or BNIP3 predominantly decreased the levels of wild-type mtDNA (Fig. 5g). This was also the case when Atg1 expression was reduced in a heteroplasmic strain in which both wild-type and mutant mtDNAs were from D. melanogaster (Extended Data Fig. 10e, f). It has previously been proposed that Pink1 inhibits the replication of mutant mtDNA, enabling wild-type mtDNA to outcompete their mutant counterparts3,5,11. Our results indicate that the turnover of mitochondria is coupled to replication, such that the elimination of defective mitochondria may trigger the replication of active mitochondria and ultimately selection.

Our findings indicate that developmentally regulated fragmentation of cyst mitochondria is required to isolate their genomes and proteomes, so that mitochondria possessing mutant mtDNA can be selected against through a process requiring the mitophagy proteins Atg1 and BNIP3. Given the benefits of mitochondrial fragmentation on mtDNA selection, the question arises as to why mitochondria are not always fragmented. Enhanced fragmentation comes at a cost, as substantial reduction in the expression of Mitofusin causes mitochondrial and cellular dysfunction in both germline and somatic tissues27 (Extended Data Fig. 6c–cʹʹʹ). In addition, evidence suggests that frequent fusion and swapping of mitochondrial content is important to maintain the health of the network27 and to efficiently generate ATP28. It has previously been shown that, during early oogenesis, the germline does not have a strong requirement for mitochondrially generated ATP29. It may have evolved an alternative energy metabolism to tolerate the possible negative energetic consequences of reduced mitochondrial function caused by sustained fragmentation. It will be interesting to explore whether inducing mitochondrial fragmentation in somatic tissues can be used as a treatment for those suffering from mtDNA disorders. Recent work indicates that this may be the case: inducing mitochondrial fragmentation in the soma temporarily during midlife improved health and prolonged lifespan in Drosophila and Caenorhabditis elegans, possibly by promoting the removal of deleterious mtDNA16,30,31. In conclusion, we have uncovered a key driver of mtDNA-purifying selection in the female germline, and our findings suggest therapeutic approaches for the treatment of mtDNA disorders.

Methods

Fly stocks

For a list of fly stocks used in this paper see Supplementary Table 1.

To generate UAS.CV-DN, the coding sequence of ATP synthase subunit C (CG1746) was amplified using Phusion High Fidelity PCR system (NEB, M0530L), the proton-accepting glutamic acid 121 mutated to a glutamine (numbered according to the start of the preprotein; E121Q) and the mutated coding sequence cloned into pVALIUM2232 using Gibson Assembly master mix (NEB, E2611S). Plasmid DNA was then injected by BestGene into a strain carrying attP40 landing sites and integrated into the second chromosome using phiC31 integrase33.

Heteroplasmic flies

Heteroplasmic flies were generated by germ plasm transfer from either wild-type D. yakuba or wild-type D. melanogaster (w1118) embryos into mutant D. melanogaster (mt:CoIts + mt:ND2del1) embryos as described previously5,34. GAL4 drivers were crossed into the heteroplasmic fly lines. Heteroplasmic yakuba/melanogaster flies were maintained at 29 °C. Heteroplasmic melanogaster/melanogaster flies were maintained at 18 °C. They were mated to flies carrying RNA interference (RNAi) or overexpression constructs at 18 °C for 2–3 days. The embryos and first instar larvae were then aged for 2–3 days at 18 °C before shifting to 29 °C.

Fluorescent in situ-hybridization and immunofluorescence

Generation of unique probes

For D. melanogaster, the D-loop was amplified from mtDNA using the primers GGCCGATATCCCGCGACTGCTGGCACCAATTTAGTCA and GGCCGATATCCCCTATCAAGGTAATCCTTTTTATCAGGCA. The PCR product was digested with EcoRV and SwaI and the unique sequences were subcloned into pUC19. The DNA that was subsequently nick translated was amplified using m13 forward and reverse primers. For D. yakuba, the D-loop was amplified from mtDNA using the primers GGCCGGATCCCCGCGACTGCTGGCACCAATTTGGT and GGCCAAGCTTCCCTATCAAGGTAACCCTTTTTATCAGGCA and subcloned into pUC19. The unique sequences were amplified using m13 forward and GATTATCTATTAATTTAGAACTTAGTATACA primers. Fluorescent probes were generated by nick translation using FISH Tag DNA kits (Thermo Fisher). The probes that recognize mtDNA of both species have previously been described35.

With the exception of the temperature-shift experiments (Fig. 1b–e, Extended Data Figs. 1h, i, 2), ovaries were dissected from 1–3-day-old females. Ovaries and testes were fixed and hybridized essentially as described36. Dissected ovaries and testes were fixed for 4 and 8 min, respectively, in cacodylate fixative (100 mM sodium cacodylate, pH 7.4, 100 mM sucrose, 40 mM potassium acetate, 10 mM sodium acetate, 10 mM EGTA, 5% formaldehyde). They were then washed for 4 × 10 min in 2× SSCT (2×SSC, 0.1% Tween-20). Ovaries were washed for 10 min in 20% then 40% formamide in 2× SSCT and 2× in 50% formamide in 2×SSCT. They were then incubated in 40 μl of 2×SSC, 50% formamide, 10% dextran sulfate, 5 μg Escherichia coli tRNA, 5 μg salmon sperm DNA, 40 μg BSA, and 200 ng of each fluorescent probe for 3 min at 91 °C, before incubation overnight at 30 °C. Testes were washed for 3 × 10 min in PBS/0.5% Triton X-100, dehydrated through an ethanol series, incubated in 100% ethanol overnight at 4 °C, rehydrated, incubated in 5% acetic acid at 4 °C for 5 min, washed for 3 × 5 min in PBS at 4 °C and refixed in 2% paraformaldehyde at room temperature for 55 min37. After three 10 min washes in PBS/0.5% Triton X-100, testes were washed for 3 × 10 min in 2× SSCT, exchanged into 50% formamide, and hybridized in the same way as for ovaries except that they were incubated for 4 h at 50 °C before overnight incubation at 30 °C. Both ovaries and testes were washed for 4 × 10 min in 50% formamide in 2× SSCT at 30 °C, 10 min in 40% formamide, then 20% formamide in 2× SSCT at room temperature, and 3 × 10 min in 2× SSCT at room temperature. When FISH was followed by immunofluorescence, ovaries were rinsed three times in PBS and fixed again in 2% paraformaldehyde in PBS for 30 min. Immunofluorescence was carried out as previously described35.

Imaging parameters are presented in Supplementary Table 3. For mtDNA FISH, at least eight control and experimental ovarioles, germaria or testes were imaged for each experimental condition. For determining the ratios of PDH-P/PDH (Fig. 4d–f), Mitofusin/mito-eYFP (Fig. 3g, Extended Data Fig. 7a) and the localization of BNIP3 (Fig. 5e, f) at least three germaria were imaged. Imaging was not done blind. Deconvolution was performed using the aggressive unsupervised profile of Huygens Professional (see Supplementary Table 3 for list of images that were deconvolved). To be able to visualize changes in germline mtDNA across samples, images were normalized so that the somatic cells of the ovary were approximately 90% mutant mtDNA, approximately the percentage determined by our qPCR measurements. Using Fiji38, the display range was adjusted by modifying the minimum to remove background signal (around 10%) from the wild-type mtDNA (green) channel. Both the mutant and wild-type maximum settings were then adjusted to make the soma around 90% as measured by quantifying a region of interest in the soma after conversion to RGB colour (see Supplementary Table 3). When the soma was manipulated (Fig. 3d, e), images were instead normalized as above to make the germline approximately 65% mutant mtDNA. All the greyscale images presented in the Extended Data are non-background-subtracted, unnormalized images.

Antibodies

Primary antisera used were rabbit anti-Vasa (from the laboratory of R.L.), mouse monoclonal anti-Hts (1B1, DSHB)39, mouse monoclonal anti-Orb (4H8, DSHB)40, mouse monoclonal anti-HA (Abcam, ab130275), chicken anti-GFP (Aves Labs, GFP-1020), mouse monoclonal anti-ATP5A [15H4C4] (Abcam, ab14748), mouse anti-PDH E1α (Abcam, ab110334) and rabbit anti-phoshpo-PDH E1α (S293) (Millipore, AP1062). Secondary antibodies were DyLight 405 donkey anti-rabbit, DyLight 405 donkey anti-mouse, Cy3 donkey anti-mouse, all from Jackson ImmunoResearch, and Alexa Fluor 488 goat anti-chicken from Thermo Fisher Scientific.

qPCR quantification of mitochondrial DNA

One- to three-day-old flies were dissected. For Figs. 3f, 5f, g and Extended Data Figs. 1g, 2e, 3f, 5h, mtDNA was extracted from pools of embryos, dissected ovaries and fly carcasses as previously described5. Samples were mechanically homogenized with a plastic pestle in 100 µl of homogenization buffer (100 mM Tris-HCl pH 8.8, 0.5 mM EDTA, 1% SDS) and incubated for 30 min at 65 °C. Potassium acetate was added to 1 M and samples were incubated for 30 min on ice, before centrifugation at 20,000g for 15 min at 4 °C. DNA was then precipitated from the supernatant by adding 0.5 volumes of isopropanol followed by centrifugation at 20,000g for 5 min at room temperature. The resultant pellet was washed with 70% ethanol and suspended in water. qPCR was carried out using 25 ng of nucleic acid and 300 nM of each primer pair with a Roche LightCycler 480 machine and LightCycler 480 SYBR Green I Master 2X (Roche, 04887352001). The PCR program was: 10 min at 95 °C, 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Dissociation curves generated through a thermal denaturation step were used to verify amplification specificity. For Figs. 2a, b, 4g, h and Extended Data Figs. 4d, 5i, 6d–f, 10e, f, individual ovaries and carcasses were homogenized in 10 mM Tris pH 8.0, 1 mM EDTA, 25 mM NaCl, 200 μg ml−1 Proteinase K, incubated at 25 °C for 30 min and 95 °C for 2 min41. qPCR was carried out as described above with 1/25 of an ovary and 1/50 of a carcass. For a list of the primers used, see Supplementary Table 4.

The crossing point (Cp) values (the cycle at which the fluorescence of a sample increases above the background fluorescence) were calculated using the Second Derivative Maximum method of the Roche LightCycler 480 software. The Cp values used in the analysis were the mean values of the two primer sets that amplified the indicated genomic or mtDNAs. The amount of mutant or wild-type mtDNA = 2−Cp. The percentage of mutant DNA was calculated as follows: % mutant DNA = (amount of mutant mtDNA/(amount of mutant mtDNA + amount of wild-type mtDNA)) × 100. The soma (carcass) represents the starting heteroplasmy of the animal being measured. This percentage varies from fly to fly. Because we are interested in the percentage decrease in mutant mtDNA in the germline relative to the starting heteroplasmy, the percentage mutant mtDNA in each ovary was normalized to the percentage mutant mtDNA in its corresponding carcass. The percentage wild-type mtDNA in each ovary was then derived by subtracting that value from 100%.

To determine the amount of mutant and wild-type mtDNA relative to the amount of genomic DNA, the amount of total mtDNA in each ovary was normalized to the amount of genomic DNA in that ovary. The amount of mutant and wild-type mtDNA was determined by multiplying the normalized percentage mutant or wild-type mtDNA in the ovary by the normalized amount of mtDNA in that ovary.

Because of the number of manipulations involved in generating qPCR data, any of which can result in errors, we routinely tested for outliers. Outliers were identified using the ROUT method (Q = 1%) as implemented in Prism 7 for Mac OS X GraphPad Software (http://www.graphpad.com). All outliers were removed ad hoc; that is, they were removed before looking at the data.

Data were analysed using unpaired two-tailed t-tests and 95% confidence intervals of the difference between the control and experimental means, as implemented in Prism 7 for Mac OS X GraphPad Software; see Supplementary Table 2.

Quantification of mitofusin RNA levels

To generate ovaries with 2-, 4- and 8-cell cysts, hs-bam;;bamΔ86 flies were heat-shocked for 2 h at 37 °C in a circulating water bath, transferred to new freshly yeasted vials and incubated at 29 °C for 8 h (2-cell cyst), 22 h (4-cell cyst) and 30 h (8-cell cysts) before ovaries were extracted for total RNA isolation. Total RNA isolated from ovaries using Tri-Reagent (BioShop, TRI118) was treated with Turbo DNA-free Kit (Thermo Fisher, AM1907) to remove residual genomic DNA contamination. Reverse transcription (RT) was performed on 1 µg of total RNA using oligo(dT)20 primers (Thermo Fisher, 18418020) and Superscript III (Thermo Fisher, 18064014). qPCR was carried out using SensiFAST SYBR No-ROX qPCR kit (FroggaBio, BIO-98050) and the cycling parameters described above on 1/2 of the RT reaction with marf-specific primers. Dissociation curves generated through a thermal denaturing step were used to verify amplification specificity. Results were normalized to the mean value obtained for three genes (CG8187; CG2698; Und) with invariant expression in a range of tissues and developmental stages, as revealed by publicly available transcriptome data42. Data were analysed using unpaired one-tailed t-tests. For a list of the primers used see Supplementary Table 4.

Live imaging, photoactivation and measurement of membrane potential

For live imaging of mito-eYFP tagged mitochondria, ovaries were removed from females and the ovarioles were teased apart using tungsten needles in Halocarbon 200 oil (Halocarbon Products, 9002-83-9) on a coverslide. For photoactivation and measurement of the membrane potential, ovaries were removed from females and incubated in Schneider’s medium (Life Technology, 21720) containing 1 µM tetraphenylborate (Sigma, T25402) and 20 nM tetramethylrhodamine, methyl ester (TMRM) (Invitrogen, T668) for 30 min at room temperature in the dark. 10 µg ml−1 CellMask Deep Red plasma membrane stain (Invitrogen, C10046) was then added and the ovaries were incubated for an additional 10 min. The ovaries were washed once with Schneider’s Medium before being teased apart as above in Halocarbon 200 oil on a coverslip. For all live imaging, the samples were then mounted on a slide with a gas-permeable membrane (YSI, Membrane Kit Standard) before imaging with a Zeiss LSM780 confocal microscope with Plan-Apochromat 40×/1.4 Oil DIC and Plan-Apochromat 63×/1.4 Oil DIC objectives. For all live-imaging experiments and for measurement of membrane potentials, at least three biological replicas were imaged. For photoactivation, the background signal (before photoactivation) was subtracted from all images in the time series using Fiji. Images were corrected for chromatic shifting using 0.1 nm TetraSpeck microspheres (Thermo Fisher) and deconvolved using Huygens Essential X11. For the quantification of the diffusion of photoactivated mito-PAGFP in stem cells and cysts, the standard deviation of the PAGFP fluorescence intensity was calculated using Fiji as previously described43,44. An increase in diffusion of PAGFP leads to a decrease in the standard deviation and indicates an increase in the number of productive fusion events. Imaris software (Bitplane) was used to quantify mitochondrial motility in germaria. Individual mitochondria were tracked using the autoregressive motion algorithm, and for each mitochondrion the distance moved (µm) in one second was measured (displacement delta length). Mean displacement of all mitochondria over one minute of live imaging is reported.

Clear native gel electrophoresis

The oligomerization of ATP synthase was assessed by clear native PAGE (CN-PAGE)45. Ten pairs of ovaries were homogenized in 50 µl PBS and mixed with 50 µl 0.1% digitonin (Thermo Fisher, BN20061) in PBS. After incubation on ice for 15 min, samples were centrifuged (10,000g) for 15 min at 4 °C. The pellets (mitoplast fraction) were washed in 200 µl PBS and centrifuged (10,000g) for 15 min at 4 °C, then solubilized in 25 µl 1× NativePAGE sample buffer (Thermo Fisher, BN20032) supplemented with 10 µl 5% digitonin (Thermo Fisher, BN20061). After incubation on ice for 15 min, samples were centrifuged (20,000g) for 30 min at 4 °C. Samples (15 µl) were then resolved on 1.0-mm, 10-well NativePAGE 3–12% Bis-Tris Gels (Thermo Fisher, BN2011BX10) with 1× NativePAGE running buffer (Thermo Fisher, BN2001) according to the manufacturer’s instructions, at 4 °C. The cathode buffer was supplemented with 0.02% (w/v) n-dodecyl β-d-maltoside (Sigma, D4641) and 0.05% (w/v) sodium deoxycholate (Sigma, 30970). After CN-PAGE, proteins were transferred to 0.2 µm PVDF membranes (Bio-Rad, 162-0174) using an XCell SureLock Mini-Cell Electrophoresis System (Thermo Fisher, EI0001) in buffer comprising 48 mM Tris (Sigma, T1503), 39 mM glycine (Thermo Fisher, BP381-1), 0.05% (w/v) SDS (Sigma, L3771), 20% (v/v) methanol (Thermo Fisher, A412-4), pH 8.3. The membrane was blocked in PBS, 0.1% Tween 20 with 5% skimmed milk powder and incubated with primary antibody for 1 h at room temperature. Blots were incubated with the appropriate secondary antiserum for 1 h at room temperature, treated with Pierce ECL Western Blotting Substrate (Thermo Fisher, 32106) according to the manufacturer’s instructions, and visualized on the ChemiDoc MP Imaging System (BioRad, 170-8280).

ATP/ADP determination

To measure ATP and ADP, embryos were dechorionated in bleach for 2 min, washed in PBS containing 0.1% Triton X-100, and homogenized (10 embryos per sample) with a pestle in 12 µl Assay Buffer (Sigma, MAK135A). Samples were then analysed using ADP/ATP Ratio Assay Kit (Sigma, MAK135) according to the manufacturer’s instructions. Luminescence was recorded using the Synergy H1 Microplate Reader (BioTek, BTH1M). Data were analysed using paired t-tests.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.

Data availability

Source Data for all graphs are provided with the paper. The Cp values associated with each primer pair and DNA, and confocal image data are available upon request.

References

  1. 1.

    Fan, W. et al. A mouse model of mitochondrial disease reveals germline selection against severe mtDNA mutations. Science 319, 958–962 (2008).

    ADS  CAS  Article  Google Scholar 

  2. 2.

    Stewart, J. B. et al. Strong purifying selection in transmission of mammalian mitochondrial DNA. PLoS Biol. 6, e10 (2008).

    Article  Google Scholar 

  3. 3.

    Hill, J. H., Chen, Z. & Xu, H. Selective propagation of functional mitochondrial DNA during oogenesis restricts the transmission of a deleterious mitochondrial variant. Nat. Genet. 46, 389–392 (2014).

    CAS  Article  Google Scholar 

  4. 4.

    Floros, V. I. et al. Segregation of mitochondrial DNA heteroplasmy through a developmental genetic bottleneck in human embryos. Nat. Cell Biol. 20, 144–151 (2018).

    CAS  Article  Google Scholar 

  5. 5.

    Ma, H., Xu, H. & O’Farrell, P. H. Transmission of mitochondrial mutations and action of purifying selection in Drosophila melanogaster. Nat. Genet. 46, 393–397 (2014).

    CAS  Article  Google Scholar 

  6. 6.

    Palozzi, J. M., Jeedigunta, S. P. & Hurd, T. R. Mitochondrial DNA purifying selection in mammals and invertebrates. J. Mol. Biol. 430, 4834–4848 (2018).

    CAS  Article  Google Scholar 

  7. 7.

    Chen, Z. et al. Genetic mosaic analysis of a deleterious mitochondrial DNA mutation in Drosophila reveals novel aspects of mitochondrial regulation and function. Mol. Biol. Cell 26, 674–684 (2015).

    Article  Google Scholar 

  8. 8.

    Ma, H. & O’Farrell, P. H. Selfish drive can trump function when animal mitochondrial genomes compete. Nat. Genet. 48, 798–802 (2016).

    CAS  Article  Google Scholar 

  9. 9.

    Pepling, M. E. & Spradling, A. C. Mouse ovarian germ cell cysts undergo programmed breakdown to form primordial follicles. Dev. Biol. 234, 339–351 (2001).

    CAS  Article  Google Scholar 

  10. 10.

    Fernandez-Ayala, D. J. M. et al. Expression of the Ciona intestinalis alternative oxidase (AOX) in Drosophila complements defects in mitochondrial oxidative phosphorylation. Cell Metab. 9, 449–460 (2009).

    CAS  Article  Google Scholar 

  11. 11.

    Zhang, Y. et al. PINK1 inhibits local protein synthesis to limit transmission of deleterious mitochondrial DNA mutations. Mol. Cell 73, 1127–1137.e5 (2019).

    CAS  Article  Google Scholar 

  12. 12.

    Cox, R. T. & Spradling, A. C. A Balbiani body and the fusome mediate mitochondrial inheritance during Drosophila oogenesis. Development 130, 1579–1590 (2003).

    CAS  Article  Google Scholar 

  13. 13.

    Hwa, J. J., Hiller, M. A., Fuller, M. T. & Santel, A. Differential expression of the Drosophila mitofusin genes fuzzy onions (fzo) and dmfn. Mech. Dev. 116, 213–216 (2002).

    CAS  Article  Google Scholar 

  14. 14.

    Bleazard, W. et al. The dynamin-related GTPase Dnm1 regulates mitochondrial fission in yeast. Nat. Cell Biol. 1, 298–304 (1999).

    CAS  Article  Google Scholar 

  15. 15.

    Pickrell, A. M. et al. Endogenous Parkin preserves dopaminergic substantia nigral neurons following mitochondrial DNA mutagenic stress. Neuron 87, 371–381 (2015).

    CAS  Article  Google Scholar 

  16. 16.

    Kandul, N. P., Zhang, T., Hay, B. A. & Guo, M. Selective removal of deletion-bearing mitochondrial DNA in heteroplasmic Drosophila. Nat. Commun. 7, 13100 (2016).

    ADS  CAS  Article  Google Scholar 

  17. 17.

    Tanaka, A. et al. Proteasome and p97 mediate mitophagy and degradation of mitofusins induced by Parkin. J. Cell Biol. 191, 1367–1380 (2010).

    CAS  Article  Google Scholar 

  18. 18.

    Yun, J. et al. MUL1 acts in parallel to the PINK1/parkin pathway in regulating mitofusin and compensates for loss of PINK1/parkin. eLife 3, e01958 (2014).

    Article  Google Scholar 

  19. 19.

    Lefebvre, V. et al. Genome-wide RNAi screen identifies ATPase inhibitory factor 1 (ATPIF1) as essential for PARK2 recruitment and mitophagy. Autophagy 9, 1770–1779 (2013).

    CAS  Article  Google Scholar 

  20. 20.

    Buzhynskyy, N., Sens, P., Prima, V., Sturgis, J. N. & Scheuring, S. Rows of ATP synthase dimers in native mitochondrial inner membranes. Biophys. J. 93, 2870–2876 (2007).

    ADS  CAS  Article  Google Scholar 

  21. 21.

    Pickles, S., Vigié, P. & Youle, R. J. Mitophagy and quality control mechanisms in mitochondrial maintenance. Curr. Biol. 28, R170–R185 (2018).

    CAS  Article  Google Scholar 

  22. 22.

    Zhang, J. et al. Mitochondrial clearance is regulated by Atg7-dependent and -independent mechanisms during reticulocyte maturation. Blood 114, 157–164 (2009).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  23. 23.

    Zhang, J. et al. A short linear motif in BNIP3L (NIX) mediates mitochondrial clearance in reticulocytes. Autophagy 8, 1325–1332 (2012).

    Article  Google Scholar 

  24. 24.

    Villa, E., Marchetti, S. & Ricci, J.-E. No parkin zone: mitophagy without parkin. Trends Cell Biol. 28, 882–895 (2018).

    CAS  Article  Google Scholar 

  25. 25.

    Schweers, R. L. et al. NIX is required for programmed mitochondrial clearance during reticulocyte maturation. Proc. Natl Acad. Sci. USA 104, 19500–19505 (2007).

    ADS  CAS  Article  Google Scholar 

  26. 26.

    Hsu, H.-J. & Drummond-Barbosa, D. A visual screen for diet-regulated proteins in the Drosophila ovary using GFP protein trap lines. Gene Expr. Patterns 23-24, 13–21 (2017).

    CAS  Article  Google Scholar 

  27. 27.

    Chan, D. C. Fusion and fission: interlinked processes critical for mitochondrial health. Annu. Rev. Genet. 46, 265–287 (2012).

    CAS  Article  Google Scholar 

  28. 28.

    Mitra, K., Wunder, C., Roysam, B., Lin, G. & Lippincott-Schwartz, J. A hyperfused mitochondrial state achieved at G1-S regulates cyclin E buildup and entry into S phase. Proc. Natl Acad. Sci. USA 106, 11960–11965 (2009).

    ADS  CAS  Article  Google Scholar 

  29. 29.

    Teixeira, F. K. et al. ATP synthase promotes germ cell differentiation independent of oxidative phosphorylation. Nat. Cell Biol. 17, 689–696 (2015).

    CAS  Article  Google Scholar 

  30. 30.

    Rana, A. et al. Promoting Drp1-mediated mitochondrial fission in midlife prolongs healthy lifespan of Drosophila melanogaster. Nat. Commun. 8, 448 (2017).

    ADS  Article  Google Scholar 

  31. 31.

    Lin, Y.-F. et al. Maintenance and propagation of a deleterious mitochondrial genome by the mitochondrial unfolded protein response. Nature 533, 416–419 (2016).

    ADS  CAS  Article  Google Scholar 

  32. 32.

    Ni, J.-Q. et al. A genome-scale shRNA resource for transgenic RNAi in Drosophila. Nat. Methods 8, 405–407 (2011).

    CAS  Article  Google Scholar 

  33. 33.

    Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E. & Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476–483 (2008).

    CAS  Article  Google Scholar 

  34. 34.

    Matsuura, E. T., Chigusa, S. I. & Niki, Y. Induction of mitochondrial DNA heteroplasmy by intra- and interspecific transplantation of germ plasm in Drosophila. Genetics 122, 663–667 (1989).

    CAS  PubMed  PubMed Central  Google Scholar 

  35. 35.

    Hurd, T. R. et al. Long Oskar controls mitochondrial inheritance in Drosophila melanogaster. Dev. Cell 39, 560–571 (2016).

    CAS  Article  Google Scholar 

  36. 36.

    McKim, K. S., Joyce, E. F. & Jang, J. K. in Meiosis. Methods in Molecular Biology, Vol. 558 (ed. Keeney, S.) 197–216 (Humana Press, Totowa, 2009).

  37. 37.

    Long, X., Colonell, J., Wong, A. M., Singer, R. H. & Lionnet, T. Quantitative mRNA imaging throughout the entire Drosophila brain. Nat. Methods 14, 703–706 (2017).

    CAS  Article  Google Scholar 

  38. 38.

    Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682 (2012).

    CAS  Article  Google Scholar 

  39. 39.

    Zaccai, M. & Lipshitz, H. D. Differential distributions of two adducin-like protein isoforms in the Drosophila ovary and early embryo. Zygote 4, 159–166 (1996).

    CAS  Article  Google Scholar 

  40. 40.

    Lantz, V., Chang, J. S., Horabin, J. I., Bopp, D. & Schedl, P. The Drosophila orb RNA-binding protein is required for the formation of the egg chamber and establishment of polarity. Genes Dev. 8, 598–613 (1994).

    CAS  Article  Google Scholar 

  41. 41.

    Gloor, G. B. et al. Type I repressors of P element mobility. Genetics 135, 81–95 (1993).

    CAS  PubMed  PubMed Central  Google Scholar 

  42. 42.

    Celniker, S. E. et al. Unlocking the secrets of the genome. Nature 459, 927–930 (2009).

    ADS  CAS  Article  Google Scholar 

  43. 43.

    Gomes, L. C., Di Benedetto, G. & Scorrano, L. During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat. Cell Biol. 13, 589–598 (2011).

    CAS  Article  Google Scholar 

  44. 44.

    Mariotti, F. R., Corrado, M. & Campello, S. Following mitochondria dynamism: confocal analysis of the organelle morphology. Methods Mol. Biol. 1241, 153–161 (2015).

    CAS  Article  Google Scholar 

  45. 45.

    Wittig, I. & Schägger, H. Advantages and limitations of clear-native PAGE. Proteomics 5, 4338–4346 (2005).

    CAS  Article  Google Scholar 

  46. 46.

    Lewis, D. L., Farr, C. L., Farquhar, A. L. & Kaguni, L. S. Sequence, organization, and evolution of the A+T region of Drosophila melanogaster mitochondrial DNA. Mol. Biol. Evol. 11, 523–538 (1994).

    CAS  PubMed  Google Scholar 

  47. 47.

    Park, J. et al. Drosophila Porin/VDAC affects mitochondrial morphology. PLoS ONE 5, e13151 (2010).

    ADS  CAS  Article  Google Scholar 

  48. 48.

    Sandoval, H. et al. Mitochondrial fusion but not fission regulates larval growth and synaptic development through steroid hormone production. eLife 3, e03558 (2014).

    Article  Google Scholar 

  49. 49.

    Ni, J.-Q. et al. Vector and parameters for targeted transgenic RNA interference in Drosophila melanogaster. Nat. Methods 5, 49–51 (2008).

    CAS  Article  Google Scholar 

  50. 50.

    LaJeunesse, D. R. et al. Three new Drosophila markers of intracellular membranes. BioTechniques 36, 784–790 (2004).

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We thank J. Chung, M. Guo, P. O’Farrell, H. Jacobs, H. Ma, the Drosophila Species Stock Center, the Bloomington Drosophila Stock Center and the Vienna Drosophila Stock Center for fly stocks; members of the Lehmann laboratory and K. Lau for discussions; Y. Abdu, L. Barton, A. Blum, S. Burden, S. Kidd, M. Murphy, A. McQuibban and D. Siekhaus for comments on the manuscript; and A. Sfeir for experimental suggestions to address the reviewers’ comments. This work was supported by Canadian Institutes of Health Research grant FRN 159510 to T.R.H. and by National Institutes of Health grant R37HD41900 to R.L. T.R.H. is part of the University of Toronto Medicine by Design initiative, which receives funding from the Canada First Research Excellence Fund. R.L. is a Howard Hughes Medical Institute investigator.

Reviewer information

Nature thanks Rachel Cox, Yukiko Yamashita and the other anonymous reviewer(s) for their contribution to the peer review of this work.

Author information

Affiliations

Authors

Contributions

S.P.J. and J.M.P. contributed equally to this work. T.R.H., T.L. and R.L. designed the experiments; T.R.H., T.L., S.P.J. and J.M.P. performed the experiments; and T.R.H., T.L. and R.L. wrote the manuscript with input from all authors.

Corresponding authors

Correspondence to Ruth Lehmann or Thomas R. Hurd.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data figures and tables

Extended Data Fig. 1 FISH probes are specific for either D. yakuba or D. melanogaster mitochondrial DNA.

a, Schematics of the mitochondrial genome and the D-loops of D. yakuba and D. melanogaster. In the schematic of the D-loop of D. melanogaster, the boxed regions denote two classes of repeated sequences. The open boxes are unique to D. melanogaster. The hatched boxes contain a 300-bp sequence, that is conserved in other Drosophilids46 and is depicted by solid bars above the repeats in D. melanogaster and by a single solid bar above the D. yakuba D-loop. The FISH probes are directed against unique regions of the D-loops; the D.-yakuba-specific probe is depicted as a green bar and the D.-melanogaster-specific probe is depicted as a magenta bar beneath the respective D-loops. be, Confocal images of D. yakuba (b, e) and D. melanogaster (c, d) stage 7 egg chambers hybridized with D.-yakuba-specific probes (green; b, c) and D.-melanogaster-specific probes (magenta; d, e). All egg chambers were also hybridized with probes recognizing mtDNA of both species (common; middle panels, blue). The merged images are in the right panels. The D. yakuba probe hybridizes to D. yakuba mtDNA (b) but not D. melanogaster mtDNA (c). The D. melanogaster probe hybridizes to D. melanogaster mtDNA (d) but not D. yakuba mtDNA (e). f, Schematic illustrating the generation of heteroplasmic flies by the transfer of germ plasm that contains wild-type mitochondria (green) from D. yakuba (D. yak) into D. melanogaster (D. mel) embryos that are homoplasmic for mt:CoIts + mt:ND2del1 mutant mitochondria (magenta). g, Bar plots showing the percentage of mutant and wild-type mtDNA, as assayed by qPCR, in adult female carcasses without ovaries from the original mutant D. melanogaster strain and the heteroplasmic line generated by pole plasm transplantation. The data are an average of four biological replicates. hh′, h″, ii′, i″, Ovarioles of flies heteroplasmic (Het) for D. melanogaster mt:Co1ts (mut) and D. yakuba (wt) genomes that were shifted to 18 °C (permissive temperature) for 10 days or maintained at 29 °C (restrictive temperature), hybridized with fluorescent probes that detect either wild-type D. yakuba (green) or mutant D. melanogaster (magenta) genomes. Selection against the mutant genome is observed in the germline when flies were raised at 29 °C. For mtDNA FISH, at least eight control and experimental ovarioles, germaria or testes were imaged for each experimental condition. Imaging parameters are presented in Supplementary Table 3. Here and in all subsequent Extended Data Figs. the greyscale images are non-background-subtracted and unnormalized. Source data

Extended Data Fig. 2 Selection against mutant mitochondrial DNA does not occur in the male germline.

ad, Testes of heteroplasmic (Het) flies that were shifted to 18 °C for 7 days (a, c) or maintained at 29 °C (b, d) hybridized with fluorescent probes that detect either wild-type D. yakuba (green) or mutant D. melanogaster (magenta) genomes. The higher magnification images in c and d include the stem cells and spermatogonial cysts. Selection against mutant mtDNA is not observed in testes of flies raised at the restrictive temperature (29 °C). e, Scatter plots showing the percentage of mutant mtDNA, as assayed by qPCR, of adult ovaries (n = 5) and testes of heteroplasmic flies raised at 29 °C (n = 5), and of adult testes of heteroplasmic flies shifted to 18 °C for 7 days (n = 5). The mtDNA qPCR data throughout are presented as medians with interquartile range and compared by two-tailed unpaired t-tests. In Supplementary Table 2, we also present 95% confidence intervals of the difference between the control and experimental means for all datasets and the number of biologically independent samples used to derive the statistics. The dashed line denotes the percentage mutant mtDNA in whole adult-female carcasses lacking ovaries. All testes are oriented with the stem-cell niche towards the left. Source data

Extended Data Fig. 3 Selection manifests in germline cyst cells and does not occur when cyst formation is blocked.

a, b, Germaria of heteroplasmic females (Het), raised at 29 °C, were hybridized with fluorescent probes that detect either wild-type D. yakuba or mutant D. melanogaster mtDNA, and reacted with anti-Vasa antisera to mark the germline (aa‴) or anti-Hts (1B1) antisera to mark the fusome and somatic cells (bb‴). The dashed outlines delineate the germline in the germarium (a), and egg chambers surrounded by somatic follicle cells (a, b). Wild-type mtDNA (arrows) can first be strongly detected in cysts. cc‴, A germarium of a heteroplasmic fly (Het), raised at 29 °C, in which cyst formation was blocked by expression of an RNAi against bag-of-marbles (Bam; UAS-bam shRNA TRiP.HMJ22155) in the germline under the control of nos-GAL4. The germarium was hybridized with fluorescent probes directed against wild-type (c, c‴) and mutant mtDNAs (c′, c‴) and reacted with anti-Vasa antisera to mark the germline (c″). No increase in wild-type mtDNA is observed. dd‴, A germarium of a heteroplasmic fly, raised at 29 °C, hybridized with fluorescent probes that detect either wild-type D. yakuba mtDNA (d, d‴) or mutant D. melanogaster mtDNA (d′, d‴), and reacted with anti-Orb antisera (d″, blue in d‴) to demarcate all cells of the developing cysts and the oocyte in later egg chambers. Arrows in d and d‴ point to wild-type mtDNA, and dashed outlines delineate the germline in the egg chambers. e, Scatter plots showing the relative amounts of wild-type D. yakuba and mutant D. melanogaster mtDNA, as assayed by FISH, in cysts (n = 7) and egg chambers (EC, n = 6) compared to the amount in stem cells (SC, n = 7). f, Scatter plot showing percentage of mutant mtDNA, as assayed by qPCR, of control (Ctrl; nos-GAL4 driving UAS-mCherry RNAi) heteroplasmic ovaries (n = 5) and of heteroplasmic ovaries in which cyst formation was blocked by the knockdown of bam (Bam KD; n = 5). Here and in all subsequent images, ovarioles are oriented with the stem-cell niche towards the left. Source data

Extended Data Fig. 4 Expression of the C. intestinalis alternative oxidase (AOX) rescues mutant mitochondria.

a, In wild-type mitochondria the electron transport chain complexes (I–IV) that reside in the inner mitochondrial membrane couple the transfer of electrons to the transfer of protons across the membrane. The resulting proton motive force drives the synthesis of ATP by complex V. b, At the restrictive temperature the CoIts mutation blocks the transfer of electrons through complex IV (cytochrome oxidase, purple) resulting in the absence of both the generation of a proton motive force and ATP production. c, AOX (yellow) catalyses the transfer of electrons from ubiquinone to molecular oxygen, bypassing complexes III and IV. This restores the transfer of protons at complex I and the generation of ATP. d, Scatter plot of the amount of mutant D. melanogaster (purple) and wild-type D. yakuba (green) mtDNA, as assayed by qPCR, in ovaries expressing AOX under the control of nos-GAL4, normalized to the amount of mutant and wild-type mtDNA in control ovaries (Ctrl) expressing mCherry RNAi (Ctrl, n = 20; AOX, n = 23). Expression of AOX rescues the mutant genomes. Source data

Extended Data Fig. 5 Mitochondrial fragmentation is necessary for germline mitochondrial DNA selection.

ac, Stills of live images illustrating the effect that overexpressing Mitofusin (b) or reducing the expression of Drp1 (c) in the germline has on the morphology of mitochondria compared to controls (a, nos-GAL4 driving UAS-mCherry RNAi; the stills in Fig. 2c, d are higher magnifications of this image). When Mitofusin is overexpressed (nos-GAL4 driving UAS-marf47), or when the expression of Drp1 is reduced (nos-GAL4 driving UAS-Drp1.miRNA.CDS48), the mitochondria in the cysts are no longer discrete as they are in control cysts. The mitochondria (white) were labelled with a mitochondrially targeted eYFP and cell membranes (blue) were labelled with CellMask Deep Red Plasma membrane Stain. Stem cells and cysts are outlined in red. dd′, d″, Germarium of a control heteroplasmic female (nos-GAL4 driving UAS-mCherry RNAi), raised at 29 °C, hybridized with fluorescent probes that detect either wild-type D. yakuba mtDNA (greyscale in d; green in d″) or mutant D. melanogaster mtDNA (greyscale in d′; magenta in d″). Selection for wild-type mtDNA is observed as indicated by the arrows in d and d″. ee′, e″, ff′, f″, Selection for wild-type mtDNA is no longer observed when Mitofusin (Mfn) is overexpressed (nos-GAL4 driving UAS-marf) or when the expression of Drp1 is reduced (nos-GAL4 driving UAS-Drp1.miRNA.CDS). Wild-type D. yakuba mtDNA, greyscale in e, f, green in e″, f″; mutant D. melanogaster mtDNA, greyscale in e′, f′, magenta in e″, f″. The dashed outlines delineate the germline. g, Scatter plot showing the percentage of mutant D. melanogaster mtDNA, as assayed by qPCR, in carcasses (carc.) and ovaries of heteroplasmic flies in which the wild-type mtDNA was either from D. yakuba or D. melanogaster. mCherry RNAi was expressed in the ovaries under control of nos-GAL4. h, Scatter plot of the amount of mutant D. melanogaster (purple) and wild-type D. yakuba (green) mtDNA, as assayed by qPCR, of young embryos laid by heteroplasmic females in which Mitofusin was overexpressed in the germline (Mfn OE, n = 4) normalized to the amount of mutant and wild-type mtDNA in young embryos laid by control heteroplasmic females (Ctrl; nos-GAL4 driving UAS-mCherry RNAi, n = 4). i, Same as g, except the analysis was performed on ovaries in which both wild-type and mutant mtDNAs were from D. melanogaster (Ctrl, n = 24; Mfn OE, n = 21). Mitofusin overexpression increases the levels of mutant mtDNA. Source data

Extended Data Fig. 6 Mitochondrial fragmentation is sufficient for germline mitochondrial DNA selection.

a, b, Stills of live images illustrating the effect that reducing the expression of Mitofusin in the germline (b) has on the morphology of mitochondria compared to controls (a). When mitofusin is knocked down (nos-GAL4 driving UAS-mfn shRNA2 TRiP.HMC0388332) the mitochondria in the stem cells are fragmented. The mitochondria (white) were labelled with a mitochondrially targeted eYFP and cell membranes (blue) were labelled with CellMask Deep Red Plasma membrane Stain. Stem cells and cysts are outlined in red. c, c′, c″, c‴, The knockdown of mitofusin in the germline by expressing mitofusin RNAi (nos-GAL4 driving UAS-mfn shRNA2 TRiP.HMC03883) results in selection for wild-type mtDNA (green) occurring in stem cells. The germarium was also reacted with anti-Vasa antiserum (c″) to mark the germline and delineate the stem cells and cysts. Wild-type D. yakuba mtDNA, greyscale in c, green in c‴; mutant D. melanogaster mtDNA, greyscale in c′, magenta in c‴. Mutant mtDNA is readily detected in the soma but not in the germline. d, Scatter plot comparing the percentage of mutant mtDNA, as assayed by qPCR, of ovaries in which mitofusin was weakly knocked down in the germline (Mfn KD; nos-GAL4 driving UAS-mfn long hairpin RNA1 TRiP.JF0165049; Ctrl, n = 23; Mfn KD, n = 24) and of ovaries in which Drp1 was overexpressed in the germline (Drp1 OE; nos-GAL4 driving UAS-Drp1.E; Ctrl, n = 11; Drp1 OE, n = 11). The percentage of mutant mtDNA in each case was normalized to the percentage of mutant mtDNA in control ovaries to illustrate that the overexpression of Drp1 enhances selection to a similar extent as does a weak reduction in the expression of Mitofusin. e, Scatter plot of the amount of mutant D. melanogaster (purple) and wild-type D. yakuba (green) mtDNA, as assayed by qPCR, in ovaries in which the expression of Mitofusin was weakly reduced (Ctrl, n = 20; Mfn OE, n = 21) or in which Drp1 was overexpressed in the germline (Ctrl, n = 10; Drp1 OE, n = 10), normalized to the amount of mutant and wild-type mtDNA in control ovaries (Ctrl) expressing mCherry RNAi in the germline. Reducing the expression of Mitofusin or overexpressing Drp1 results in a decrease in mutant mtDNA. fh, The effect of germline overexpression of Mitofusin (Mfn) and Drp1 on copy number (f), ATP levels (g), and mitochondrial motility (h) in homoplasmic wild-type D. melanogaster ovaries (see Supplementary Note 1). f, Scatter plot of the amount of mtDNA, as assayed by qPCR, in homoplasmic ovaries in which Mfn (n = 24) or Drp1 (n = 24) was overexpressed in the germline, normalized to the amount of mtDNA in control ovaries (Ctrl; nos-GAL4 driving UAS-mCherry RNAi, n = 23). g, Scatter plot of the amount of ATP in homoplasmic ovaries overexpressing Mfn (n = 5) or Drp1 (n = 5) in the germline under control of Maternal α-Tubulin Gal4, normalized to the amount of ATP in control ovaries (Ctrl; Maternal α-Tubulin Gal4 driving UAS-mCherry RNAi, n = 5). h, Scatter plot of mitochondrial motility in homoplasmic ovaries overexpressing Mfn (n = 5) or Drp1 (n = 5) in the germline. Motility was assessed by measuring mean mitochondrial displacement using live confocal microscopy and Imaris analysis software. Source data

Extended Data Fig. 7 Mitofusin is downregulated in germline cysts.

aa′, a″, a‴, A germarium of a female fly expressing haemagglutinin-tagged Mitofusin (Mfn), under control of the Mitofusin promoter (Marf-gHA48), and mitochondrially targeted eYFP (mito-eYFP50), was reacted with anti-haemagglutinin antisera to detect Mitofusin (a), anti-GFP antisera to detect mitochondria (a′) and anti-Vasa antisera to delineate the germline (a″). In a‴, the ratio of the levels of Mitofusin to mito-eYFP is presented in pseudocolour. The colours correspond to the ratios indicated on the pseudocolour bar. The dashed red circles outline the cysts and the dashed white circles demarcate the germline in the egg chambers. b, Scheme for quantifying the levels of mitofusin RNA at different time points during early oogenesis. Females mutant for the differentiation factor Bam—which is required for cyst formation—and carrying a rescuing transgene expressing Bam under the control of a heat-shock promoter were heat-shocked at 37 °C for 2 h, and then allowed to recover for the indicated times. This enables the isolation of ovaries that contain staged cysts, predominantly at the 2-, 4- or 8-cell cyst stage. The morphology of the spectrosome and fusome, as revealed by staining with anti-Hts (1B1) antisera, was used to confirm the staging. RNA for RT-qPCR was isolated from ovaries from flies before heat shock and at the indicated times following heat shock.

Extended Data Fig. 8 The downregulation of Mitofusin in cysts is not mediated by known regulators of Mitofusin protein.

ah″, Germaria of females expressing haemagglutinin-tagged Mitofusin, under control of the Mitofusin promoter (Marf-gHA48) reacted with anti-haemagglutinin antisera to detect Mitofusin (greyscale in ah, magenta in a″–h″) and anti-Vasa antibody to delineate the germline (greyscale in a′–h′, blue in a″h″). The indicated known regulators of Mitofusin protein levels were knocked down in the germline using RNAi under the control of nos-GAL4. The numbers in parentheses are Bloomington Drosophila Stock Center stock numbers. All ovarioles are oriented with the stem-cell niche towards the left.

Extended Data Fig. 9 Inhibiting mitochondrial fragmentation blocks the decrease in proton motive force and ATP levels in cysts of heteroplasmic flies.

ad, Germaria of heteroplasmic control flies (a, c; w1118) and heteroplasmic flies in which Mitofusin was overexpressed in the germline (b, d; nos-GAL4 driving UAS-marf47), reacted with TMRM to visualize mitochondrial membrane potential (pseudocoloured in a, b) or with antibodies to phosphorylated pyruvate dehydrogenase (PDH P, purple) and pyruvate dehydrogenase (PDH, green) to measure ATP levels (c, d). e, Diagram showing the essential glutamate at position 121 in c-ring subunit that acts as the proton donor and acceptor in the proton translocation pathway. In the dominant negative c-ring (CV-DN) this glutamate was mutated to a glutamine, which can no longer bind the protons. f, Scatter plot illustrating the reduction in ATP/ADP ratio in embryos laid by mothers expressing CV-DN in the germline under the control of Maternal α-Tubulin Gal4. The ratios were measured using an ADP/ATP Ratio Assay Kit (Abcam ab65313). Data presented are median and interquartile range and were analysed using paired t-tests (ATP, n = 5; ADP, n = 4; ATP/ADP, n = 4). g, Blue native polyacrylamide gel illustrating that the expression of the dominant negative inhibitor of complex V (CV-DN) does not disrupt the Complex V dimer. For gel source data, see Supplementary Fig. 1. Source data

Extended Data Fig. 10 The mitophagy proteins Atg1 and BNIP3 are necessary for germline mitochondrial DNA selection.

ad″, Germaria of a control heteroplasmic female (a, a″; nos-GAL4 driving UAS-mCherry RNAi) and of heteroplasmic females in which the expression of Atg1 (b, b″), Atg8a (c, c″) or BNIP3 (d, d″) was reduced in the germline, raised at 29 °C, hybridized with fluorescent probes that detect either wild-type D. yakuba mtDNA (greyscale in ad, green in a″–d″) or mutant D. melanogaster mtDNA (greyscale in a′d′, magenta in a″d″). The dashed circles demarcate the germline in the early egg chambers. The arrows point to wild-type mtDNA. e, f, Scatter plots showing the percentage of mutant mtDNA and the amount of mutant (magenta) and wild-type (green) mtDNA, as assayed by qPCR, of control heteroplasmic ovaries (Ctrl, n = 24 in e, f) and of ovaries in which the expression of Atg1was reduced in the germline (Atg1 KD, n = 24 in e; n = 23 in f). In the left panel in f, the amount of mutant and wild-type mtDNA of heteroplasmic ovaries overexpressing Mitofusin (Mfn OE) is plotted to illustrate that overexpressing Mitofusin primarily inhibits selection by increasing the amount of mutant mtDNA, whereas reduced expression of Atg1 primarily inhibits selection by decreasing the amount of wild-type mtDNA. The control and Mitofusin-overexpression data are the same as that presented in Extended Data Fig. 5h. All the dissections and analyses were carried out at the same time. The right panel of f is a magnified view to illustrate the effect of reducing the expression of Atg1 on the level of wild-type mtDNA. In e and f, both wild-type and mutant mtDNAs were from D. melanogaster. Source data

Supplementary information

Supplementary Information

This file contains Supplementary Note 1 and Supplementary Note 2: References for Supplementary Note 1 and Supplementary Table 1.

Reporting Summary

Supplementary Figures

This file contains Supplementary Figure 1: gel source data for Extended Data Figure 9g.

Supplementary Table

This file contains Supplementary Table 1: Drosophila stocks.

Supplementary Table

This file contains Supplementary Table 2: Statistical Analysis of qPCR data.

Supplementary Table

This file contains Supplementary Table 3: Microscopy settings and imaging parameters.

Supplementary Table

This file contains Supplementary Table 4: qPCR primers.

Video 1: Mitochondria undergo fragmentation as stem cells differentiate into cysts.

Live imaging of mitochondrial morphology in stem cells and cysts. Mitochondria (white) were labeled with a mitochondrially targeted eYFP and cell membranes (blue) with CellMask™ Deep Red Plasma Membrane Stain. Cysts are outlined in green and stem cells in magenta.

Source data

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Lieber, T., Jeedigunta, S.P., Palozzi, J.M. et al. Mitochondrial fragmentation drives selective removal of deleterious mtDNA in the germline. Nature 570, 380–384 (2019). https://doi.org/10.1038/s41586-019-1213-4

Download citation

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing