Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Author Correction: Lipid peroxidation regulates long-range wound detection through 5-lipoxygenase in zebrafish

The Original Article was published on 31 August 2020

Correction to: Nature Cell Biology https://doi.org/10.1038/s41556-020-0564-2, published online 31 August 2020.

In the version of this Letter originally published, the morpholino sequences in the Methods section ‘morpholino injections’ were incorrect. “One-cell-stage embryos were injected with 2.3 nl of 250–500 μM duox morpholino 1 (MO1: 5′- AAGCGTCACTTACTATAATGTTGGA-3′; Gene Tools) or misprime morpholino (MP: 5′-TCCCTTTTAGAATTTACCTTGCCGA-3′; Gene Tools)2, together with 200 μM p53 morpholino (5′-ATGCTCAACTATAATGTTGGACATT-3′; Gene Tools)38 diluted in water” should instead read “One-cell-stage embryos were injected with 2.3 nl of 250–500 μM duox morpholino 1 (MO1: 5′- AGTGAATTAGAGAAATGCACCTTTT-3′; Gene Tools) or misprime morpholino (MP: 5′- AGTcAATTAcAGAAATcCAgCTaTT -3′; Gene Tools)2, together with 200 μM p53 morpholino (5′- GCGCCATTGCTTTGCAAGAATTG -3′; Gene Tools)38 diluted in water.” The error has been corrected.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Philipp Niethammer.

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Katikaneni, A., Jelcic, M., Gerlach, G.F. et al. Author Correction: Lipid peroxidation regulates long-range wound detection through 5-lipoxygenase in zebrafish. Nat Cell Biol 23, 566 (2021). https://doi.org/10.1038/s41556-021-00683-0

Download citation

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing