Author Correction: Lipid peroxidation regulates long-range wound detection through 5-lipoxygenase in zebrafish

Correction to: Nature Cell Biology https://doi.org/10.1038/s41556-020-0564-2, published online 31 August 2020.

In the version of this Letter originally published, the morpholino sequences in the Methods section ‘morpholino injections’ were incorrect. “One-cell-stage embryos were injected with 2.3 nl of 250–500 μM duox morpholino 1 (MO1: 5′- AAGCGTCACTTACTATAATGTTGGA-3′; Gene Tools) or misprime morpholino (MP: 5′-TCCCTTTTAGAATTTACCTTGCCGA-3′; Gene Tools)², together with 200 μM p53 morpholino (5′-ATGCTCAACTATAATGTTGGACATT-3′; Gene Tools)³⁸ diluted in water” should instead read “One-cell-stage embryos were injected with 2.3 nl of 250–500 μM duox morpholino 1 (MO1: 5′- AGTGAATTAGAGAAATGCACCTTTT-3′; Gene Tools) or misprime morpholino (MP: 5′- AGTcAATTAcAGAAATcCAgCTaTT -3′; Gene Tools)², together with 200 μM p53 morpholino (5′- GCGCCATTGCTTTGCAAGAATTG -3′; Gene Tools)³⁸ diluted in water.” The error has been corrected.