Tight genetic linkage of genes causing hybrid necrosis and pollinator isolation between young species

Li, Chaobin; Binaghi, Marta; Pichon, Vivien; Cannarozzi, Gina; Brandão de Freitas, Loreta; Hanemian, Mathieu; Kuhlemeier, Cris

doi:10.1038/s41477-023-01354-8

Download PDF

Article
Open access
Published: 20 February 2023

Tight genetic linkage of genes causing hybrid necrosis and pollinator isolation between young species

Nature Plants volume 9, pages 420–432 (2023)Cite this article

5719 Accesses
15 Altmetric
Metrics details

Subjects

Abstract

The mechanisms of reproductive isolation that cause phenotypic diversification and eventually speciation are a major topic of evolutionary research. Hybrid necrosis is a post-zygotic isolation mechanism in which cell death develops in the absence of pathogens. It is often due to the incompatibility between proteins from two parents. Here we describe a unique case of hybrid necrosis due to an incompatibility between loci on chromosomes 2 and 7 between two pollinator-isolated Petunia species. Typical immune responses as well as endoplasmic reticulum stress responses are induced in the necrotic line. The locus on chromosome 2 encodes ChiA1, a bifunctional GH18 chitinase/lysozyme. The enzymatic activity of ChiA1 is dispensable for the development of necrosis. We propose that the extremely high expression of ChiA1 involves a positive feedback loop between the loci on chromosomes 2 and 7. ChiA1 is tightly linked to major genes involved in the adaptation to different pollinators, a form of pre-zygotic isolation. This linkage of pre- and post-zygotic barriers strengthens reproductive isolation and probably contributes to rapid diversification and speciation.

On the origin of the widespread self-compatible allotetraploid Capsella bursa-pastoris (Brassicaceae)

Article Open access 19 April 2021

The identification of the Rosa S-locus and implications on the evolution of the Rosaceae gametophytic self-incompatibility systems

Article Open access 12 February 2021

Genome of the early spider-orchid Ophrys sphegodes provides insights into sexual deception and pollinator adaptation

Article Open access 26 July 2024

Main

Speciation depends on the evolution of reproductive barriers that reduce gene flow between previously interbreeding populations^1,2,3. In plants, pollinator-mediated isolation constitutes a crucial pre-zygotic isolation barrier⁴. The preferences of distinct classes of pollinators for sets of floral traits such as colour, morphology, scent and nectar production are considered a driving force in the rapid diversification of the angiosperms⁵. These matching sets of floral traits are called pollination syndromes. However, pollinator preference for a flower type is rarely absolute, and hybridization between (incipient) species is often observed. Thus, plant speciation generally involves the accumulation of multiple reproductive barriers³.

In plants, hybrid necrosis (HN) is a post-zygotic isolation barrier in which hybrids show necrotic leaves and poor growth^6,7. Many of the reported cases were caused by deleterious epistatic interactions between alleles at two or more loci, creating a post-mating barrier that reduces fitness in the hybrids but not in the parents⁸. HN often involves genes encoding components of the immune system^9,10. For instance, many reported cases of HN in Arabidopsis are due to improper combinations of nucleotide-binding domain leucine-rich repeat (NLR) proteins, which are key players in the immune systems of both plants and vertebrates^11,12,13,14.

We have previously studied the genetic basis of the evolution of pollination syndromes in the South American genus Petunia (Solanaceae). Petunia axillaris (P. axillaris) is widely distributed in southern South America, while Petunia exserta (P. exserta) is a highly endemic species that is found exclusively in shaded shelters in the Guaritas Region of Rio Grande do Sul, Brazil¹⁵. P. axillaris has white, ultraviolet (UV)-absorbent, fragrant flowers and is pollinated by hawkmoths^16,17, while P. exserta has red, scentless flowers with exserted stamens and stigma and is pollinated by hummingbirds^15,18. Single genes underlying major quantitative trait loci (QTLs) for UV absorption (MYB-FL), scent production (CNL1) and pistil length (EOBII) were found to be tightly linked in a so-called supergene region on chromosome 2^19,20,21,22. Such tight genetic linkage is thought to impede the dissolution of pollination syndromes by recombination. The two species are thought to have evolved recently from a common ancestor that was most likely hawkmoth pollinated^23,24,25. Natural hybrids are present in a few locations in the Guaritas Region where the two species are sympatric, showing that reproductive barriers are incomplete^18,25,26.

In this Article, we describe a case of HN in a cross between P. axillaris and P. exserta. The necrotic symptoms are associated with a deleterious combination between two loci located on chromosome 2 and chromosome 7. We show that the locus on chromosome 2 encodes ChiA1, a bifunctional chitinase/lysozyme with a major role in pattern-triggered immunity against fungi and bacteria²⁷. We discuss the potential relevance of the tight linkage of ChiA1 to pre-zygotic isolation barriers.

Results

An introgression line shows necrotic symptoms

The introgression line IL5 is derived from a cross between hawkmoth-pollinated P. axillaris N and hummingbird-pollinated P. exserta²⁸. It segregates for a P. axillaris region of low recombination on chromosome 2 in an otherwise P. exserta background (Fig. 1a). Several major genes affecting pollination syndrome traits were previously identified in this so-called supergene region^19,20,21,22. Unexpectedly, the progenies of IL5 that are homozygous for P. axillaris N at the supergene region (hereafter called IL5-Ax) displayed necrotic symptoms that strongly affect plant growth (Fig. 1b) and flower production (Fig. 1c). IL5-Ex (homozygous for P. exserta at the supergene region) plants were healthy. The necrotic symptoms in IL5-Ax can be observed as early as 38 days after sowing (Extended Data Fig. 1a). The symptoms were also observed in plants heterozygous for the introgression (IL5-Het) but were milder than in the IL5-Ax plants, suggesting semi-dominance (Fig. 1d). Necrosis was associated with the production of reactive oxygen species (ROS) and increased levels of expression of key pathogenesis-related genes (Fig. 1e and Extended Data Fig. 1b,c). These data are consistent with HN, in which an immune response is triggered in the absence of pathogens¹⁰. Endoplasmic reticulum (ER) stress marker genes²⁹, for example, two luminal binding protein coding genes BiP4 and BiP5, and transcription factor bZIP60, were highly induced in the necrotic line (Extended Data Fig. 1d), suggesting ER-stress-induced cell death may play a role in HN development³⁰.

**Fig. 1: IL5 shows necrotic symptoms.**

HN is caused by genetic interaction of two loci

HN often results from incompatibilities between genetic loci that have diverged over time and are brought together in hybrids¹⁰. Such interactions can involve pairs of nuclear genes or nucleo-cytoplasmic interactions^31,32. Therefore, we generated reciprocal F2 populations derived from P. axillaris N and P. exserta to dissect the genetic architecture of HN and identify the loci interacting with the chromosome 2 region. Both populations displayed comparable distributions of HN scores, that is, approximately three-quarters of the plants did not show symptoms and one-quarter of the plants displayed symptoms. The similar distribution of HN scores in the two populations indicates that the loci controlling HN are nuclear, as cytoplasmic inheritance is unidirectional (Fig. 2a,b). Bulked segregant RNA sequencing (BSR-seq) was used to locate the genomic regions causing HN. Strong signals associated with the necrotic phenotype were detected on chromosomes 2 and 7 (Fig. 2c and Extended Data Fig. 2). We named these loci HNe2 and HNe7. The necrosis is triggered by a combination of P. axillaris N alleles at HNe2 and P. exserta alleles at HNe7 (Fig. 2c and Extended Data Fig. 2) in accordance with the genetic make-up of IL5-Ax (Fig. 1a).

**Fig. 2: Genetic mapping of HN between *P. axillaris* N and *P. exserta*.**

Map-based cloning of HNe2

To reduce the interval carrying HNe2, a fine-mapping approach was undertaken through the search of recombinant progenies of IL5-Het. The relationship between the phenotypic segregation of HN and the genotype of the recombinant lines led to a first interval of 8.7 Mb (Fig. 3a and Supplementary Table 1). Then, the recombination breakpoints of ten of the most informative lines were precisely characterized through whole-genome sequencing, resulting in a 1.74 Mb interval (Fig. 3a and Extended Data Fig. 3). As this region still contains 60 genes (Supplementary Table 2), an RNA sequencing (RNA-seq) analysis of leaf tissues from IL5-Ax and IL5-Ex plants was performed to investigate their functional relevance on the basis of expression. Among the 34 expressed genes in the candidate region (read counts >100 in at least one of the samples; Supplementary Table 3), 8 were differentially expressed (q < 0.001) including 4 genes known to play a role in plant–pathogen interactions: ChiA1, ChiA2, FMO1 and CNGC1 (Table 1 and Supplementary Table 4).

**Fig. 3: *HNe2* encodes a chitinase ChiA1.**

Table 1 List of the four best candidate genes underlying HNe2. DEGs that are immune response related were considered. Gene ID, annotation, expression (normalized read counts), q value and alignment results are shown. The en dash indicates no protein sequence change or only amino acid changes found between P. axillaris N and P. exserta. Gene ID and scientific names of the species are italicized

Full size table

Chitinase A1 (ChiA1) is one of the most highly expressed genes in IL5-Ax (Table 1 and Extended Data Fig. 4a) and is annotated as a bifunctional endochitinase³³ (Extended Data Fig. 4b). The protein encoded by ChiA1 is homologous to AtLYS1/ChiA (AT5G24090), which has a central role in triggering immune responses in Arabidopsis²⁷ (Extended Data Fig. 4c). Importantly, ChiA1 carries a nonsense mutation in P. exserta, which leads to a truncated protein of 158 amino acids (Extended Data Fig. 4d,e). ChiA2 is closely related to ChiA1 but shows a much lower expression level than ChiA1 in IL5-Ax (Table 1). Flavin-containing monooxygenase 1 (FMO1) plays key roles in systemic acquired resistance by synthesizing N-OH-Pip from pipecolic acid³⁴. It has two copies in the P. exserta genome, whereas only one copy was present in P. axillaris N. Cyclic nucleotide-gated ion channel 1 (CNGC1) belongs to a gene family involved in plant immunity by triggering calcium signalling and hypersensitive response^35,36.

To functionally validate these four candidates for HNe2, we knocked down their transcript levels in IL5-Ax by virus-induced gene silencing (VIGS)³⁷. VIGS of ChiA1 caused a robust decrease of necrosis in IL5-Ax plants compared with the empty vector or untreated controls (Fig. 3b,c). In contrast, VIGS of ChiA2, FMO1 and CNGC1 showed no significant reductions of symptoms (Fig. 3c). To confirm the role of ChiA1 in HN, we transiently overexpressed ChiA1^Ax (P. axillaris N allele) as well as ChiA1^Ex (P. exserta allele) in IL5-Ex leaves driven by the 35S promoter. ChiA1^Ax was highly expressed, while ChiA1^Ex was barely detectable (Extended Data Fig. 4f). Only leaves overexpressing ChiA1^Ax turned yellow in the region of infiltration (Fig. 3d,e). Thus, the lack of messenger RNA accumulation is post-transcriptional, most likely due to nonsense-mediated decay (NMD)³⁸. Furthermore, we generated a ChiA1 loss-of-function mutant in the IL5-Ax background by clustered regularly interspaced short palindromic repeats (CRISPR)–Cas9. The mutant (chia1-cas9-1) has a 4 bp deletion, leading to a frameshift and a premature stop codon, resulting in a truncated protein of 173 amino acids (instead of the 292 amino acid full length), similar to the protein encoded by ChiA1^Ex (Fig. 3f). The necrotic symptoms were strongly reduced, and plant morphology was similar to IL5-Ex (Fig. 3g,h and Extended Data Fig. 5a,b). The combined results prove beyond reasonable doubt that ChiA1 is the gene underlying HNe2.

HN does not require ChiA1 enzymatic activity

ChiA1 harbours the glycoside hydrolase 18 (GH18) domain and a secretion signal peptide (Extended Data Fig. 4b) and is probably a bifunctional enzyme digesting both chitin and peptidoglycan as the homologous proteins in rubber tree (Hevea brasiliensis) and Arabidopsis^27,39. We observed that chitinase and lysozyme activities were extremely high in IL5-Ax leaves compared with the other lines (Fig. 4a). In the chia1-cas9-1 mutant, these activities were reduced to a level similar to that in IL5-Ex. P. axillaris N plants overexpressing ChiA1 (35S::ChiA1) showed higher activity levels compared with wild-type P. axillaris N. Moreover, the enzyme activities were in line with the transcription levels of ChiA1 (Fig. 4b). These results indicate that ChiA1 is responsible for the high chitinase and lysozyme activities in IL5-Ax leaves.

**Fig. 4: Necrotic symptoms do not depend on pathogens or ChiA1’s glycoside hydrolase activity.**

As ChiA1 degrades microbial cell wall components, we asked whether the necrotic symptoms might be caused by conserved degradation products of microbial cell walls that could act as microbe-associated molecular patterns⁴⁰. When grown under axenic conditions, IL5-Ax plants still developed strong necrotic symptoms (Fig. 4c,d; and Extended Data Fig. 6). This suggests that necrotic symptoms develop in the absence of a microbial substrate for ChiA1. To test whether symptom development relied on ChiA1 enzymatic activity, we generated a ChiA1 mutant in which the critical amino acids D148 and E150 in the glycoside hydrolase active site DXDXE motif are replaced by alanine (Fig. 4e). Mutation of these two amino acids abolishes both chitinase and lysozyme activities^41,42,43 (Extended Data Fig. 7a). IL5-Ex leaves overexpressing either the catalytically inactive ChiA1^{D148A, E150A} or ChiA1^Ax showed strong necrosis at the site of infiltration, whereas the overexpression of ChiA1^Ex and GFP did not induce symptoms (Fig. 4e and Extended Data Fig. 7b,c). These results show that the necrotic symptoms represent a case of autoimmunity that does not rely on the enzymatic activities of ChiA1.

ChiA1-dependent induction of WRKY18 induces necrotic symptoms

Transcriptional reprogramming is an integral part of plant immunity⁴⁴. To better understand the mechanism underlying the activation of the immune system in IL5-Ax, we screened the promoters of the 1,717 differentially expressed genes (DEGs; q < 0.001) between IL5-Ax and IL5-Ex for conserved cis-elements (Supplementary Table 5). A WRKY binding site (Fig. 5a) was present in 60% of the DEG promoters (Supplementary Table 6). WRKY transcription factors are involved in pathogen responses, abiotic stress responses and senescence^45,46. Of all the DEGs encoding WRKY transcription factors, WRKY18 (homologous to AtWRKY18) showed the highest expression level in IL5-Ax, while its expression was negligible in IL5-Ex or P. axillaris N wild-type plant leaves (Fig. 5b). Moreover, AtWRKY18 binds to the typical binding motif in its target genes⁴⁷ (Fig. 5a). Overexpression of WRKY18 induced necrotic symptoms in leaves of IL5-Ex as well as Nicotiana benthamiana (Fig. 5c,d). Importantly, agro-infiltration of 35S::ChiA1^Ax but not 35S::ChiA1^Ex in IL5-Ex leaves induced WRKY18 expression (Figs. 5e and 3d and Extended Data Fig. 4f). We conclude that the massive transcriptional reprogramming observed in IL5-Ax is mediated through ChiA1-dependent induction, most likely indirectly, of one or more WRKY18-type transcription factors.

**Fig. 5: *WRKY18* overexpression induces necrotic symptoms and can be induced by ChiA1.**

The synteny of ChiA1 and MYB-FL is specific to Petunia

ChiA1 is located at the edge of a region of chromosome 2, where recombination in crosses between P. axillaris N and P. exserta is strongly reduced¹⁹ (Fig. 6a). Indeed, ChiA1 is tightly linked (1.63 cM) to MYB-FL, a well-characterized gene inside the supergene that is responsible for the gain and loss of floral UV absorption during evolutionary shifts in pollinator preference²¹ (Fig. 6a and Supplementary Table 7).

**Fig. 6: Tight genetic linkage of *ChiA1* with the pollination syndrome genes and the widespread presence of *ChiA1*^Ax and *ChiA1*^Ex in nature.**

Analysis of ChiA1 and its neighbouring genes showed clear microsynteny between Petunia and the related Solanaceae species Solanum lycopersicum (tomato) and S. tuberosum (potato). However, in both these Solanum species, MYB-FL is not linked to ChiA1 but resides on a different chromosome (Extended Data Fig. 8 and Supplementary Table 8). The exclusive genetic linkage between ChiA1 and MYB-FL in Petunia is consistent with the notion that the ChiA1-mediated HN constitutes a post-zygotic barrier that acts in concert with the pre-zygotic barrier to limit gene flow.

The ChiA1 ^Ex allele is widespread in nature

To analyse the frequencies of the two alleles of ChiA1, we genotyped ChiA1 across the range of the two species (for details, see Supplementary Tables 9 and 10). P. exserta was sampled from 18 sites representing its highly restricted distribution in the Guaritas Region of Brazil. Of the 75 P. exserta accessions genotyped, 58 were homozygous for the nonsense mutation (ChiA1^Ex), 13 were homozygous for the P. axillaris genotype (ChiA1^Ax) and 4 were heterozygous (Fig. 6b, right, Extended Data Fig. 9 and Supplementary Table 9). The overall ChiA1^Ex allele frequency among these accessions was 80% (Fig. 6b, right).

P. axillaris accessions were sampled from multiple locations in Argentina, Uruguay and Brazil, including the regions of sympatry with P. exserta (Fig. 6b, left, red-dashed square). Of the 238 P. axillaris accessions, 173 were homozygous for the P. axillaris allele (ChiA1^Ax), 61 were homozygous for the P. exserta allele (ChiA1^Ex) and 4 were heterozygous (Fig. 6b, left, and Supplementary Table 10). The overall ChiA1^Ax allele frequency among these accessions was 74% (Fig. 6b, left). Sixty-two P. axillaris accessions with the ChiA1^Ex allele are located in the Corrientes and Entre Ríos regions in Argentina (Fig. 6b, solid square in red), which is ~500 km away from the Guaritas Region where P. exserta accessions are exclusively found. These accessions belong to P. axillaris subspecies parodii⁴⁸, which is distinguished from P. axillaris ssp. axillaris mainly by its longer corolla tube⁴⁹.

These results confirm the presence of both ChiA1 alleles in the natural P. axillaris and P. exserta populations. ChiA1^Ex is more present in P. exserta, whereas ChiA1^Ax is more frequent in P. axillaris.

Discussion

We discovered a case of HN in crosses between P. axillaris and P. exserta relying on a deleterious epistatic interaction between the HNe2 and HNe7 loci (Fig. 6c). The gene underlying HNe2 is ChiA1, which encodes a protein with both chitinase and lysozyme activity. ChiA1^Ax allele encodes a functional enzyme, whereas ChiA1^Ex has a nonsense mutation leading to a premature stop codon.

Cases of HN characterized in multiple species often have commonalities: activation of immune responses and the direct participation of immune system components¹⁰. In a well-studied case in tomato, a secreted cysteine protease causes autoimmunity when the allele from a related wild species is present in combination with an avirulence (Avr) receptor of the cultivated tomato^50,51. In this example, however, the protease activity of the enzyme is thought to be essential, whereas replacement of the critical amino acids in the active site of ChiA1 does not interfere with its ability to cause necrosis (Fig. 4e).

If it is not the activity of the protein, by what mechanism does ChiA1 cause necrosis? The level of expression is high for ChiA1^Ax in IL5-Ax but low for the ChiA1^Ex and chia1-cas9-1 alleles. The low expression of ChiA1^Ex and chia1-cas9-1 is mostly probably caused by the mRNA surveillance pathway through the mRNA NMD mechanisms³⁸. In contrast, ChiA1^Ax is one of the most highly expressed genes in the necrotic IL5-Ax background. The high expression of ER stress marker genes in the same background indicates ER stress. Many key pathogenesis-related proteins rely on ER and ER quality control for proper folding and secretion^52,53,54. We propose that the high and chronic demand for the processing of ChiA1 in the ER exceeds the ER quality control working capacity and causes prolonged ER stress and cell death^55,56,57.

Considering the extremely high expression of ChiA1^Ax in the necrotic line, a positive feedback loop between the two interacting loci seems plausible (Fig. 6d). The basal expression of ChiA1^Ax in the necrotic line may trigger the activation of HNe7^Ex (probably via WRKY18), and thus HNe7^Ex induces autoimmunity, which further enhances the expression of ChiA1. In this case, HNe7 may encode an auto-active immune system component (for example, NLR¹⁰). Alternatively, HNe7^Ex activates the expression of ChiA1^Ax, and ChiA1^Ax induces the autoimmunity. In that case, HNe7 might be a transcriptional or post-transcriptional regulator. HNe7 is located in a large region of very low recombination containing close to 1,000 genes, and its identity is not yet known. Thus, the molecular details of the interaction of ChiA1 and HNe7 remain to be determined.

A unique aspect of the work presented here is that ChiA1 is tightly linked to a region of low recombination containing major genes involved in the evolution of pollination syndromes. Among them is MYB-FL, encoding a transcription factor that induces the synthesis of UV-absorbing pigments in the moth-pollinated P. axillaris but was inactivated in the hummingbird pollinated P. exserta^19,21. This genetic linkage is relatively recent, as ChiA1 and MYB-FL are located on different chromosomes in tomato and potato (Extended Data Fig. 8). This association may have served to enhance reproductive isolation during the process of speciation.

Both the ChiA1^Ax and ChiA1^Ex alleles were found in P. axillaris as well as in P. exserta wild accessions collected from multiple sites in South America (Fig. 6b). The presence of ChiA1^Ax in wild P. exserta could be due to introgression⁵⁸. P. axillaris ssp. parodii does not reach the P. exserta region today, and in the past, there were no conditions suitable for P. parodii in Serra do Sudeste, even considering Last Glacial Maximum (~ 22 kya) or mid-Holocene (6 kya)⁵⁹. The presence of ChiA1^Ex in P. axillaris ssp. parodii strongly suggests incomplete lineage sorting⁶⁰, consistent with a function in reproductive isolation during speciation. As chitinases are important in pattern-triggered immunity against pathogens, the loss of ChiA1 function is likely to compromise defence. The potential benefit of the ChiA1^Ex allele in allopatric P. axillaris ssp. parodii populations will need further study. The presence of ChiA1^Ax in P. exserta suggests conditions in which the benefits of pathogen resistance outweigh its effect on reproductive isolation.

Speciation occurs when reproductive barriers accumulate and substantially reduce gene flow between lineages³. Pollinator preference is a strong barrier against gene flow, but it is rarely absolute⁶¹. This is also true for Petunia⁶². Multiple reproductive barriers acting in concert are therefore often needed to complete reproductive isolation^63,64. The genetic linkage of distinct isolation mechanisms would further enhance reproductive isolation and thereby enhance the tempo of diversification and speciation. Such linkage may be a more general phenomenon that can help explain the rapid and successful diversification of the angiosperms.

Methods

Plant materials

P. axillaris N is from the Rostock Botanical Garden (Germany), P. exserta is from R.J. Griesbach (Beltsville, United States). The accessions are maintained by self-fertilization. The introgression line IL5 has been described previously²⁸. Wild accessions of P. axillaris and P. exserta have been described previously^21,23,25,48 and are described further in Supplementary Tables 9 and 10.

Plants were grown in a greenhouse or a growth chamber. Greenhouse plants were grown with additional lighting resulting in 14 h day at 18–25 °C in pots. Plants grown in a growth chamber are under a light:dark regime of 15 h:9 h, at 22 °C:17 °C at 60%–80% relative humidity, in commercial soil (70% Klasman substrate, 15% Seramis clay granules and 15% quartz sand) and fertilized once a week (Plantaktiv, 16+6+26 type K fertilizer, 0.1% concentration).

DAB staining

Diaminobenzidine (DAB) staining was performed according to a previous protocol⁶⁵. After the treatment, the leaf was used for immediate observation or kept at 4 °C.

RNA extraction and quantitative PCR

Total RNA was extracted from leaf tissues using an innuPREP DNA/RNA Mini Kit (Analytik Jena; code 845-KS-20800250). Complementary DNA was synthesized using qScriber cDNA Synthesis Kit (HighQu; code RTK0104). Quantitative PCR reactions were set up with ORA SEE qPCR Green ROX L Mix (HighQu; code QPD0505). The amplification was performed using a QuantStudio 5 Real-Time PCR Instrument (Applied Biosystems). Leaves were sampled from three individual plants for each genotype. We took the seventh-oldest leaves (counting from bottom to up; approximately sixth-newest counting from up to bottom) from the 10-week-old plants as this leaf in IL5-Ax plants starts to show necrotic symptoms at this stage. The data were analysed by the ∆∆Ct method⁶⁶, and normalized by the housekeeping RAN1 gene²¹. Primer pairs for quantitative PCR are listed in Supplementary Table 11.

Leaf yellowness analysis

The ratio of leaf yellow area was calculated on the basis of a previous method with modifications⁶⁷. Briefly, leaves from each plant were removed and photographed on a black background under uniform artificial light conditions with a colour reference card included in each photo. The software Fiji (ImageJ) was used to process the pictures⁶⁸. Total leaf area as well as yellow and green leaf area were measured on the basis of colour thresholds for hue, saturation and brightness values. Only pictures taken in the same session were compared to guarantee light uniformity. To define the hue parameters that identify a region as yellow, we first applied the parameters to the colour reference card in each photo and verified that the yellow areas identified were consistent. The yellow area measured on the colour cards is shown in Extended Data Fig. 10. We then used the hue thresholds to analyse the leaf photos. The Fiji macro outputs a painted version of the photos, where the yellow area measured is shown. We manually verified that this area correctly overlapped the yellow parts of the leaves. Detailed scripts and instructions can be found here: https://github.com/Kuhlemeier-lab/fiji_macros.

BSR-seq and data analysis

We used the method for BSR-seq (a bulk-segregant analysis based on RNA-seq data) published by Soyk et al.⁶⁹ to map the loci responsible for HN. P. axillaris N (mother plant) and P. exserta (pollen donor) were used to produce an F2 population. A total of 384 F2 plants were sown for sampling. On the basis of the phenotypic scale shown in Fig. 2a, we selected plants 13 weeks after sowing showing a strong necrotic leaf phenotype (19 individuals, score 4) or showing a healthy leaf phenotype (89 individuals, score 0). A leaf disc (Ø = 9 mm) from a mature and healthy leaf of each plant was collected, flash frozen in liquid nitrogen and stored at −80 °C. Total RNA was extracted from pools of leaf discs either from the necrotic plants or the healthy plants. RNA-seq was performed by NovoGene with a polyA-enriched library prep, to obtain paired-end reads of 150 bp. Alignment of quality-controlled reads was performed with STAR⁷⁰ (2.6.0c) on the reference genome of P. axillaris N version 4.03. Variants were called using GATK⁷¹ (4.0.4.0). The variants were filtered to keep only high-quality, biallelic single-nucleotide polymorphisms (SNPs) with a minimum read depth of 100 in each sample (using minDP argument in vcftools), and with minimum 100 bp between each variant position. We calculated the difference in alternate allele frequency between the two pools (necrotic - healthy) and used this ∆SNP frequency to define genome-wide thresholds at 0.01 and 0.05 (lower thresholds) and 0.95 and 0.99 (higher thresholds) quantiles. The SNPs were then grouped in stepping windows of 100 SNPs along the genome and the proportion of SNPs with value outside of the genome-wide thresholds in each window was used to produce the main figure. Allele frequency calculations and plotting was performed in R⁷². Detailed parameters, software versions and scripts are deposited on Github: https://github.com/Kuhlemeier-lab/Petunia_hybrid_necrosis#bsr-seq.

Fine mapping using recombinant lines of IL5-Het

As IL5-Het is a near-isogenic line segregating for a chromosome 2 region comprising HNe2 while the rest of the genome is homozygous, we use it as a starting material to search for recombinant lines among its progenies and reduce the size of the interval of interest. We screened 3,800 progenies of IL5-Het with the markers mHIND-cn9140 and mHIND-MYB58 that are flanking the heterozygous region, allowing the identification of 37 recombinant lines (Supplementary Table 1). These lines harbour a smaller heterozygous region compared with IL5-Het that were genotypically characterized with the addition of more genetic markers (Supplementary Tables 1 and 11). Then, phenotypic characterization of homozygous progenies of these recombinant lines allowed the fine mapping of HNe2 down to an 8.7 Mb region (Supplementary Table 1).

To get a better resolution of the recombination breakpoints and reduce the HNe2 locus, ten informative recombinant lines and four controls homozygous for the HNe2 region (two P. axillaris and two P. exserta) were selected for whole genome sequencing (Supplementary Table 1). Genomic DNA extraction from leaf tissue of the selected lines was performed with a modified CTAB method as previously reported⁷³. DNA was sequenced by the Next Generation Sequencing platform of the University of Bern using Illumina whole genome sequencing library preparation to obtain paired-end 150 bp reads. Quality-controlled reads were aligned with BWA MEM default parameters⁷⁴ to the genome of P. axillaris N v. 4.03, providing an average coverage of 3.3 × along the genome. Variants were called and quality filtered with GATK⁷¹. Observation of the genotypes of the variants associated with the HN phenotype in the recombinant lines allowed reduction of the size of the region containing HNe2. The detailed software versions, parameters and scripts are deposited on Github: https://github.com/Kuhlemeier-lab/Petunia_hybrid_necrosis#il-shallow-sequencing.

RNA-seq analysis

IL5-Ax and IL5-Ex plants coming from the same IL5-Het parent were grown for leaf sampling. The leaf displaying the onset of necrosis in IL5-Ax was harvested, and equivalent leaves were sampled for the other genotypes. Three biological replicates from three different plants were set for each genotype. Total RNA was extracted from leaf tissues using an innuPREP DNA/RNA Mini Kit (Analytik Jena; code: 845-KS-20800250). Quality controls were performed using a Nanodrop (NanoDrop 1000, Thermo Fisher) and a fragment analyser (2100 Bioanalyzer Instrument, Agilent). RNA-seq was performed by Lausanne Genomic Technologies Facility (University of Lausanne) with TruSeq stranded RNA library prep to obtain single-end reads of 125 bp. Quality-controlled reads were aligned to the reference genome of P. axillaris version 4.03 using STAR⁷⁰. Read counts were generated with Subread⁷⁵. Differential expression analysis was performed with DESeq2 in R⁷⁶ between IL5-Ax and IL5-Ex (q < 0.001). The detailed software versions, parameters and scripts are deposited on Github: https://github.com/Kuhlemeier-lab/Petunia_hybrid_necrosis#rnaseq.

Phylogenetic analysis

ChiA1 and its homologous sequences from species listed in Extended Data Fig. 4c were identified in the NCBI nr (nonredundant protein sequences) database by performing a BLASTp search with ChiA1 protein sequences (Supplementary Table 12). Amino acid sequences were aligned with MUSCLE in the MEGA-X software package using the default settings for protein multiple alignments. Evolutionary distances were computed using Poisson correction analysis. The bootstrap method with 1,000 replicates for phylogeny testing was used.

Protein structure prediction

The structures of ChiA1 variants were predicted by AlphaFold⁷⁷. The structures were visualized and aligned by PyMOL (Version 2.5.3, Schrödinger LLC).

VIGS

VIGS was performed as described previously²³. For each candidate gene, we targeted a specific part of the coding region to avoid off-targeting (Supplementary Table 11). After amplification with primers containing BamHI and EcoRI restriction sites, these fragments were cloned into the pTRV2-MCS plasmid (ABRC accessions CD3-1040) and transformed into Agrobacterium tumefaciens strain GV3101. Seven weeks after the infection, only leaves from the branches arising from infected meristems were phenotyped.

Transient and stable overexpression

ChiA1^{D148A, E150A} coding sequence was generated by PCR mutagenesis method with ChiA1^Ax as a template. The coding sequences of ChiA1^Ax, ChiA1^{D148A, E150A} and ChiA1^Ex were amplified with primers containing AttB sites (Supplementary Table 11) and cloned into the Gateway-compatible binary vector pGWB402 (Addgene plasmid #74796) containing a CaMV35S promoter. For transient overexpression, the constructs were transformed into Agrobacterium tumefaciens strain GV3101. The Agrobacterium cells were grown to OD₆₀₀ of 0.8, pelleted, and resuspended in infiltration buffer (10 mM methylester sulfonate, 10 mM MgCl₂ and 150 µM acetosyringone, pH 5.7) and infiltrated into 7- or 8-week-old P. exserta or 5-week-old Nicotiana benthamiana plant leaves using a needleless syringe. The phenotype was observed 2 weeks (Petunia) or 5 days (Nicotiana) after the infiltration. Stable transgenic P. axillaris N lines were generated by leaf disc transformation with Agrobacterium tumefaciens strain GV3101 following an adapted protocol²³ based on Conner et al.⁷⁸.

CRISPR–Cas9 editing

CRISPR–Cas9 construct for ChiA1 pHSE401(Neo/Kana)-U6-26p > CHIAb[gRNA#1]-U6-26p>CHIAb[gRNA#2] was ordered from VectorBuilder (https://en.vectorbuilder.com/). gRNA 1: CTCACGTCCACTAGGAGATG, gRNA 2: AGGGAGGGACAGCAGAACAT. The construct was transformed into Agrobacterium tumefaciens strain LBA4404. IL5-Ax CRISPR–Cas9 line was generated with the Agrobacterium by leaf disc transformation following the same protocol for stable transgenic P. axillaris N lines. Editing in the T0 generation was detected by PCR performed on genomic DNA with primers targeting the gRNA sites (Supplementary Table 11) followed by Sanger sequencing.

Protein extraction, chitinase and lysozyme activity measurement

Leaf apoplastic proteins were obtained by vacuum infiltration of 7-week-old Petunia plant leaves (the stage when IL5-Ax plants start to show necrotic symptoms) with activity buffer from Chitinase Assay Kit (abbexa, catalogue: abx298854) or Lysozyme Activity Assay Kit (Fluorometric) (Abcam, catalogue: ab211113). The leaves were dried on a paper towel. Then leaf discs (Ø = 9 mm) were obtained by a hole puncher so that the total area of leaves used for protein extraction could be determined. Twenty-two leaf discs from three plants were pooled as one biological replicate. Afterward, the pooled leaf discs were placed in a 50 ml Falcon tube and spun at 1,000 g for 5 min at 4 °C. Three biological replicates (3 × 22 leaf discs from nine plants) were set for each genotype tested.

Chitinase activity was detected with a Chitinase Assay Kit (abbexa, code: abx298854) following its standard protocol. One unit of chitinase activity was defined as the amount of enzyme required to produce 1 µg of N-acetylglucosamine per hour at 37 °C. Lysozyme activity was detected with Lysozyme Activity Assay Kit (Fluorometric) (Abcam, code: ab211113) following its standard protocol. One unit of lysozyme activity was defined as the amount of enzyme that generates 1.0 μmol of 4-MU per minute at pH 5.0 at 37 °C.

Sterile culture

Transparent 5-litre beakers were used as containers for the sterile culture. The beakers with 1.5 litre commercial soil (70% Klasman substrate, 15% Seramis clay granules and 15% quartz sand) were sealed with aluminium foil and autoclaved at 121 °C for 20 min. Then 500 ml autoclaved water was added to the beaker in a sterile environment under laminar flow. Seeds with the genotype of IL5-Ax and IL5-Ex were sterilized with 1% bleach for 10 min and rinsed in sterile water five times. Then the seeds were sowed in the beakers in a sterile environment. The beakers were sealed with several layers of transparent plastic film and put in the growth chamber. The phenotypes of the leaves were analysed 12 weeks after sowing. Four biological replicates for each genotype were observed with similar results.

Conserved cis-elements screening

One-kilobase promoter sequences (1 kb upstream of translation start codons) of the DEGs were extracted and subjected to the motif discovery by MEME-ChIP⁷⁹ (http://meme-suite.org/tools/meme-chip) with default parameters.

Genotyping

Genotypes of ChiA1 in the wild accessions of P. axillaris and P. exserta were determined by the CAPS marker designed on the nonsense mutation site. The G-to-T mutation in P. exserta allele of ChiA1 impairs the FokI (GGATGN7) restriction enzyme digestion site. CAPS marker primer sequences can be found in Supplementary Table 11. Genotypes of MYB-FL were determined as previously described²¹.

Microsynteny analysis

Sequences of MYB-FL, ChiA1 and its four nearby genes in the genome were BLASTed against the ITAG release 4.0 cDNA library for S. lycopersicum and PGSC DM4.03 cDNA library for S. tuberosum. For detailed gene IDs and coordinates of the genes shown in the microsynteny analysis, see Supplementary Table 8.

Statistical analysis

GraphPad Prism v.6.0.7 and Microsoft Excel 2016 were used for the statistical analyses (one-way analysis of variance (ANOVA) and two-sided Student’s t-test).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

BSR-seq reads have been deposited in the NCBI Sequence Read Archive (SRA) under BioProject PRJNA708139. Shallow whole-genome sequencing reads data have been deposited under BioProject PRJNA705072. RNA-seq reads have been deposited under BioProject PRJNA705649. The P. axillaris N 4.03 genome assembly has been deposited at NCBI GenBank under the accession JANRMM000000000 (https://www.ncbi.nlm.nih.gov/bioproject/?term=JANRMM000000000).

Code availability

All scripts used in this paper have been deposited on Github: https://github.com/Kuhlemeier-lab/Petunia_hybrid_necrosis. Major computations were performed on a SLURM computing cluster (UBELIX http://www.id.unibe.ch/hpc, the HPC cluster at the University of Bern).

References

Coyne, J. A. & Orr, H. A. The evolutionary genetics of speciation. Philos. Trans. R. Soc. Lond. B 353, 287–305 (1998).
Article CAS Google Scholar
Coyne, J.A. & Orr, H.A. Speciation, xiii, 545, 2 p. of plates (Sinauer Associates, 2004).
Rieseberg, L. H. & Willis, J. H. Plant speciation. Science 317, 910–914 (2007).
Article CAS PubMed PubMed Central Google Scholar
Grant, V. Plant Speciation (Columbia Univ. Press, 1981).
Fenster, C. B., Armbruster, W. S., Wilson, P., Dudash, M. R. & Thomson, J. D. Pollination syndromes and floral specialization. Annu. Rev. Ecol. Evol. Syst. 35, 375–403 (2004).
Article Google Scholar
Alcazar, R., Garcia, A. V., Parker, J. E. & Reymond, M. Incremental steps toward incompatibility revealed by Arabidopsis epistatic interactions modulating salicylic acid pathway activation. Proc. Natl Acad. Sci. USA 106, 334–339 (2009).
Article CAS PubMed Google Scholar
Bomblies, K. & Weigel, D. Hybrid necrosis: autoimmunity as a potential gene-flow barrier in plant species. Nat. Rev. Genet. 8, 382–393 (2007).
Article CAS PubMed Google Scholar
Seehausen, O. et al. Genomics and the origin of species. Nat. Rev. Genet. 15, 176–192 (2014).
Article CAS PubMed Google Scholar
Orr, H. A. & Turelli, M. The evolution of postzygotic isolation: accumulating Dobzhansky–Muller incompatibilities. Evolution 55, 1085–1094 (2001).
CAS PubMed Google Scholar
Li, L. & Weigel, D. One hundred years of hybrid necrosis: hybrid autoimmunity as a window into the mechanisms and evolution of plant–pathogen interactions. Annu Rev. Phytopathol. 59, 213–237 (2021).
Article CAS PubMed Google Scholar
Chae, E. et al. Species-wide genetic incompatibility analysis identifies immune genes as hot spots of deleterious epistasis. Cell 159, 1341–1351 (2014).
Article CAS PubMed PubMed Central Google Scholar
Bomblies, K. et al. Autoimmune response as a mechanism for a Dobzhansky–Muller-type incompatibility syndrome in plants. PLoS Biol. 5, e236 (2007).
Article PubMed PubMed Central Google Scholar
Barragan, A. C. et al. A truncated singleton NLR causes hybrid necrosis in Arabidopsis thaliana. Mol. Biol. Evol. 38, 557–574 (2021).
Article CAS PubMed Google Scholar
Maekawa, T., Kufer, T. A. & Schulze-Lefert, P. NLR functions in plant and animal immune systems: so far and yet so close. Nat. Immunol. 12, 817–826 (2011).
Article CAS PubMed Google Scholar
Stehmann, J.R., Lorenz-Lemke, A.P., Freitas, L.B. & Semir, J. in Petunia: Evolutionary, Developmental and Physiological Genetics (eds Gerats, T. & Strommer, J.) 1–28 (Springer New York, 2009).
Galliot, C., Stuurman, J. & Kuhlemeier, C. The genetic dissection of floral pollination syndromes. Curr. Opin. Plant Biol. 9, 78–82 (2006).
Article CAS PubMed Google Scholar
Venail, J., Dell’olivo, A. & Kuhlemeier, C. Speciation genes in the genus Petunia. Philos. Trans. R. Soc. Lond. B 365, 461–468 (2010).
Article Google Scholar
Lorenz-Lemke, A. P. et al. Diversity and natural hybridization in a highly endemic species of Petunia (Solanaceae): a molecular and ecological analysis. Mol. Ecol. 15, 4487–4497 (2006).
Article CAS PubMed Google Scholar
Hermann, K. et al. Tight genetic linkage of prezygotic barrier loci creates a multifunctional speciation island in Petunia. Curr. Biol. 23, 873–877 (2013).
Article CAS PubMed Google Scholar
Amrad, A. et al. Gain and loss of floral scent production through changes in structural genes during pollinator-mediated speciation. Curr. Biol. 26, 3303–3312 (2016).
Article CAS PubMed Google Scholar
Sheehan, H. et al. MYB-FL controls gain and loss of floral UV absorbance, a key trait affecting pollinator preference and reproductive isolation. Nat. Genet. 48, 159–166 (2016).
Article CAS PubMed Google Scholar
Yarahmadov, T., Robinson, S., Hanemian, M., Pulver, V. & Kuhlemeier, C. Identification of transcription factors controlling floral morphology in wild Petunia species with contrasting pollination syndromes. Plant J. 104, 289–301 (2020).
Article CAS PubMed PubMed Central Google Scholar
Berardi, A. E. et al. Complex evolution of novel red floral color in Petunia. Plant Cell 33, 2273–2295 (2021).
Article PubMed PubMed Central Google Scholar
Reck-Kortmann, M. et al. Multilocus phylogeny reconstruction: new insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. 81, 19–28 (2014).
Article PubMed Google Scholar
Segatto, A. L. et al. Nuclear and plastid markers reveal the persistence of genetic identity: a new perspective on the evolutionary history of Petunia exserta. Mol. Phylogenet. Evol. 70, 504–512 (2014).
Article PubMed Google Scholar
Schnitzler, C. K., Turchetto, C., Teixeira, M. C. & Freitas, L. B. What could be the fate of secondary contact zones between closely related plant species? Genet. Mol. Biol. 43, e20190271 (2020).
Article PubMed PubMed Central Google Scholar
Liu, X. et al. Host-induced bacterial cell wall decomposition mediates pattern-triggered immunity in Arabidopsis. eLife 3, e01990 (2014).
Article PubMed PubMed Central Google Scholar
Hermann, K., Klahre, U., Venail, J., Brandenburg, A. & Kuhlemeier, C. The genetics of reproductive organ morphology in two Petunia species with contrasting pollination syndromes. Planta 241, 1241–1254 (2015).
Article CAS PubMed Google Scholar
Iwata, Y., Fedoroff, N. V. & Koizumi, N. Arabidopsis bZIP60 is a proteolysis-activated transcription factor involved in the endoplasmic reticulum stress response. Plant Cell 20, 3107–3121 (2008).
Article CAS PubMed PubMed Central Google Scholar
Howell, S. H. Endoplasmic reticulum stress responses in plants. Annu. Rev. Plant Biol. 64, 477–499 (2013).
Article CAS PubMed Google Scholar
Lee, H. Y. et al. Incompatibility of nuclear and mitochondrial genomes causes hybrid sterility between two yeast species. Cell 135, 1065–1073 (2008).
Article CAS PubMed Google Scholar
Meiklejohn, C. D. et al. An Incompatibility between a mitochondrial tRNA and its nuclear-encoded tRNA synthetase compromises development and fitness in Drosophila. PLoS Genet. 9, e1003238 (2013).
Article CAS PubMed PubMed Central Google Scholar
Lin, W. et al. Genetic-engineering of rice for resistance to sheath blight. Nat. Biotechnol. 13, 686–691 (1995).
Article CAS Google Scholar
Chen, Y. C. et al. N-hydroxy-pipecolic acid is a mobile metabolite that induces systemic disease resistance in Arabidopsis. Proc. Natl Acad. Sci. USA 115, E4920–E4929 (2018).
CAS PubMed PubMed Central Google Scholar
Ma, W., Smigel, A., Verma, R. & Berkowitz, G. A. Cyclic nucleotide gated channels and related signaling components in plant innate immunity. Plant Signal Behav. 4, 277–282 (2009).
Article CAS PubMed PubMed Central Google Scholar
Balague, C. et al. HLM1, an essential signaling component in the hypersensitive response, is a member of the cyclic nucleotide-gated channel ion channel family. Plant Cell 15, 365–379 (2003).
Article CAS PubMed PubMed Central Google Scholar
Lu, R., Martin-Hernandez, A. M., Peart, J. R., Malcuit, I. & Baulcombe, D. C. Virus-induced gene silencing in plants. Methods 30, 296–303 (2003).
Article CAS PubMed Google Scholar
Chang, Y. F., Imam, J. S. & Wilkinson, M. F. The nonsense-mediated decay RNA surveillance pathway. Annu. Rev. Biochem. 76, 51–74 (2007).
Article CAS PubMed Google Scholar
Jekel, P. A., Hartmann, B. H. & Beintema, J. J. The primary structure of hevamine, an enzyme with lysozyme/chitinase activity from Hevea brasiliensis latex. Eur. J. Biochem. 200, 123–130 (1991).
Article CAS PubMed Google Scholar
Yu, X., Feng, B., He, P. & Shan, L. From chaos to harmony: responses and signaling upon microbial pattern recognition. Annu. Rev. Phytopathol. 55, 109–137 (2017).
Article CAS PubMed PubMed Central Google Scholar
van Aalten, D. M. et al. Structural insights into the catalytic mechanism of a family 18 exo-chitinase. Proc. Natl Acad. Sci. USA 98, 8979–8984 (2001).
Article PubMed PubMed Central Google Scholar
Synstad, B. et al. Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase. Eur. J. Biochem. 271, 253–262 (2004).
Article CAS PubMed Google Scholar
Malolepszy, A. et al. A plant chitinase controls cortical infection thread progression and nitrogen-fixing symbiosis. eLife 7, e38874 (2018).
Article PubMed PubMed Central Google Scholar
Aerts, N., Chhillar, H., Ding, P. & Van Wees, S. C. M. Transcriptional regulation of plant innate immunity. Essays Biochem. 66, 607–620 (2022).
Article CAS PubMed PubMed Central Google Scholar
Rushton, P. J., Somssich, I. E., Ringler, P. & Shen, Q. J. WRKY transcription factors. Trends Plant Sci. 15, 247–258 (2010).
Article CAS PubMed Google Scholar
Tsuda, K. & Somssich, I. E. Transcriptional networks in plant immunity. N. Phytol. 206, 932–947 (2015).
Article CAS Google Scholar
Franco-Zorrilla, J. M. et al. DNA-binding specificities of plant transcription factors and their potential to define target genes. Proc. Natl Acad. Sci. USA 111, 2367–2372 (2014).
Article CAS PubMed PubMed Central Google Scholar
Turchetto, C. et al. Diversification in the South American Pampas: the genetic and morphological variation of the widespread Petunia axillaris complex (Solanaceae). Mol. Ecol. 23, 374–389 (2014).
Article CAS PubMed Google Scholar
Steere, W. C. Petunia parodii, a new species of the subgenus Pseudonicotiana from Argentina. J. Pap. Mich. Acad. Sci. Arts Lett. 13, 213–215 (1931).
Google Scholar
Kruger, J. et al. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296, 744–747 (2002).
Article PubMed Google Scholar
Dixon, M. S., Golstein, C., Thomas, C. M., van Der Biezen, E. A. & Jones, J. D. Genetic complexity of pathogen perception by plants: the example of Rcr3, a tomato gene required specifically by Cf-2. Proc. Natl Acad. Sci. USA 97, 8807–8814 (2000).
Article CAS PubMed PubMed Central Google Scholar
Li, J. et al. Specific ER quality control components required for biogenesis of the plant innate immune receptor EFR. Proc. Natl Acad. Sci. USA 106, 15973–15978 (2009).
Article CAS PubMed PubMed Central Google Scholar
Wang, D., Weaver, N. D., Kesarwani, M. & Dong, X. Induction of protein secretory pathway is required for systemic acquired resistance. Science 308, 1036–1040 (2005).
Article CAS PubMed Google Scholar
Simoni, E. B., Oliveira, C. C., Fraga, O. T., Reis, P. A. B. & Fontes, E. P. B. Cell death signaling from endoplasmic reticulum stress: plant-specific and conserved features. Front. Plant Sci. 13, 835738 (2022).
Article PubMed PubMed Central Google Scholar
Kang, Y. W., Jeon, Y. & Pai, H. S. Characterization of cell death induced by NbBPS1 silencing in Nicotiana benthamiana. Mol. Cells 34, 185–191 (2012).
Article CAS PubMed PubMed Central Google Scholar
Liu, J. X. & Howell, S. H. Managing the protein folding demands in the endoplasmic reticulum of plants. N. Phytol. 211, 418–428 (2016).
Article CAS Google Scholar
Moon, J. Y., Lee, J. H., Oh, C. S., Kang, H. G. & Park, J. M. Endoplasmic reticulum stress responses function in the HRT-mediated hypersensitive response in Nicotiana benthamiana. Mol. Plant Pathol. 17, 1382–1397 (2016).
Article CAS PubMed PubMed Central Google Scholar
Turchetto, C. et al. Contact zones and their consequences: hybridization between two ecologically isolated wild Petunia species. Bot. J. Linn. Soc. 190, 421–435 (2019).
Google Scholar
Giudicelli, G. C., Turchetto, C., Silva-Arias, G. A. & Freitas, L. B. Influence of climate changes on the potential distribution of a widespread grassland species in South America. Perspect. Plant Ecol. Evol. Syst. 41, 125496 (2019).
Article Google Scholar
Mailund, T., Munch, K. & Schierup, M. H. Lineage sorting in apes. Annu Rev. Genet. 48, 519–535 (2014).
Article CAS PubMed Google Scholar
Baack, E., Melo, M. C., Rieseberg, L. H. & Ortiz-Barrientos, D. The origins of reproductive isolation in plants. N. Phytol. 207, 968–984 (2015).
Article Google Scholar
Brandenburg, A., Kuhlemeier, C. & Bshary, R. Hawkmoth pollinators decrease seed set of a low-nectar Petunia axillaris line through reduced probing time. Curr. Biol. 22, 1635–1639 (2012).
Article CAS PubMed Google Scholar
Butlin, R. K. & Smadja, C. M. Coupling, reinforcement, and speciation. Am. Nat. 191, 155–172 (2018).
Article PubMed Google Scholar
Christie, K. & Strauss, S. Y. Reproductive isolation and the maintenance of species boundaries in two serpentine endemic Jewelflowers. Evolution 73, 1375–1391 (2019).
Article PubMed Google Scholar
Daudi, A. & O’Brien, J. A. Detection of hydrogen peroxide by DAB staining in Arabidopsis leaves. Bio Protoc. 2, e263 (2012).
Article PubMed Google Scholar
Winer, J., Jung, C. K., Shackel, I. & Williams, P. M. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem. 270, 41–49 (1999).
Article CAS PubMed Google Scholar
Laflamme, B., Middleton, M., Lo, T., Desveaux, D. & Guttman, D. S. Image-based quantification of plant immunity and disease. Mol. Plant Microbe Interact. 29, 919–924 (2016).
Article CAS PubMed Google Scholar
Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682 (2012).
Article CAS PubMed Google Scholar
Soyk, S. et al. Variation in the flowering gene SELF PRUNING 5G promotes day-neutrality and early yield in tomato. Nat. Genet. 49, 162–168 (2017).
Article CAS PubMed Google Scholar
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).
Article CAS PubMed Google Scholar
Van der Auwera, G. A. et al. From FastQ data to high-confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Curr. Protoc. Bioinform. 43, 1–33 (2013).
R: A language and environment for statistical computing (R Core Team, 2013).
Esfeld, K. et al. Pseudogenization and resurrection of a speciation gene. Curr. Biol. 28, 3776–3786 e7 (2018).
Article CAS PubMed Google Scholar
Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754–1760 (2009).
Article CAS PubMed PubMed Central Google Scholar
Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930 (2014).
Article CAS PubMed Google Scholar
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Article PubMed PubMed Central Google Scholar
Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).
Article CAS PubMed PubMed Central Google Scholar
Conner, A.J., Albert, N.W. & Deroles, S.C. in Petunia: Evolutionary, Developmental and Physiological Genetics (eds Gerats, T. & Strommer, J.) 395–409 (Springer New York, 2009).
Machanick, P. & Bailey, T. L. MEME-ChIP: motif analysis of large DNA datasets. Bioinformatics 27, 1696–1697 (2011).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank T. Nuernberger for critical reading of the manuscript, M. Chopy and D. Bonnet for helpful discussion and proofreading, T. Mandel and L. Lebeigle for technical support and C. Ball, J. Sekulovski and S. Dolder for expert care of the plants. This work was supported by grants from the Swiss National Science Foundation (31003A_182340 to C.K.) and the European Union (ERC AdG 741354-RESPEC to C.K.).

Funding

Open access funding provided by University of Bern.

Author information

Vivien Pichon
Present address: Department of Biology, University of Fribourg, Fribourg, Switzerland
Gina Cannarozzi
Present address: Chemistry/Biology/Pharmacy Information Center, ETH Zürich, Zürich, Switzerland
These authors jointly supervised this work: Mathieu Hanemian, Cris Kuhlemeier.

Authors and Affiliations

Institute of Plant Sciences, University of Bern, Bern, Switzerland
Chaobin Li, Marta Binaghi, Vivien Pichon, Gina Cannarozzi, Mathieu Hanemian & Cris Kuhlemeier
Department of Genetics, Laboratory of Molecular Evolution, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil
Loreta Brandão de Freitas
Laboratoire des Interactions Plantes-Microbes-Environnement (LIPME), INRAE, CNRS, Université de Toulouse, Castanet-Tolosan, France
Mathieu Hanemian

Authors

Chaobin Li
View author publications
You can also search for this author in PubMed Google Scholar
Marta Binaghi
View author publications
You can also search for this author in PubMed Google Scholar
Vivien Pichon
View author publications
You can also search for this author in PubMed Google Scholar
Gina Cannarozzi
View author publications
You can also search for this author in PubMed Google Scholar
Loreta Brandão de Freitas
View author publications
You can also search for this author in PubMed Google Scholar
Mathieu Hanemian
View author publications
You can also search for this author in PubMed Google Scholar
Cris Kuhlemeier
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

C.K., M.H. and C.L. conceived the study, designed the experiments and analysed the data. C.L. and M.H. performed plant-related experiments. M.B. developed the scripts and processed the high-throughput sequencing data. V.P. performed ROS analysis and provided technical support. G.C. performed protein structure modelling and genome assembly. L.B.d.F. performed field work and contributed the materials. C.L. and C.K. wrote the paper with contributions from all authors.

Corresponding authors

Correspondence to Mathieu Hanemian or Cris Kuhlemeier.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Plants thanks Elena Kramer and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 Characterization of IL5-Ax plants.

a, Plant phenotype of IL5-Ax and IL5-Ex at different days after sowing (DAS). b, Assessment of ROS production using DAB staining of a representative 5 weeks old IL5-Ex plant. DAB was oxidized by hydrogen peroxide (ROS) and stained in brown. The experiment was repeated once with similar results (n = 2). c, Quantitative RT-PCR showing the expression levels of pathogenesis-related genes PR1, PR1B1, and PTI5 in leaves of 10 weeks old P. axillaris N, IL5-Ax, IL5-Ex, and IL5-Het plants. Data are presented as mean values ± s.d. of three biological replicates (n = 3). Different letters indicate significant differences (P < 0.05, one-way ANOVA, Tukey’s HSD test); For P values, see Source Data. d, Quantitative RT-PCR showing the expression levels of ER-stress marker genes BiP4, BiP5, and bZIP60 in leaves of 10 weeks old P. axillaris N, IL5-Ax, IL5-Ex, and IL5-Het plants. Data are presented as mean values ± s.d. of three biological replicates (n = 3). Different letters indicate significant differences (P < 0.05, one-way ANOVA, Tukey’s HSD test); for P values, see Source Data.

Source data

Extended Data Fig. 2 Raw ΔSNP frequency between the necrotic and healthy group for BSR-seq.

Dots represent the difference in frequency between the groups for each SNP. A y value higher than 0 indicates a higher frequency of the P. exserta allele in the necrotic group. This trend is observed in large part of Chr 7. A y value lower than 0 indicates a higher frequency of the P. axillaris N allele in the necrotic group. This trend is observed in large part of Chr 2. Blue lines represent the Loess smoothing, with 0.95 confidence intervals represented in light grey. Dashed lines indicate 0.01 and 0.99 genome-wide quantile value, while dash-dotted lines indicate the 0.05 and 0.95 quantile value.

Extended Data Fig. 3 Positional cloning using shallow sequencing of ten informative recombinant lines.

Schematic showing the genotypes of the most informative SNP markers obtained from shallow sequencing of ten informative recombinant lines (Fig. 3a and Supplementary Table 1). Red color indicates the genotype of the sample at the specified SNP is homozygous for P. exserta; yellow color indicates the genotype of a sample at the specified SNP is homozygous for P. axillaris N. The black frame indicates the region associated with the HN phenotype in the fine mapping.

Extended Data Fig. 4 Expression analysis, domain annotation, and phylogenetic analysis of ChiA1 and confirmation of the nonsense mutation of ChiA1 in P. exserta.

a, Quantitative RT-PCR showing the transcription of ChiA1 in P. axillaris N, IL5-Ax. IL5-Ex, and IL5-Het leaves. Data are presented as mean values ± s.d. of three biological replicates (n = 3). Different letters indicate significant differences (P < 0.05, one-way ANOVA, Tukey’s HSD test); for P values, see Source Data. b, Domain annotation of ChiA1 suggesting it is a glycoside hydrolase (GH18) bifunctional chitinase with a secretion signal peptide (SP). c, Phylogenetic relationships of ChiA1 and its homologs in some other species. Distances were estimated using the neighbor-joining algorithm. The numbers at the nodes represent their confidence level, shown as a percentage from 1,000 bootstraps. The scale bar indicates the average number of amino acid substitutions per site. The Arabidopsis thaliana homolog was used as an outgroup. d, Nonsense mutation in ChiA1 P. exserta allele. The upper panel shows the schematic representation of ChiA1 with the G to T nonsense mutation. The mutated site is indicated by a triangle. Thin line indicates the intron. Black boxes indicate the exons. White boxes indicate the untranslated regions. The lower panel shows the Sanger sequencing confirming the G to T mutation of ChiA1 in P. exserta. Asterisk indicates the translation stop codon. e, Structure models of ChiA1^Ax and ChiA1^Ex predicted by AlphaFold. Protein sequences of ChiA1^Ax and ChiA1^Ex are used for the structure prediction. f, Quantification of ChiA1 expression levels in IL5-Ex plant leaves transiently overexpressing ChiA1^Ax, ChiA1^Ex, GFP, or negative controls. Data are presented as mean values ± s.d. (n = 9 leaves for each treatment). Different letters indicate significant differences (P < 0.05, one-way ANOVA, Tukey’s HSD test); for P values, see Source Data.

Source data

Extended Data Fig. 5 Detailed phenotype of chia1-cas9-1 in IL5-Ax compared with IL5-Ax and IL5-Ex.

a, Plant phenotype of chia1-cas9-1 in IL5-Ax compared with IL5-Ax and IL5-Ex at different weeks after sowing. b, Leaf phenotype of chia1-cas9-1 in IL5-Ax compared with IL5-Ax and IL5-Ex. The leaf phenotype was photographed at 13 weeks after sowing. Bar, 1 cm.

Extended Data Fig. 6 Detailed phenotype of IL5-Ax and IL5-Ex in sterile culture.

Sterile culture of IL5-Ax and IL5-Ex in a sealed transparent beaker (left) and one representative leaf from each of IL5-Ex and IL5-Ax plants in sterile culture (right). Bar, 1 cm.

Extended Data Fig. 7 ChiA1 catalytic activity is not required for necrosis induction.

a. Chitinase and lysozyme activity in leaf tissues transiently overexpressing ChiA1^Ax, ChiA1^Ex, or ChiA1^{D148A, E150A} in 7 weeks old IL5-Ex background, with the overexpression of GFP, infiltration buffer, or untreated plant leaves as controls. For each genotype, 9 plants were used and were grouped into 3 for replicates. Sixty-six leaf discs were sampled from each group to unify the total leaf area used. Data are presented as mean values ± s.d. Different letters indicate significant differences (P < 0.05, one-way ANOVA, Tukey’s HSD test); for P values, see Source Data. b, Phenotype of IL5-Ex leaves transiently overexpressing ChiA1^{D148A, E150A}, ChiA1^Ax, ChiA1^Ex, and GFP with three biological replicates. The 35S promoter was used for the overexpression. ChiA1^Ex and GFP were used as controls. 7 or 8 weeks old IL5-Ex plant leaves were used for agro-infiltration. Photos were taken 2 weeks after the infiltration. Bar, 1 cm. c. Quantification of ChiA1 expression levels in IL5-Ex plant leaves transiently overexpressing ChiA1^Ax, ChiA1^Ex, ChiA1^{D148A, E150A}, GFP, or negative controls. Data are presented as mean values ± s.d. (n = 4 leaves for each treatment). Different letters indicate significant differences (P < 0.05, one-way ANOVA, Tukey’s HSD test); for P values, see Source Data.

Source data

Extended Data Fig. 8 Microsynteny of ChiA1 with its nearby genes and physical coordinates of ChiA1 and MYB-FL in P. axillaris N, S. lycopersicum and S. tuberosum.

The genomic sequences of ChiA1 and its four nearby genes, as well as MYB-FL gene were used for a BLAST search against P. axillaris N, S. lycopersicum, and S. tuberosum genomes. Detailed gene accession numbers, coordinates, and genome versions can be found in Supplementary Table 8 and Methods section.

Extended Data Fig. 9 Allele frequency of ChiA1 in the P. exserta wild accessions with a higher resolution.

Red squared region was zoomed in in the right panel. Its regional allele frequency is shown as a pie chart on the top left corner. Yellow color indicates ChiA1^Ax allele. Red color indicates ChiA1^Ex allele. For detailed genotypes and location information, see Supplementary Table 9.

Extended Data Fig. 10 Consistency of picture light condition.

The consistency of the yellow areas identified through each set of pictures from Fig. 3c (a), 3e (b), 3h (c), 4d (d) was validated using the color card included in each picture.

Supplementary information

Reporting Summary

Supplementary Table 1

Supplementary Table 1. Fine mapping of HNe2 using recombinant lines derived from IL5-Het. Supplementary Table 2. List of genes inside the final HNe2 region. Supplementary Table 3. Expression level (normalized read counts) of the genes present in the HNe2 region. Supplementary Table 4. Features of the 34 expressed genes present in the HNe2 region. Supplementary Table 5. List of all the genes differentially expressed between IL5-Ax and IL5-Ex plant leaves. Supplementary Table 6. List of DEGs between IL5-Ax and IL5-Ex leaves that carry a WRKY binding site(s) shown in Fig. 5a in the promoter regions. Supplementary Table 7. Genetic distance between ChiA1 and MYB-FL analysed by an F2 population of 369 individuals. Supplementary Table 8. Gene ID and coordinates of the genes used in the microsynteny analysis. Supplementary Table 9. Detailed information of individuals in the P. exserta wild accessions. Supplementary Table 10. Detailed information of individuals in the P. axillaris wild accessions. Supplementary Table 11. Primer list. Supplementary Table 12. Protein IDs and sequences used in phylogenetic analysis of ChiA1.

Source data

Source Data Fig. 1

Statistical source data.

Source Data Fig. 3

Statistical source data.

Source Data Fig. 4

Statistical source data.

Source Data Fig. 5

Statistical source data.

Source Data Extended Data Fig. 1

Statistical source data.

Source Data Extended Data Fig. 4

Statistical source data.

Source Data Extended Data Fig. 7

Statistical source data.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Li, C., Binaghi, M., Pichon, V. et al. Tight genetic linkage of genes causing hybrid necrosis and pollinator isolation between young species. Nat. Plants 9, 420–432 (2023). https://doi.org/10.1038/s41477-023-01354-8

Download citation

Received: 01 September 2022
Accepted: 19 January 2023
Published: 20 February 2023
Issue Date: March 2023
DOI: https://doi.org/10.1038/s41477-023-01354-8

This article is cited by

Maximization through optimization? On the relationship between hybrid performance and parental genetic distance
- Tobias Würschum
- Xintian Zhu
- Hans Peter Maurer
Theoretical and Applied Genetics (2023)

Subjects

Abstract

Similar content being viewed by others

Main

Results

An introgression line shows necrotic symptoms

HN is caused by genetic interaction of two loci

Map-based cloning of HNe2

HN does not require ChiA1 enzymatic activity

ChiA1-dependent induction of WRKY18 induces necrotic symptoms

The synteny of ChiA1 and MYB-FL is specific to Petunia

The ChiA1 Ex allele is widespread in nature

Discussion

Methods

Plant materials

DAB staining

RNA extraction and quantitative PCR

Leaf yellowness analysis

BSR-seq and data analysis

Fine mapping using recombinant lines of IL5-Het

RNA-seq analysis

Phylogenetic analysis

Protein structure prediction

VIGS

Transient and stable overexpression

CRISPR–Cas9 editing

Protein extraction, chitinase and lysozyme activity measurement

Sterile culture

Conserved cis-elements screening

Genotyping

Microsynteny analysis

Statistical analysis

Reporting summary

Data availability

Code availability

References

Acknowledgements

Funding

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Competing interests

Peer review

Peer review information

Additional information

Extended data

Supplementary information

Source data

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Search

Quick links

The ChiA1 ^Ex allele is widespread in nature