Structure of the human TIP60 complex

Chen, Ke; Wang, Li; Yu, Zishuo; Yu, Jiali; Ren, Yulei; Wang, Qianmin; Xu, Yanhui

doi:10.1038/s41467-024-51259-z

Download PDF

Article
Open access
Published: 17 August 2024

Structure of the human TIP60 complex

Nature Communications volume 15, Article number: 7092 (2024) Cite this article

2053 Accesses
2 Altmetric
Metrics details

Subjects

Abstract

Mammalian TIP60 is a multi-functional enzyme with histone acetylation and histone dimer exchange activities. It plays roles in diverse cellular processes including transcription, DNA repair, cell cycle control, and embryonic development. Here we report the cryo-electron microscopy structures of the human TIP60 complex with the core subcomplex and TRRAP module refined to 3.2-Å resolution. The structures show that EP400 acts as a backbone integrating the motor module, the ARP module, and the TRRAP module. The RUVBL1-RUVBL2 hexamer serves as a rigid core for the assembly of EP400 ATPase and YL1 in the motor module. In the ARP module, an ACTL6A-ACTB heterodimer and an extra ACTL6A make hydrophobic contacts with EP400 HSA helix, buttressed by network interactions among DMAP1, EPC1, and EP400. The ARP module stably associates with the motor module but is flexibly tethered to the TRRAP module, exhibiting a unique feature of human TIP60. The architecture of the nucleosome-bound human TIP60 reveals an unengaged nucleosome that is located between the core subcomplex and the TRRAP module. Our work illustrates the molecular architecture of human TIP60 and provides architectural insights into how this complex is bound by the nucleosome.

Structure of the human TIP60-C histone exchange and acetyltransferase complex

Article Open access 11 September 2024

Structure of the NuA4 acetyltransferase complex bound to the nucleosome

Article 05 October 2022

The structure of the NuA4–Tip60 complex reveals the mechanism and importance of long-range chromatin modification

Article 07 August 2023

Introduction

As a basic repeating unit of chromatin in eukaryotic cells, nucleosome contains ~147 bp of DNA wrapping around a histone octamer formed by two histone H2A–H2B heterodimers and a histone H3–H4 heterotetramer¹. Nucleosomal packaging can alter chromatin structure and regulate genome function mainly by regulating nucleosome occupation, covalent histone modifications, and histone variant composition². Regulations of nucleosomes are mainly executed by ATP-dependent chromatin-remodeling complexes (also known as remodelers) and histone-modifying complexes. The chromatin remodelers are molecular machines containing a SWI2/SNF2 family ATPase subunit, which plays a key role in chromatin remodeling activities such as sliding, positioning, evicting, or editing nucleosomes. Chromatin remodelers are generally classified into four families: SWI/ SNF, ISWI, CHD, and INO80³. Histone acetylation, one of the most important regulatory histone modifications, destabilizes the binding of the octamer core to nucleosomal DNA by neutralizing the positively charged lysine tails and, therefore, provides an epigenetic modification to facilitate gene expression. Histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes reversibly regulate the level of histone acetylation in cells^4,5. HATs are grouped into five families: GNATs, the MYST-related HATs, p300/CBP HATs, the general transcription factor HATs, and the nuclear hormone-related HATs SRC1 and SRC3⁶.

While previous studies have demonstrated the functional interplay between ATP-dependent remodeling complexes and histone-modifying complexes in chromatin structure regulation^5,7,8, the human TIP60 (hTIP60) complex is unique in that it possesses both chromatin remodeling and histone-modifying activities. The hTIP60 complex was initially identified as a multi-subunit complex possessing histone acetyltransferase activity and DNA helicase activity^9,10. As a counterpart of the 13-subunit yeast NuA4 (yNuA4) complex, the hTIP60 consists of 12 equivalent subunits (except Eaf5) of yNuA4 and exhibits HAT activity towards histone H2A, H2A.Z, and H4⁶. Its HAT catalytic subunit, KAT5, belongs to the MYST-related HATs and is equivalent to the yeast Esa1 subunit⁶. Moreover, hTIP60 differs from yNuA4 in its presence of another catalytic subunit, EP400, belonging to the INO80 family of remodeling ATPases. Consistently, hTIP60 has been reported to facilitate the replacement of canonical histone H2A with its variant H2A.Z and canonical histone H3.1 with its variant H3.3 on chromatin^11,12. The H2A–H2A.Z histone exchange activity is absent in yNuA4 but present in the yeast SWR1 complex (ySWR-C)¹³ and its human homolog SRCAP (hSRCAP-C)¹⁴. Furthermore, hTIP60 consists of 9 subunits equivalent to components of ySWR-C including the ATPase subunit and the actin-related proteins (ARPs). Due to the similarities in remodeling activity and molecular composition, the hTIP60 is also regarded to be a homolog of ySWR-C. Thus, two yeast chromatin-regulating complexes, NuA4 and SWR-C^15,16, likely merged into a dual-function hTIP60 complex over evolution.

The mammalian TIP60 complex was reported to regulate diverse cellular processes. For example, it was described as a transcriptional coactivator by binding various transcription factors, such as p53, c-Myc, E2F1, and nuclear receptors¹⁷. Having its histone dimer exchange activity, the hTIP60 has also been proposed to facilitate the generation of H2A.Z/H3.3-containing nucleosomes, which are enriched in promotor and enhancer regions to influence the transcription^12,18. Furthermore, the acetylation of H2A.Z by the KAT5 subunit is tightly linked to transcription activation¹⁹. EP400 and KAT5 were also reported to function together to alter nucleosome stability during DNA double-strand break repair^11,20. Moreover, the mammalian TIP60 complex is important for early embryonic development and is required to maintain characteristic features of embryonic stem cells^21,22. Studies also revealed that the hTIP60 complex plays a role in cell cycle control and apoptosis^23,24.

The hTIP60 is a super large complex with a molecular weight of ~1.7 Megadalton. It consists of 17 subunits including MBTD1, EP400, DMAP1, YEATS4, ACTL6A, ACTB, EPC1, KAT5, ING3, MEAF6, MRG15, MRGBP, TRRAP, YL1, RUVBL1, RUVBL2, and BRD8²⁵. EP400 has two yeast counterparts, Eaf1 in yNuA4 and Swr1 in ySWR-C. MBTD1, an H4K20me reader, was identified as a component of the hTIP60 to regulate gene expression and DNA repair. MBTD1 homolog is absent in yeast^25,26. The equivalents of other hTIP60 subunits in yeast include Swc4, Yaf9, Arp4, Actin, Epl1, Esa1, Yng2, Eaf6, Eaf3, Eaf7, Tra1, Swc2, RvB1, RvB2, and Bdf1¹⁶. Based on previous studies of hTIP60 and its compositional homology with yNuA4 and ySWR-C, we divided hTIP60 into five modules (Fig. 1a): the EP400-ATPase-containing motor module, the regulatory ARP module, the catalytic HAT module, the Trimer Independent of NuA4 for Transcription Interactions with Nucleosomes (TINTIN) module with histone marker readers (specifically, bromodomain in BRD8 and chromodomain in MRG15)²⁵, and the TRRAP module for transcription activators binding.

**Fig. 1: Overall structure of the apo hTIP60.**

Several recent studies with high-resolution structures have revealed the subunit assembly of yNuA4^27,28,29. Furthermore, a cryo-electron microscopy (cryo-EM) structure of yNuA4 bound to the nucleosome revealed nucleosome recognition and transcription co-activation by a HAT³⁰. The structures of SWR-C^31,32 and nucleosome-bound SWR-C in the presence of ADP-BeF_x, an ATP analog, also revealed SWR-C assembly and histone exchange³³. Despite these studies of yNuA4 and SWR-C, it remains largely unknown how hTIP60 is assembled and how hTIP60 binds nucleosomes for function due to the absence of hTIP60 structure. Here, we determined the cryo-EM structures of hTIP60 in its nucleosome-free and nucleosome-bound states. The structures reveal an unexpected complex assembly of hTIP60 and the positioning of an unengaged nucleosome. We proposed a model for the merge of yNuA4 and ySWR-C into hTIP60.

Results

The overall architecture of the hTIP60 complex

To elucidate the structure of the hTIP60, we reconstituted the complex consisting of the scaffold subunit EP400 and all of the currently known auxiliary subunits (Fig. 1a). The 17-subunit complex was purified to homogeneity for biochemical and structural analyses (Supplementary Fig. 1a). An in vitro acetylation assay confirmed the histone H4 acetylation activity on reconstituted mononucleosome (Supplementary Fig. 1b). The complex also showed a basal ATPase activity and the activity was slightly enhanced upon the addition of the nucleosome (~1.5 fold) or DNA (~1.3 fold) substrate (Supplementary Fig. 1c), consistent with previous study on human EP400-containing complexes³⁴. The purified hTIP60 was then subjected to single-particle cryo-EM structure determination (Supplementary Fig. 2). The obtained low-resolution cryo-EM map showed the molecular architecture of the bipartite organization (Fig. 1b; Supplementary Movie 1; Supplementary Table 1). The two parts are termed core subcomplex and TRRAP module, which are nucleated by the RUVBL1–RUVBL2 hexamer and the large subunit TRRAP, respectively. The core subcomplex and TRRAP module adopt compact folds, which were both locally refined to 3.2 Å resolution. The two separated parts are connected by flexible regions, as evidenced by the low-resolution cryo-EM density (small panel in Fig. 1b; Supplementary Fig. 3a). The structural model was built based on these high-resolution maps, assisted by cross-linking mass spectrometry (XL-MS) and AlphaFold2 prediction³⁵ (Supplementary Fig. 4; Supplementary Data 1).

EP400 serves as a central scaffold that connects the two parts. The core subcomplex could be further divided into a motor module and an ARP module (Fig. 1a). The motor module consists of the RUVBL1–RUVBL2 hexamer, YL1, and the ATPase and a long helical post-ATPase domain of EP400 (we termed it post-ATPase domain). The ARP module consists of the helicase-SANT-associated (HSA) domain, pre-HSA domain, a fragment (residues 2184-2245) of EP400, the EPc-B domain and a short segment of EPc-C domain of EPC1, DMAP1, ACTIN, and two copies of ACTL6A. The TRRAP module comprises the whole TRRAP subunit and a SANT domain-containing region near the C-terminus of EP400.

Apart from the observed core subcomplex and TRRAP module, the hTIP60 also consists of the HAT and TINTIN modules that were not readily detected in our cryo-EM map. Besides, MBTD1 and GAS41 are invisible subunits of the ARP module. As for the HAT module, our XL-MS data indicated that subunits of the HAT module organize around the EPc-A domain of EPC1 (Supplementary Fig. 4a), which is connected to the rest of the protein in the core of hTIP60 via a predicted unstructured linker (residues R290–P398). As for the TINTIN module, our XL-MS data (Supplementary Fig. 4a) and previous study³⁶ indicated that this module was connected to the N-terminal domain of EP400 (EP400-N) by BRD8. This segment of EP400 is connected to the rest of the protein in the core of hTIP60 via a predicted unstructured linker (residues Q470–S727). The first residue of EPC1 and EP400 that can be determined in our cryo-EM map is D399 and Q738, respectively. These residues are located near the TRRAP module (Fig. 1b), suggesting that the HAT and TINTIN modules contribute to the weak cryo-EM density between the core subcomplex and the TRRAP module (Fig. 1b; Supplementary Fig. 3a). Hence, the HAT and TINTIN modules are flexibly tethered to the core module of hTIP60 through EPC1 and EP400. Previous structural studies of yNuA4 showed that the HAT and TINTIN modules are also highly flexible relative to the core of the complex^27,29, suggesting the structural conservation from yeast to humans.

Structure of the motor module

The RUVBL1–RUVBL2 hexamer forms a ring-shaped hexamer and serves as a rigid core for the assembly of the motor module of hTIP60 (Fig. 2a, b), similar to that of the human SRCAP-C and INO80-C^37,38. The large insert of the EP400 ATPase domain winds through the RUVBL1–RUVBL2 hexamer, generating extensive intermolecular contacts. A characteristic two-helix extension fills in the gap between two β-stalks of RUVBL1 (termed 1^b) and RUVBL2 (termed 2^c) (Fig. 2a, b). The insert of EP400 binds the RUVBL1–RUVBL2 hexamer similar to that of SRCAP-C (Supplementary Fig. 5b), indicating that the complex-specific scaffold subunits EP400 and SRCAP guide mutually exclusive assembly of the hTIP60 and SRCAP-C, respectively. The EP400 ATPase domain shows relatively weak density in our cryo-EM maps with the two lobes loosely connected, likely due to the lack of substrate stabilization (Figs. 1b and 2a). The post-ATPase helix is inversely parallel with the long HSA helix, which connects the motor module and the ARP module (Fig. 2a).

**Fig. 2: Structure of the core subcomplex.**

The YL1 shows an elongated conformation and is located between the RUVBL1–RUVBL2 hexamer and EP400–HSA helix (Fig. 2a, b). We did not observe the N-terminal H2A.Z-interacting domain of YL1, which has been reported to serve as an H2A.Z chaperone³⁹. A putative helix of the YL1 middle region (MR) contacts the ATPase lobe1 domain (Fig. 2b). The placement of this helix is guided by the cryo-EM map, XL-MS, and a structural model predicted by AlphaFold2³⁵ (Supplementary Fig. 3c; Supplementary Fig. 4a–e). The following β-hairpin wedges between OB folds of RUVBL2 (2^a) and RUVBL1 (1^c) and binds the post-ATPase domain of EP400 (Fig. 2a, b), with the placement supported by XL-MS (crosslink between residues K228 of YL1 and K2166 of EP400). The C-terminal proline-rich region of YL1 shows a mixed α/β fold interacting with both DMAP1 and the OB-fold of RUVBL2 (2^c) (Fig. 2b). The structure and location of YL1 in the hTIP60 complex is similar to Swc2 in ySWR-C and Ies2 in INO80-C, suggesting their similar roles in these complexes (Supplementary Fig. 5a).

Organization of the ARP module

The ARP module of the hTIP60 is located between and connects the motor module and the TRRAP module (Fig. 1b). Within the ARP module, EP400 serves as a central scaffold to organize five auxiliary subunits (Fig. 3). Specifically, a single-subunit ACTL6A (termed ACTL6A^b) and the ACTL6A (termed ACTL6A^a)–ACTB heterodimer array on the long HSA helix of EP400 (approximately 22 α-helical turns, ~140 Å in length). DMAP1 and EPC1 also make multiple interactions with the pre-HSA, HSA, and the following region of the post-ATPase domain of EP400.

**Fig. 3: Structure of the ARP module.**

The HSA helix-bound actin-related heterodimer has been found in several chromatin remodelers or histone-modifying complexes such as BAF, PBAF, INO80-C, SRCAP-C, and yNuA4^{29,40,41,42,43}. Interestingly, apart from the ACTL6A^a–ACTB heterodimer, our cryo-EM map and XL-MS analysis together support the placement of an additional ACTL6A, which binds near the C-terminus of EP400–HSA, approximately five α-helical turns away from the ACTL6A^a–ACTB heterodimer (Fig. 3; Supplementary Fig. 3c; Supplementary Fig. 4a–d, f). Both ACTL6A^b and ACTL6A^a–ACTB heterodimers make hydrophobic interactions with the HSA helix of EP400. The additional ACTL6A in hTIP60 may function in stabilizing the long HSA helix and this requires further investigation.

DMAP1 shows an elongated fold and makes extensive interactions with other subunits of the ARP module (Fig. 3). The highly hydrophobic N-terminal loop region of DMAP1 winds around the EPC1, and its following short helix (residues 80–87) and the β-hairpin span across the ACTL6A^a–ACTB heterodimer. The β-hairpin of DMAP1 anchors to the ACTL6A^a–ACTB heterodimer through several hydrophobic residues, including W97, A109, F111, F112, and W114 (Fig. 3, interface-2). The SANT domain of DMAP1 packs against the linker region of EP400 and ACTL6A^a and the following helices of DMAP1 bind the pre-HSA helix. Moreover, our XL-MS result shows that the C-terminal region of DMAP1 crosslinks with YEATS4, similar to their counterparts in yeast (Supplementary Fig. 4a, d)⁴⁴. Given that DMAP1 contacts five subunits of the ARP module, it may function as an auxiliary scaffold to organize the ARP module.

The hTIP60-specific subunit EPC1

EPC1 is a hTIP60-specific subunit that contains EPc-A, EPc-B, and EPc-C domains and a C-terminal hydrophobic segment (HS)²⁶ (Fig. 1a). We could observe a clear density of its EPc-B domain and a short fragment of the EPc-C domain. The EPc-B exhibits a long disordered loop (residues 400–440), followed by the β-sheets and two short helices (Fig. 3). The N-terminal region of EPc-B interacts with a loop following the pre-HSA domain of EP400 and also makes charge-charge interactions with an EP400 loop region stretching to the TRRAP module. In particular, residue K407 of EPC1 contacts residue E2241 of EP400; residue H416 of EPC1 contacts residue E2235 of EP400 at the interface-1 (Fig. 3). Following the N-terminal loop of EPc-B domain, a curved three-stranded β-sheet, and two short α-helices form a rigid motif, which is sandwiched by the N-terminal loop of DMAP1 and a β-hairpin of EP400 (residues 2197-2210) (Fig. 3, interface-3). The tip of the EPC1 β-sheet inserts into the pocket formed by the EP400–HSA and ACTL6A^a–ACTB heterodimer (Fig. 3, interface-4). Therefore, this segment of EPC1 acts as an adhesive that associates with both the N-terminal and C-terminal fragments of EP400 within the ARP module, as well as with DMAP1 and the ACTL6A^a–ACTB heterodimer. Consistently, earlier studies showed that the corresponding region of Epl1 (EPC1 ortholog in yeast) is also responsible for the association with the core of yNuA4, suggesting the functional conservation of EPC1 from yeast to human^27,45.

The hTIP60 shows a clear and rigid density of the ARP module (Fig. 2a), different from the flexible ARP modules (corresponding to the A-module of INO80-C and the N-module of hSRCAP-C) of the hINO80-C and hSRCAP-C in their nucleosome-free state^37,38. Our structural study reveals that the hTIP60-specific subunit EPC1 links the N-terminal and C-terminal fragments of EP400 within the core subcomplex with the help of DMAP1 (Fig. 3). DMAP1 also binds the C-terminal proline-rich region of YL1 as described above (Fig. 2b). Such combinatory interactions may explain the stable connection between the ARP module and motor module in hTIP60.

The TRRAP module

The TRRAP module of hTIP60 is composed of the EP400 C-terminal SANT domain and its flanking regions, and the TRRAP subunit (~400 kDa) (Fig. 1a). TRRAP serves as a hub for binding transcriptional activators and is a shared subunit of human Spt-Ada-Gcn5 acetyltransferase (hSAGA) complex in human cells⁴⁶. The conformation of TRRAP in hTIP60 is highly resembled to that in the hSAGA complex⁴⁶. The N-terminal extension of the EP400 SANT domain contacts the FAT-proximal HEAT repeat region of TRRAP. The SANT domain and the following region of EP400 span over the FAT domain of TRRAP (Fig. 4a). The structural observation agrees with the previous study showing that the depletion of the SANT domain of Eaf1 (EP400 ortholog) in yeast provokes the loss of Tra1 (TRRAP ortholog)¹⁵. Structural analysis also revealed that the EP400 binding surface in TRRAP overlaps with most of the SUPT20H–SUPT3H–TADA1–SUPT7L-binding surface of TRRAP in hSAGA^46,47, which explains the mutually exclusive assembly of of TRRAP in hTIP60 and hSAGA.

Different organization of the ARP and TRRAP module in hTIP60 and yNuA4

In hTIP60, the ARP-containing core subcomplex and the TRRAP module are separated and likely tethered through a flexible loop region of EP400 (P2245-V2276), as predicted by AlphaFold2³⁵ (Fig. 1b; Fig. 4b; Supplementary Fig. 8d). By contrast, in the yNuA4 complex, the ARP module stably associates with the TRRAP module²⁷ (Fig. 4b). Structural comparison of hTIP60 and yNuA4 reveals that ARP modules shows positional difference by ~70° relative to the superimposed TRRAP (Fig. 4c). In yNuA4, the two modules are bridged by a rigid neck formed by Eaf1, Epl1 and Swc4, which together fold into a helical bundle and a β-cluster²⁷. For example, in yNuA4 neck region, regions V505–E530 and N734–Q770 of Epl1 and region L287–L302 of Eaf1 are folded into α-helices (α1 and α9 of Epl1; α2 of Eaf1 respectively); regions E267–N274 and Y598–L605 of Eaf1 are folded into β-sheets (β1 and β4 of Eaf1) (Fig. 4b). In hTIP60, no such neck was observed. In addition, most of the equivalent neck-forming regions (F364–P375 and R551–Q589 of EPC1; R705–P720, A671–P678, A2274–L2281 of EP400) in hTIP60 are disordered, as predicted by AlphaFold2³⁵ (Supplementary Figs. 6, 7, and 8d). The distinct modular organization between hTIP60 and yNuA4 may reflect their intrinsic differences in complex composition.

Nucleosome-interaction of human TIP60

We next investigated whether, and if yes, how hTIP60 binds to its nucleosome substrate. Previous studies of yNuA4 have proved that nucleosomes with long overhangs are better substrates for acetylation than core. Several studies of ySWR-C have revealed that it prefers nucleosome substrates with long overhangs (at least one side overhang needs to be longer than 60 base pairs)^48,49. Based on the substrate preference of these hTIP60-related complexes, we used a canonical nucleosome with long (108 base pairs) and short (12 base pairs) overhangs on the respective side (termed 108N12) as the substrate of hTIP60. We then performed the electrophoretic mobility shift assay (EMSA) using the purified hTIP60 and 108N12 nucleosome. An obvious upward shift of nucleosome was observed in the reactions with an increasing amount of hTIP60, indicating a direct interaction between them (Fig. 5a). Then we mixed hTIP60 and 108N12 nucleosome followed by gradient fixation (Grafix). The assembled sample (hTIP60-NCP) was subjected to negative stain and single-particle cryo-EM analyses (Supplementary Fig. 9). The negative stain class average views and the low-resolution cryo-EM map showed clear features of the core subcomplex and the TRRAP subunit (Fig. 5b, c). The structure model of the core subcomplex and TRRAP module could be docked into the hTIP60-NCP cryo-EM map (Fig. 5c). The TRRAP subunit exhibits slight differences in the placement relative to the core subcomplex compared to that in nucleosome-free hTIP60 (apo hTIP60), possibly due to the binding of the nucleosome (Fig. 5b). In addition, we could observe considerable cryo-EM density between the core subcomplex and the TRRAP module in the hTIP60-NCP map, which shows larger volume than that in the apo hTIP60 (Fig. 5b). To improve the quality of the extra density between the core subcomplex and the TRRAP subunit in the hTIP60-NCP map, we subtracted the density followed by the focused cryo-EM 3D classification. One of the 3D classes shows the map with characteristics of a nucleosome (Supplementary Fig. 9e). We subtracted the the density of core subcomplex and TRRAP module for further processing and finally yielded maps with typical structural features (Supplementary Fig. 9e, f; Fig. 5c), showing that the nucleosome is located between the core subcomplex and TRRAP module. The extra density of the hTIP60–NCP overall map may be accounted for by the flexible HAT/TINTIN module and/or other unmodeled subunits like YEATS4 and MBTD1 (right panel in Fig. 5c). Our structural observations suggest that the nucleosome binds near the hTIP60 HAT module rather than being engaged with the motor module. Such observation is consistent with our biochemical assays that the reconstituted hTIP60 shows notable acetylation activity (Supplementary Fig. 1b) but very low ATPase activity even in the presence of nucleosome substrate (Supplementary Fig. 1c).

**Fig. 5: Interactions between nucleosome and hTIP60.**

The nucleosome is unengaged with the hTIP60 core subcomplex

Considering that the hTIP60 has histone exchange activity as its homologs ySWR-C and hSRCAP-C^12,50, we assumed that the hTIP60 core subcomplex should bind and engage with a nucleosome (the ATPase grasping the nucleosomal DNA for chromatin remodeling) as other remodelers do. However, we carefully analyzed the density map of the hTIP60–nucleosome and found no such evidence. It seems that the nucleosome binds the hTIP60 HAT module instead of being engaged with its core subcomplex. To investigate whether the hTIP60 core subcomplex binds nucleosome substrate, we prepared a hTIP60 complex in the absence of its HAT module (hTIP60ΔHAT). The EMSA assay showed obvious binding between hTIP60ΔHAT and nucleosome substrate (Supplementary Fig. 1d), suggesting that the HAT module is not essentially required for the interaction between nucleosome and the core subcomplex.

According to our biochemical and structural analyses, we proposed the following speculations for the interaction between nucleosome and the hTIP60 core subcomplex. First, both ySWR-C and hSRCAP-C have two arms extended from the RUVBL1–RUVBL2 hexamer^33,38. One arm is the ATPase domain formed by two split lobes of the ATPase domain of hSRCAP-C and ySWR-C. The other one is the Arp6/Swc6 heterodimer (ARP6/ZNHIT1 in hSRCAP-C) which interacts with the protrusion region of ySWR-C and hSRCAP-C (Supplementary Fig. 5c). Both arms are involved in stabilizing the nucleosome substrate. However, the homologs of arp6/swc6 (ARP6/ZNHIT1) are absent in hTIP60¹⁶. Therefore, hTIP60 has only one arm, which is formed by the lobe1 and lobe2 of the EP400 ATPase domain (Supplementary Fig. 5c). Thus, lacking one arm may result in a relatively weak binding of nucleosome substrate to the hTIP60 motor module. Second, a structural comparison of the hTIP60 core subcomplex with hSRCAP-C in the nucleosome-bound state⁴³ shows that the ARP modules of the two complexes are in a distinct orientation (relative to the motor module) (Supplementary Fig. 5d). We suspected that if the hTIP60 binds nucleosome similar to the hSRCAP, there will be a dramatic conformational change. The stable binding between the ARP and motor module of hTIP60 is probably an obstacle to binding a nucleosome. Additionally, our SDS-PAGE and XL-MS results indicated that some endogenous H2A.Z–H2B dimer copurified with our hTIP60 after extensive purification steps (Supplementary Figs. 1a and 4a; Supplementary Data 1). The existence of these histone proteins may impede the binding of nucleosomes to the hTIP60 core subcomplex.

The above analyses provide a structural explanation for the unengaged nucleosome in the hTIP60–nucleosome structure. However, it does not exclude the possibility of nucleosome engagement and remodeling activity of hTIP60, which may occur with the help of other unknown factor(s) or under different experimental conditions.

Discussion

The ARP modules in hTIP60 and other related complexes

The ARP module of hTIP60 comprises a three-actin-fold-protein bound HSA helix. Sequence alignment shows that the HSA helix of SRCAP and Swr1 have similar hydrophobic properties at the equivalent position where three actin-fold proteins bound in EP400–HSA (Supplementary Fig. 10a), suggesting that hSRCAP-C and ySWR-C may have three-actin-fold-protein-bound HSA helices similar to that of hTIP60. Previous biochemical studies on ySWR-C³² and our recent structural study on hSRCAP⁴³ verified such a hypothesis. The A-module of INO80-C was also reported to contain an extra actin-fold-protein (Arp8) besides the ACTL6A–ACTB heterodimer⁵¹ (Supplementary Fig. 10b). EP400–HSA has multiple positively charged residues between the ACTB-bound and the ACTL6A^b-bound regions (Supplementary Fig. 10a). Moreover, our structure shows that most regions of EP400–HSA are solvent-exposed. Such an evolutionarily conserved feature of the HSA module in the INO80 family suggests that the EP400–HSA may bind nucleosomal DNA if hTIP60 does function in chromatin remodeling.

We also compared the structures of the ARP module of hTIP60 and yNuA4. Compared with hTIP60, yNuA4 contains a short HSA (approximately 10 helical turns) that is associated with actin–Arp4 heterodimer (Supplementary Fig. 10b). The interaction between the actin-related heterodimer and HSA helix are both enhanced by a complicated interaction network among DMAP1/Swc4, EPC1/ Epl1, and EP400/Eaf1, suggesting the conservation of the ARP module from yNuA4 to hTIP60. However, two short helices of Epl1 and the N-terminal of Swc4 occupy the space between Eaf1–HSA and Arp4–Actin dimer^27,30. Homologs of these regions in hTIP60 (α1 and α2 of EPC1; the N-terminal of DMAP1) are located away from the ACTL6A^a–ACTB heterodimer and suspended above the EP400–HSA helix. The different position of these regions results in a more open environment for ACTL6A^a–ACTB-heterodimer-bound EP400–HSA compared with its homolog in yNuA4.

Human TIP60 is a merge of yNuA4 and ySWR-C

In yeast, the SWR-C and NuA4 are two chromatin-associated complexes, which have merged into an hTIP60 complex to fulfill its multiple functions in higher eukaryotes^15,16. Our structural study of hTIP60 helps to gain a more comprehensive understanding of how the two complexes are merged (Fig. 6a, b). The structure of hTIP60 showed that the SWR-C-like hTIP60 portion and NuA4-like hTIP60 portion are organized into an elongated architecture. ySWR-C and yNuA4 share four subunits, Arp4, Actin, Swc4 and Yaf9¹⁰. The homologs of these subunits in hTIP60 are ACTL6A^a, ACTB, DMAP1, and YEATS4 (Supplementary Table 2). Although YEATS4 is invisible in our structure, ACTL6A^a, ACTB, and DMAP1 tightly interact with EP400–HSA and pre-HSA domain and are located in the middle of the hTIP60, acting as a docking platform of the SWR-C-like hTIP60 portion and NuA4-like hTIP60 portion.

**Fig. 6: Cancer-derived mutations of EP400 and a model for merge of yNuA4 and ySWR-C to hTIP60.**

The hTIP60 scaffold subunit EP400 is a hybrid of Swr1 in ySWR-C and Eaf1 in yNuA4. It has been proposed that the merge of Swr1 and Eaf1 is not a simple fusion, instead, the ATPase domain of Swr1 was inserted between the HSA domain and SANT domain of Eaf1¹⁶. Our structure of hTIP60 confirmed that EP400 is an evolutionarily merged subunit of Swr1 and Eaf1 and acts as a scaffold for the whole complex. Specifically, the N-terminal region of EP400 is homologous to Eaf1 and provides an anchoring site for the TINTIN module³⁶, which is derived from yNuA4. EP400 and Swr1 both have the pre-HSA domain, HSA helix, and ATPase domain, and the insert and act as a scaffold within the ARP module and then form the motor module. The motor module and part of the ARP module of hTIP60 are SWR-C-like portions. However, it is worth mentioning that the pre-HSA domain and ACTL6A^a–ACTB-bound-HSA helix of EP400 are also homologous to Eaf1 in yNuA4. Sequence analyses and evolutionary study¹⁶ suggested that this segment of EP400 is more closely related to that in the Eaf1 than to Swr1. Following the post-ATPase domain, the C-terminal extension of EP400 (adopted from Eaf1) is a NuA4-like portion, where it further contributes to the ARP module and provides an anchoring site for the HAT module and TRRAP subunit. Together, the hybrid EP400 threads through the hTIP60 complex and mediates the interaction with multiple modules.

Except for EP400, there are also variations in other subunits of hTIP60 compared with their yeast counterparts (Supplementary Table 2). Eaf5 has no homolog in hTIP60¹⁰ and is responsible for linking the TINTIN module to the yNuA4 core by its interaction with Eaf1⁴⁴. BRD8, the homolog of Bdf1 in ySWR-C, forms the human TINTIN module together with the MRG15-MRGBP (the homolog of Eaf3 and Eaf7 in yNuA4) heterodimer. Our XL-MS result (Supplementary Fig. 4a, d) and previous study³⁶ show that the human TINTIN module anchors to the core complex of hTIP60 by the interaction between BRD8 and the N-terminal of EP400. Although BRD8 shares no recognizable sequence similarity to Eaf5, it seems to be functionally equivalent to Eaf5 in hTIP60. In addition, several subunits of ySWR-C (specifically, Swc6 and Arp6 as previously mentioned, Swc3, Swc5, and Swc7) also have no homologs in hTIP60¹⁶.

Human cancer-related mutations in EP400

Previous pan-cancer analysis shows that there is an enrichment of EP400 mutations in metastatic tumors⁵². Given the important role of EP400 as both a scaffold and a putative motor subunit in hTIP60, it is not surprising that EP400 is frequently mutated in human cancers⁵³. To rationalize these findings, we mapped representative cancer-associated mutations of EP400 on our high-resolution structure (Fig. 6c). A group of mutations clusters predominantly on the ATPase domain of EP400, such as residues R1125 and R1187 of lobe1, and residues R1291, R1341, R1879, V1953, R1993 of lobe2. These charged mutations may influence the hTIP60 function by impairing the ATPase activity of EP400, suggesting that the ATPase activity is functionally important. Another group of mutations occurs on the interaction surface of EP400 with other hTIP60 subunits. For example, residues E751, R762, and R771 reside at/near the EP400 pre-HSA domain, mutations of which may influence the interactions between EP400 and DMAP1. Mutations of residues R2279, R2284, R2293, P2395, and R2408 reside at the C-terminal region of EP400, which involves the interaction with TRRAP. Most of the mapped mutations in human cancers are predicted to destabilize hTIP60. The mutations may cause functional defects by destabilization of the complex assembly.

In conclusion, our results here present the molecular architecture of the hTIP60 complex and hTIP60 in the nucleosome-binding state. We found that the HAT module, the TINTIN module, and the TRRAP module are all flexibly connected to the core subcomplex in hTIP60. Such a structural arrangement is similar to SAGA and CBP/p300^46,54,55, which also leave their activators-binding and enzymatic modules flexibly linked. Given the different histone marker readers²⁵ and transcription activators-binding regions existing in different modules of hTIP60, such structural flexibility may allow hTIP60 to recognize complicated chromatin environments and find proper substrates in cells.

Methods

Protein expression and purification

The seventeen full-length open reading frames (ORFs) of hTIP60 subunits were individually subcloned into a modified pCAG vector. EPC1 is the only subunit that is tagged with an N-terminal Flag, 4× Protein A, followed by an HRV-3C cleavage site. All the other subunits of the hTIP60 complex were untagged. Except subunits TRRAP, YL1, and EP400 were individually cloned, the expression cassettes of the other fourteen subunits were merged into six plasmids (in particular, tagged EPC1, KAT5 and MBTD1 were merged as the first plasmid; RUVBL1 and RUBVL2 were merged as the second plasmid; DMAP1 and YEATS4 were merged as the third plasmid; ACTB and ACTL6A were merged as the fourth plasmid; BRD8, MRG15 and MRGBP were merged as the fifth plasmid; ING3 and MEAF6 were merged as the sixth plasmid). All these plasmids were co-transfected into Expi293F suspension cells (ThermoFisher cat. no. A14527) using polyethylenimine (Polysciences). Cells were cultured for 72 h at 37 °C and harvested by centrifugation. For complex purification, all the steps were performed at 4 °C. Cells were disrupted in lysis buffer containing 50 mM HEPES (pH 7.4), 300 mM NaCl, 10% (v/v) Glycerol, 0.25% (w/v) chaps, 2 mM MgCl₂, 0.5 mM EDTA (Ethylenediaminetetraacetic Acid), 2 mM DTT (Dithiothreitol), 1 mM PMSF (Phenylmethylsulfonyl fluoride), 1 μg/mL Aprotinin, 1 μg/mL Pepstatin, 1 μg/mL Leupeptin for 30 min. The raw cell lysate was clarified by centrifugation at 38,420 × g for 30 min. The supernatant was incubated with IgG resin for 4 h and washed thoroughly with wash buffer containing 50 mM HEPES (pH 7.4), 300 mM NaCl, 10% (v/v) Glycerol, 0.1% (w/v) chaps, 2 mM MgCl₂, 0.5 mM EDTA, 2 mM DTT. After on-column digestion overnight, the immobilized protein was eluted using wash buffer and further purified through ion-exchange chromatography (Mono Q 5/50 GL column, GE Healthcare). The bound protein was eluted with increasing concentrations of NaCl from 0.1 to 1 M, and the hTIP60 complex was eluted at 300 mM NaCl. Peak fractions containing hTIP60 complex were pooled, concentrated using a 100-kDa cut-off centrifugation filter unit (Millipore) to ~2 mg/mL and used for subsequent cryo-EM sample preparation or flash-frozen in liquid nitrogen in small aliquots for biochemical analyses.

For the 13-subunit hTIP60ΔHAT complex, EPC1 is still the only subunit tagged with an N-terminal Flag, 4× Protein A, followed by an HRV-3C cleavage site. Subunits TRRAP, YL1, EPC1, and EP400 were individually cloned, the expression cassettes of the other 9 subunits were merged into four plasmids (in particular, RUVBL1 and RUBVL2 were merged as the first plasmid; DMAP1 and YEATS4 were merged as the second plasmid; ACTB and ACTL6A were merged as the third plasmid; BRD8, MRG15 and MRGBP were merged as the fourth plasmid). hTIP60ΔHAT complex was expressed and purified in a similar way as the hTIP60 complex.

Preparation of nucleosomes

Canonical human histones H2A–H2B heterodimer and H3.1–H4 heterotetramer were separately co-expressed as a soluble protein in Escherichia coli BL21 (DE3) cells as described previously⁵⁶. Briefly, cells were disrupted in lysis buffer containing 50 mM Tris-HCl (pH 8.0), 2 M NaCl, 5% (v/v) glycerol, 0.7 mM β-mercaptoethanol (β-ME), and then purified through ion-exchange chromatography. For octamer assembly, H2A–H2B heterodimer in 1.2-fold excess was mixed with H3.1–H4 heterotetramer and then incubated for 0.5 h at 4 °C, followed by a size exclusion chromatography (Superdex 200 10/300, GE Healthcare). Peak fractions were concentrated and used for nucleosome assembly.

DNA fragments for nucleosome reconstitution were prepared by PCR amplification and subsequently purified by anion-exchange chromatography. Peak fractions were concentrated and used for nucleosome assembly. Nucleosomal DNA used in this study contained the Widom 601 positioning sequence⁵⁷ with two flanking sequences, one is 12 bp in length, and another is 108 bp. The DNA sequence for assembly of 108N12 nucleosome is as below (the ‘601’ positioning sequence is underscored):

ACTGGCACCGGTTTAAACGCTGTTCAATACATGCCCGGCACCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCCTCGGGACCCAAGCGACACCGGCACTGGAACAGGATGTATATATGTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGAATTCCCCAG.

Nucleosome reconstitution with recombinant histones and DNA was performed as previously described⁵⁸. Briefly, DNA and octamer were mixed at an equimolar ratio followed by a linear salt gradient dialysis from 2 M NaCl to 600 mM NaCl. Finally, nucleosomes were dialyzed to 1× HE buffer containing 10 mM HEPES (pH 8.0), 0.1 mM EDTA. The nucleosomes can be immediately used for complex assembly and biochemical assay.

Cryo-EM sample preparation

For EM sample preparation of apo hTIP60, the purified hTIP60 complex is subjected to gradient fixation (Grafix). Briefly, the sample was loaded onto a gradient generated from a glycerol light solution containing 15% (v/v) glycerol, 50 mM HEPES (pH 7.4), 60 mM NaCl, 2 mM MgCl₂, 2 mM DTT and a glycerol heavy solution containing 35% (v/v) glycerol, 50 mM HEPES (pH 7.4), 60 mM NaCl, 2 mM MgCl₂, 2 mM DTT and 0.0075% (v/v) glutaraldehyde. Centrifugation was performed for 15 h at 247,600 × g in an SW41Ti swinging-bucket rotor⁵¹ at 4 °C. Peak fractions were pooled and quenched by the addition of 100 mM Tris-HCl (pH 8.0). The cross-linked hTIP60 complex was concentrated and dialyzed overnight against a buffer containing 50 mM HEPES (pH 7.4), 60 mM NaCl, 2 mM MgCl₂, 2 mM DTT and 0.5% (v/v) glycerol.

For negative staining EM grid preparation of apo hTIP60, 5 μL of hTIP60 complex after dialysis were applied onto glow-discharged copper grids supported by a continuous thin layer of carbon film for 60 s before negative staining by 2% (w/v) uranyl acetate solution at room temperature. The grids were prepared in the Ar/O₂ mixture for 15 s using a Gatan 950 Solarus plasma cleaning system with a power of 35 W. The negatively stained grids were loaded onto a Thermo Fisher Scientific Talos L120C microscope equipped with a Ceta CCD camera and operated at 120 kV at a nominal magnification of 73,000×, corresponding to a pixel size of 1.99 Å on the specimen.

For cryo-EM grids preparation of apo hTIP60, detergent C8E6 was added to the sample with a final concentration of 0.01% (m/v). Samples (4 μL at a concentration of ~1.5 mg/mL) were applied to freshly glow-discharged Quantifoil R1.2/1.3 holey carbon grids with 200 mesh. After incubation for 5 s at 4 °C and 100% humidity, the grids were blotted for 2 s with blot force −2 in a Thermo Fisher Scientific Vitrobot Mark IV and plunge-frozen in liquid ethane at liquid nitrogen temperature. The grids were prepared in the Ar/O₂ mixture for 120 s using a Gatan 950 Solarus plasma cleaning system with a power of 5 W. The ø 55/20 mm blotting paper from TED PELLA was used for plunge freezing.

For EM sample preparation of hTIP60-NCP, the purified hTIP60 complex was mixed with 108N12 nucleosome at a ratio of 1:1.2, followed by incubation of 0.5 mM ADP-BeF_x (0.5 mM ADP, 7 mM NaF, and 1 mM BeSO4) for 15 min at 30 °C. The complexes were subjected to Grafix. In brief, the sample was loaded onto a gradient generated from a glycerol light solution containing 15% (v/v) glycerol, 20 mM HEPES (pH 7.4), 60 mM NaCl, 2 mM MgCl₂, 2 mM DTT and a glycerol heavy solution containing 35% (v/v) glycerol, 20 mM HEPES (pH 7.4), 60 mM NaCl, 2 mM MgCl₂, 2 mM DTT and 0.005% (v/v) glutaraldehyde. Centrifugation was performed for 15 h at 198,200 × g in an SW41Ti swinging-bucket rotor⁵¹ at 4 °C. Peak fractions were pooled and quenched with 100 mM Tris-HCl (pH 8.0). The cross-linked hTIP60-NCP complex was concentrated and dialyzed overnight against a buffer containing 50 mM HEPES (pH 7.4), 60 mM NaCl, 2 mM MgCl₂, 2 mM DTT and 0.5% (v/v) glycerol. The two Grafix solutions and dialysis buffer contain 0.5 mM ADP-BeF_x. The negative staining EM grid preparation and the cryo-EM grid preparation of hTIP60-NCP are the same as that of apo hTIP60.

Cryo-EM data collection

The cryo-EM grids of apo hTIP60 were loaded onto a Thermo Fisher Scientific Titan Krios transmission electron microscope operated at 300 kV for data collection. Cryo-EM images were automatically recorded by a post-GIF Gatan K3 Summit direct electron detector in the super-resolution counting mode using Serial-EM⁵⁹ with a nominal magnification of 64,000× in the EFTEM mode, resulting in a super-resolution pixel size of 0.667 Å on the image plane, and with defocus values ranging from −1.0 to −2.8 μm. Each micrograph stack was dose-fractionated to 40 frames with a total electron dose of ~50 e^–/Å² and a total exposure time of 3.6 s. A total of 16,955 micrographs were collected for further processing.

The cryo-EM grids of hTIP60-NCP were loaded onto a Thermo Fisher Scientific Talos Arctica transmission electron microscope operated at 200 kV for data collection. The cryo-EM images were automatically recorded by a Gatan K3 Summit direct electron detector in the super-resolution counting mode using Serial-EM with a nominal magnification of 28,000× in the TEM mode, which yielded a super-resolution pixel size of 0.695 Å on the image plane, and with defocus values ranging from −1.0 to −2.8 μm. Each micrograph stack was dose-fractionated to 40 frames with a total electron dose of ~50 e⁻/Å² and a total exposure time of 4.6 s. 8110 micrographs of hTIP60-nucleosome were collected for further processing.

Cryo-EM data processing

Drift and beam-induced motion correction were applied on the super-resolution movie stacks using MotionCor2⁶⁰ and binned twofold to a calibrated pixel size of 1.334 Å/pix (apo hTIP60) and 1.39 Å/pix (hTIP60-NCP). Contrast transfer function (CTF) parameters were estimated by Gctf⁶¹ from summed images without dose weighting. Other procedures of cryo-EM data processing were performed within RELION v3.1⁶² using the dose-weighted micrographs.

For data processing of apo hTIP60, 3,941,803 particles were automatically picked (Supplementary Fig. 2), extracted with 4× binning, and subjected to several rounds of reference-free 2D classification, yielding a total of 2,641,077 particles. The particles were further subjected to the 3D classification. High variability and low resolution of the overall hTIP60 were observed. To acquire high-resolution maps of each module, hTIP60 was divided into two parts which were performed particle subtraction respectively. The classes with good features of the motor module and ARP module consisted of 1,481,644 particles and were subsequently subtracted with the motor module and ARP module masked. The classes with good features of the TRRAP module consisted of 1,328,461 particles and were subsequently subtracted with the TRRAP module masked. As for the motor module and ARP module, 701,594 particles with good quality were selected after several rounds of 3D classification. These particles were re-extracted without binning and used for 3D refinement, CTF refinement, and Bayesian polishing, resulting in a map at 3.2 Å which contains a high-resolution motor module and a relatively low-resolution ARP module. To improve the mapping of the ARP module, 3D classification by applying the mask for the actin-related module resulted in a cleaner dataset containing 293,181 particles. These particles were locally refined and post-processed, yielding a reconstruction of the actin-related module with better map quality at 3.3 Å. As for the TRRAP module, 190,003 particles with good quality were selected after several rounds of 3D classification. These particles were re-extracted without binning and used for 3D refinement, CTF refinement, and Bayesian polishing, resulting in a map at 3.2 Å. Furthermore, these particles with optimal feathers of the TRRAP module were reverted to original particles and subjected to 3D classification with the map of TRRAP module low-pass filtered to 50 Å as a reference, resulting in 20,275 particles with apparent features of the motor module, ARP module, and the TRRAP module. These particles were re-extracted with 2× binning and used for 3D refinement, resulting in an overall map of hTIP60 at 9.4 Å.

For data processing of hTIP60-NCP, 1,383,116 particles were automatically picked (Supplementary Fig. 9), extracted with 4× binning and subjected to several rounds of reference-free 2D classification, yielding a total of 1,005,785 particles. The particles were further subjected to the 3D classifications. After several rounds of 3D classifications, 35,936 particles of the complex in the nucleosome-bound state were selected from good 3D class, which were used for refinement, yielding a reconstruction of the hTIP60-NCP complex at 23.4 Å resolution. To acquire a map with better characteristics of the nucleosome, 88,724 particles with obvious extra density between the core subcomplex and TRRAP module were subsequently subtracted with the extra density masked. The subtracted particles were subjected to further 3D classification. 22,589 particles with apparent features of nucleosome were selected from one of the 3D classes, which were used for refinement, yielding a reconstruction of the NCP-containing module at 17.6 Å resolution. The core subcomplex and TRRAP module were subtracted followed by 3D classification and local refinement. For the core subcomplex, 38,175 particles with apparent features were selected for local refinement, yielding a reconstruction of the core subcomplex at 8.8 Å resolution. For the TRRAP module, 33,610 particles with apparent features were selected for local refinement, yielding a reconstruction of the TRRAP module at 13.9 Å resolution.

All reported resolutions are calculated based on the gold-standard Fourier shell correlation (FSC) = 0.143 criterion. The FSC curves were corrected for the effects of a soft mask with high-resolution noise substitution. All the visualization and evaluation of the 3D volume map were performed within UCSF Chimera or UCSF ChimeraX⁶³, and the local resolution variations were calculated using RELION v3.1.

Model building and structure refinement

Model building was performed using COOT 0.8.9.2 and model refinement was performed using Phenix⁶⁴ with secondary structure and geometry restraints using the corresponding cryo-EM maps. Structure predictions were performed by AlphaFold2³⁵. For the model building of the hTIP60 core module, part of the structures of the nucleosome-bound hSRCAP-C (PDB: 8 × 19)⁴³ and nucleosome-bound ySWR-C (PDB: 6GEJ)³³ were used as initial structural templates. Specifically, the RUVBL hexamer, ACTL6A^a–ACTB heterodimer, DMAP1, the pre-HSA domain, HSA domain, and most ATPase domain of EP400 were generated by using previously mentioned structures, followed by iterative rounds of manual adjustment and rebuilding in COOT. The lobe1 of EP400 ATPase domain shows weaker density than the lobe2 domain, thus, the AlphaFold2 predicted lobe1 structure model was docked onto the hTIP60 core module map (Supplementary Fig. 3c). For the helical post-ATPase domain of EP400 and its C-terminus (N2148-P2245), we did de novo model building in COOT based with the predicted structures by AlphaFold2 as templates. The structure prediction of EP400 by AlphaFold2 was carried out using the Alphafold co-lab server (https://colab.research.google.com/github/sokrypton/ColabFold/blob/main/AlphaFold2.ipynb) with the MSA_method: MMseqs2 and all other parameters set to default⁶⁵. For YL1, the model was manually built in COOT based on AlphaFold2 prediction from the AlphaFold protein structure database (Identifier of YL1: AF-Q15906-F1) and the XL-MS analysis revealing the interaction between YL1 and the post-ATPase helix of EP400 (Supplementary Fig. 4e). The single ACTL6A (termed as ACTL6A^b) was built by docking the structure of ACTL6A^a to the 3.2 Å map of the hTIP60 core module (Supplementary Fig. 3c), which is confirmed by the XL-MS analysis revealing the interaction between ACTL6A and the post-ATPase helix of EP400 (Supplementary Fig. 4f). For the TRRAP module, the TRRAP subunit was built and refined using previous structure of hSAGA complex (PDB: 7KTR)⁴⁶ as a template. The EP400 C-terminal SANT domain and its flanking regions in the TRRAP module were built using yNuA4 structure (PDB: 8ESC)²⁷ as a template, followed by manually adjusting it to fit the map. To generate the hTIP60 overall structure, the structural models of the hTIP60 core module and TRRAP module were docked onto the hTIP60 overall map.

The final models were evaluated using MolProbity⁶⁶. Statistics of the map reconstruction and model refinement can be found in Supplementary Table 1. The crosslinks mapped on the 3D structure of hTIP60 are generated by Xlink Analyzer⁶⁷ (Supplementary Fig. 4b, c). Map and model representations in the figures and movies were prepared by PyMOL, UCSF Chimera, or UCSF ChimeraX.

HAT assay

To investigate the histone acetyltransferase activity of hTIP60, the complex (130 nM) was incubated with 108N12 nucleosome (20 nM) in buffer 20 mM Tris (pH 8.0), 100 mM NaCl, 2 mM MgCl₂, 1 mM DTT and 10% (v/v) glycerol. The reactions were initiated by adding 100 μM acetyl-CoA. After incubation at 37 °C for 10-80 min, the reactions were stopped by adding SDS loading buffer and heating at 95 °C for 5 min. Proteins were then resolved by 6–15% SDS-PAGE, followed by a western blot with a primary antibody against histone H3 and acetylated-lysine (pan-acetyl) of histone H4 (ABclonal cat. no. A2348; Active Motif cat. no. 39244).

ATPase assay

The ATPase activity was performed with the ADP-GloTM Kinase Assay Kit following the manufacturer’s instructions. In brief, hTIP60 complex (200 nM) or PBAF complex⁴¹ (200 nM) was alone or mixed with nucleosome (200 nM) in buffer containing 20 mM HEPES (pH 8.0), 100 mM NaCl, 2 mM MgCl₂, 1 mM DTT, 5% (v/v) glycerol, 0.1 mg/ml BSA in a final volume of 5 μl. The reactions were started with the addition of 0.1 mM ATP at 30 °C for 30 min and stopped by adding 5 μl ADP-Glo^TM Reagent. Synergy™ H4 Hybrid Multi-Mode Microplate Reader was used to monitor the luminescent signal initiated by adding the Kinase Detection Reagent in non-binding, black, 384-well plates (Corning CLS3575) at an emission wavelength of 528 nm over an integration time of 1 second per well. The final ATP turnover rate was calculated using a standard curve generated following the ADP-GloTM Kinase Assay protocol, which was modified for a buffer blank.

Electrophoretic-mobility shift assays (EMSAs)

The binding capability of hTIP60 and hTIP60ΔHAT to nucleosomes was examined by EMSAs. Specifically, increasing amounts of the protein (0–200 nM) were respectively incubated with 100 nM 108N12 nucleosomes in 10 μL reaction buffer containing 20 mM HEPES (pH 7.4), 60 mM NaCl, 2 mM MgCl₂, 1 mM DTT, 5% (v/v) glycerol and 0.1 mg/ml BSA at 4 °C for 60 min. Samples were then analyzed by native 3.5% polyacrylamide gels (75:1 acrylamide to bis ratio) at 4 °C and run in 0.5× TG (Tris-glycine) for 70 min at 180 V constant. The gels were stained with GelRed dye for 5 min and visualized using the Tanon-2500 image system.

Cross-linking and mass spectrometry analysis

The chemical cross-linking mass spectrometry (XL-MS) analysis was performed as following steps. In brief, the purified hTIP60 complex (0.37 μM) was incubated in buffer and cross-linked by DSS (0.5 mM) for 30 min at room temperature with shaking at 500 rpm (Thermo Mixer) for 1 h. The reaction was terminated by adding 20 mM ammonium bicarbonate (Sigma). The cross-linked sample was precipitated with cooled acetone and dried in a speed vac. The pellet was dissolved in 8 M Urea, 100 mM Tris-HCl (pH 8.5), followed by TCEP reduction, iodoacetamide (Sigma) alkylation, and trypsin (Promega) digestion overnight at 37 °C using a protein/enzyme ratio of 50:1 (w/w). Tryptic peptides were desalted with Pierce C18 spin column (GL Sciences) and eluted with C18 column elute buffer (99.9% methanol and 0.1% formaldehyde). The peptides were then dried in a speed vac and resuspended with 7 μl solvent A (water with 0.1% formic acid), separated by nanoLC, and analyzed by online electrospray tandem mass spectrometry. The experiments were performed on an EASY-nLC 1200 UPLC system connected to Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific, Bremen, Germany) equipped with an online nano-electrospray ion source. A 2 μl peptide sample was loaded onto the trap column (Thermo Scientific Acclaim PepMap C18, 100 μm × 2 cm), with a flow of 10 μl/min for 3 min and subsequently separated on the analytical column (Acclaim PepMap C18, 75 μm × 50 cm) with a linear gradient, from 5 to 35% solvent B (80% ACN with 0.1% formic acid) over 108 min, 30–50% solvent B in 6 min and climbing to 100% solvent B in 1 min then holding at 100% for the last 5 min. The column was re-equilibrated at initial conditions for 10 min. The column flow rate was maintained at 300 nL/min and column temperature was maintained at 60 °C. The electrospray voltage of 2.3 kV versus the inlet of the mass spectrometer was used. The Orbitrap Exploris 480 mass spectrometer was operated in the data-dependent mode to switch automatically between MS and MS/MS acquisition. Survey full-scan MS spectra (m/z 350–1800) were acquired with a mass resolution of 60 K, followed by fifteen sequential high energy collisional dissociation (HCD) MS/MS scans with a resolution of 15 K. For MS scans, the AGC target was set to 1000,000, and the maximum injection time was 50 ms. For MS/MS, the intensity threshold was 13,000, the maximum injection time was 80 ms and the AGC target was set to 100,000. In all cases, one microscan was recorded using dynamic exclusion of 30 s. MS/MS fixed first mass was set at 110 and the normalized collision energy (NEC) of HCD was set to 30%.

To identify crosslinked peptides, the acquired raw data files were processed using pLink software (v.2.3.11)⁶⁸. The data was searched against the sequences and the reversed sequences of crosslinked peptides. The following parameters were applied for the search: enzyme = trypsin allowing up to 3 missed cleavages; peptide mass limited between 600 and 6000 Da; peptide length limited between 6 and 60; precursor tolerance = ±20 ppm; fragment tolerance = ±20 ppm; crosslinker = DSS; fixed modifications = carbamidomethylation on cysteine; variable modifications = oxidation on methionine. These candidates were then filtered to 5% FDR at the PSM level with a mass tolerance of ±10 ppm. The results were visualized using the xiNET online server (https://crosslinkviewer.org)⁶⁹.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The cryo-EM maps and coordinates for TIP60 overall, core subcomplex, and TRRAP module have been deposited to the Electron Microscopy Data Bank (EMDB) and Protein Data Bank (PDB) with accession codes EMD-38703 and PDB-8XVG; EMD-38718 and PDB-8XVT; EMD-38720 and PDB-8XVV, respectively. The cryo-EM maps of the hTIP60–NCP complex have been deposited to EMDB with accession codes EMD-60547. Previously published structures used in model building and structural comparison are available in PDB with accession codes: 8X19 (nucleosome-bound hSRCAP-C), 6GEJ (nucleosome-bound ySWR-C), 7KTR (hSAGA), 8ESC (yNuA4), 2CV5 (human nucleosome core particle), 6FML (ctINO80), 6HTS (hINO80), 6IGM (hSRCAP-C) and 8A5D (A-module of ctINO80). XL-MS data of hTIP60 have been deposited to the PRoteomics IDEntifications (PRIDE) Archive database with the accession number PXD048625. Source data are provided in this paper.

References

Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F. & Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251–260 (1997).
Article ADS PubMed CAS Google Scholar
Lai, W. K. M. & Pugh, B. F. Understanding nucleosome dynamics and their links to gene expression and DNA replication. Nat. Rev. Mol. Cell Biol. 18, 548–562 (2017).
Article PubMed PubMed Central CAS Google Scholar
Clapier, C. R. & Cairns, B. R. The biology of chromatin remodeling complexes. Annu. Rev. Biochem. 78, 273–304 (2009).
Article PubMed CAS Google Scholar
Berger, S. L. The complex language of chromatin regulation during transcription. Nature 447, 407–412 (2007).
Article ADS PubMed CAS Google Scholar
Narlikar, G. J., Fan, H. Y. & Kingston, R. E. Cooperation between complexes that regulate chromatin structure and transcription. Cell 108, 475–487 (2002).
Article PubMed CAS Google Scholar
Carrozza, M. J., Utley, R. T., Workman, J. L. & Cote, J. The diverse functions of histone acetyltransferase complexes. Trends Genet 19, 321–329 (2003).
Article PubMed CAS Google Scholar
Altaf, M. et al. NuA4-dependent acetylation of nucleosomal histones H4 and H2A directly stimulates incorporation of H2A.Z by the SWR1 complex. J. Biol. Chem. 285, 15966–15977 (2010).
Article PubMed PubMed Central CAS Google Scholar
Pray-Grant, M. G. et al. Chd1 chromodomain links histone H3 methylation with SAGA- and SLIK-dependent acetylation. Nature 433, 434–438 (2005).
Article ADS PubMed CAS Google Scholar
Ikura, T. et al. Involvement of the TIP60 histone acetylase complex in DNA repair and apoptosis. Cell 102, 463–473 (2000).
Article PubMed CAS Google Scholar
Doyon, Y. & Cote, J. The highly conserved and multifunctional NuA4 HAT complex. Curr. Opin. Genet. Dev. 14, 147–154 (2004).
Article PubMed CAS Google Scholar
Xu, Y. et al. Histone H2A.Z controls a critical chromatin remodeling step required for DNA double-strand break repair. Mol. Cell 48, 723–733 (2012).
Article PubMed PubMed Central CAS Google Scholar
Pradhan, S. K. et al. EP400 deposits H3.3 into promoters and enhancers during gene activation. Mol. Cell 61, 27–38 (2016).
Article PubMed CAS Google Scholar
Fan, J., Moreno, A. T., Baier, A. S., Loparo, J. J. & Peterson, C. L. H2A.Z deposition by SWR1C involves multiple ATP-dependent steps. Nat. Commun. 13, 7052 (2022).
Article ADS PubMed PubMed Central CAS Google Scholar
Ruhl, D. D. et al. Purification of a human SRCAP complex that remodels chromatin by incorporating the histone variant H2A.Z into nucleosomes. Biochemistry 45, 5671–5677 (2006).
Article PubMed CAS Google Scholar
Auger, A. et al. Eaf1 is the platform for NuA4 molecular assembly that evolutionarily links chromatin acetylation to ATP-dependent exchange of histone H2A variants. Mol. Cell Biol. 28, 2257–2270 (2008).
Article PubMed PubMed Central CAS Google Scholar
Lu, P. Y., Levesque, N. & Kobor, M. S. NuA4 and SWR1-C: two chromatin-modifying complexes with overlapping functions and components. Biochem. Cell Biol. 87, 799–815 (2009).
Article PubMed CAS Google Scholar
Sapountzi, V., Logan, I. R. & Robson, C. N. Cellular functions of TIP60. Int. J. Biochem. Cell Biol. 38, 1496–1509 (2006).
Article PubMed CAS Google Scholar
Jin, C. et al. H3.3/H2A.Z double variant-containing nucleosomes mark ‘nucleosome-free regions’ of active promoters and other regulatory regions. Nat. Genet. 41, 941–945 (2009).
Article PubMed PubMed Central CAS Google Scholar
Janas, J. A. et al. Tip60-mediated H2A.Z acetylation promotes neuronal fate specification and bivalent gene activation. Mol. Cell 82, 4627–4646.e4614 (2022).
Article PubMed PubMed Central CAS Google Scholar
Mattera, L. et al. The p400/Tip60 ratio is critical for colorectal cancer cell proliferation through DNA damage response pathways. Oncogene 28, 1506–1517 (2009).
Article PubMed CAS Google Scholar
Fazzio, T. G., Huff, J. T. & Panning, B. An RNAi screen of chromatin proteins identifies Tip60-p400 as a regulator of embryonic stem cell identity. Cell 134, 162–174 (2008).
Article PubMed PubMed Central CAS Google Scholar
Ravens, S., Yu, C., Ye, T., Stierle, M. & Tora, L. Tip60 complex binds to active Pol II promoters and a subset of enhancers and co-regulates the c-Myc network in mouse embryonic stem cells. Epigenetics Chromatin 8, 45 (2015).
Article PubMed PubMed Central Google Scholar
Taubert, S. et al. E2F-dependent histone acetylation and recruitment of the Tip60 acetyltransferase complex to chromatin in late G1. Mol. Cell Biol. 24, 4546–4556 (2004).
Article PubMed PubMed Central CAS Google Scholar
Tyteca, S., Vandromme, M., Legube, G., Chevillard-Briet, M. & Trouche, D. Tip60 and p400 are both required for UV-induced apoptosis but play antagonistic roles in cell cycle progression. EMBO J. 25, 1680–1689 (2006).
Article PubMed PubMed Central CAS Google Scholar
Jacquet, K. et al. The TIP60 complex regulates bivalent chromatin recognition by 53BP1 through direct H4K20me binding and H2AK15 acetylation. Mol. Cell 62, 409–421 (2016).
Article PubMed PubMed Central CAS Google Scholar
Zhang, H. et al. Structural basis for EPC1-mediated recruitment of MBTD1 into the NuA4/TIP60 acetyltransferase complex. Cell Rep. 30, 3996–4002.e3994 (2020).
Article PubMed CAS Google Scholar
Zukin, S. A. et al. Structure and flexibility of the yeast NuA4 histone acetyltransferase complex. Elife 11, e81400 (2022).
Article PubMed PubMed Central CAS Google Scholar
Bai, H. et al. Deleterious variants in TAF7L cause human oligoasthenoteratozoospermia and its impairing histone to protamine exchange inducing reduced in vitro fertilization. Front. Endocrinol. (Lausanne) 13, 1099270 (2022).
Article PubMed Google Scholar
Frechard, A. et al. The structure of the NuA4-Tip60 complex reveals the mechanism and importance of long-range chromatin modification. Nat. Struct. Mol. Biol. 30, 1337–1345 (2023).
Article PubMed CAS Google Scholar
Qu, K., Chen, K., Wang, H., Li, X. & Chen, Z. Structure of the NuA4 acetyltransferase complex bound to the nucleosome. Nature 610, 569–574 (2022).
Article ADS PubMed CAS Google Scholar
Nguyen, V. Q. et al. Molecular architecture of the ATP-dependent chromatin-remodeling complex SWR1. Cell 154, 1220–1231 (2013).
Article PubMed PubMed Central CAS Google Scholar
Lin, C. L. et al. Functional characterization and architecture of recombinant yeast SWR1 histone exchange complex. Nucleic Acids Res. 45, 7249–7260 (2017).
Article ADS PubMed PubMed Central CAS Google Scholar
Willhoft, O. et al. Structure and dynamics of the yeast SWR1-nucleosome complex. Science 362, eaat7716 (2018).
Article PubMed Google Scholar
Fuchs, M. et al. The p400 complex is an essential E1A transformation target. Cell 106, 297–307 (2001).
Article PubMed CAS Google Scholar
Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).
Article ADS PubMed PubMed Central CAS Google Scholar
Devoucoux, M. et al. MRG proteins are shared by multiple protein complexes with distinct functions. Mol. Cell Proteom. 21, 100253 (2022).
Article CAS Google Scholar
Aramayo, R. J. et al. Cryo-EM structures of the human INO80 chromatin-remodeling complex. Nat. Struct. Mol. Biol. 25, 37–44 (2018).
Article PubMed CAS Google Scholar
Feng, Y., Tian, Y., Wu, Z. & Xu, Y. Cryo-EM structure of human SRCAP complex. Cell Res. 28, 1121–1123 (2018).
Article PubMed PubMed Central Google Scholar
Latrick, C. M. et al. Molecular basis and specificity of H2A.Z-H2B recognition and deposition by the histone chaperone YL1. Nat. Struct. Mol. Biol. 23, 309–316 (2016).
Article PubMed CAS Google Scholar
He, S. et al. Structure of nucleosome-bound human BAF complex. Science 367, 875–881 (2020).
Article ADS PubMed CAS Google Scholar
Wang, L. et al. Structure of nucleosome-bound human PBAF complex. Nat. Commun. 13, 7644 (2022).
Article ADS PubMed PubMed Central CAS Google Scholar
Kunert, F. et al. Structural mechanism of extranucleosomal DNA readout by the INO80 complex. Sci. Adv. 8, eadd3189 (2022).
Article PubMed PubMed Central CAS Google Scholar
Yu, J. et al. Structural insights into histone exchange by human SRCAP complex. Cell Discov. 10, 15 (2024).
Article PubMed PubMed Central CAS Google Scholar
Setiaputra, D. et al. Molecular architecture of the essential yeast histone acetyltransferase complex NuA4 redefines its multimodularity. Mol. Cell Biol. 38, e00570–17 (2018).
Article PubMed PubMed Central CAS Google Scholar
Boudreault, A. A. et al. Yeast enhancer of polycomb defines global Esa1-dependent acetylation of chromatin. Genes Dev. 17, 1415–1428 (2003).
Article PubMed PubMed Central CAS Google Scholar
Herbst, D. A. et al. Structure of the human SAGA coactivator complex. Nat. Struct. Mol. Biol. 28, 989–996 (2021).
Article PubMed PubMed Central CAS Google Scholar
Ji, L. et al. Structure of the NuA4 histone acetyltransferase complex. Proc. Natl Acad. Sci. USA 119, e2214313119 (2022).
Article PubMed PubMed Central CAS Google Scholar
Ranjan, A. et al. Nucleosome-free region dominates histone acetylation in targeting SWR1 to promoters for H2A.Z replacement. Cell 154, 1232–1245 (2013).
Article PubMed CAS Google Scholar
Ranjan, A. et al. H2A histone-fold and DNA elements in nucleosome activate SWR1-mediated H2A.Z replacement in budding yeast. Elife 4, e06845 (2015).
Article PubMed PubMed Central Google Scholar
Gevry, N., Chan, H. M., Laflamme, L., Livingston, D. M. & Gaudreau, L. p21 transcription is regulated by differential localization of histone H2A.Z. Genes Dev. 21, 1869–1881 (2007).
Article PubMed PubMed Central CAS Google Scholar
Knoll, K. R. et al. The nuclear actin-containing Arp8 module is a linker DNA sensor driving INO80 chromatin remodeling. Nat. Struct. Mol. Biol. 25, 823–832 (2018).
Article PubMed CAS Google Scholar
Halaburkova, A. et al. Pan-cancer multi-omics analysis and orthogonal experimental assessment of epigenetic driver genes. Genome Res. 30, 1517–1532 (2020).
Article PubMed PubMed Central CAS Google Scholar
Cerami, E. et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2, 401–404 (2012).
Article PubMed Google Scholar
Papai, G. et al. Structure of SAGA and mechanism of TBP deposition on gene promoters. Nature 577, 711–716 (2020).
Article ADS PubMed CAS Google Scholar
Dyson, H. J. & Wright, P. E. Role of Intrinsic Protein Disorder in the Function and Interactions of the Transcriptional Coactivators CREB-binding Protein (CBP) and p300. J. Biol. Chem. 291, 6714–6722 (2016).
Article PubMed PubMed Central CAS Google Scholar
Klinker, H., Haas, C., Harrer, N., Becker, P. B. & Mueller-Planitz, F. Rapid purification of recombinant histones. PLoS ONE 9, e104029 (2014).
Article ADS PubMed PubMed Central Google Scholar
Lowary, P. T. & Widom, J. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol. 276, 19–42 (1998).
Article PubMed CAS Google Scholar
Dyer, P. N. et al. Reconstitution of nucleosome core particles from recombinant histones and DNA. Methods Enzymol. 375, 23–44 (2004).
Article PubMed CAS Google Scholar
Mastronarde, D. N. Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. 152, 36–51 (2005).
Article PubMed Google Scholar
Zheng, S. Q. et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods 14, 331–332 (2017).
Article PubMed PubMed Central CAS Google Scholar
Zhang, K. Gctf: Real-time CTF determination and correction. J. Struct. Biol. 193, 1–12 (2016).
Article ADS PubMed PubMed Central CAS Google Scholar
Scheres, S. H. RELION: implementation of a Bayesian approach to cryo-EM structure determination. J. Struct. Biol. 180, 519–530 (2012).
Article PubMed PubMed Central CAS Google Scholar
Pettersen, E. F. et al. UCSF Chimera–a visualization system for exploratory research and analysis. J. Comput Chem. 25, 1605–1612 (2004).
Article PubMed CAS Google Scholar
Adams, P. D. et al. PHENIX: building new software for automated crystallographic structure determination. Acta Crystallogr D Biol. Crystallogr. 58, 1948–1954 (2002).
Article ADS PubMed Google Scholar
Mirdita, M. et al. ColabFold: making protein folding accessible to all. Nat. Methods 19, 679–682 (2022).
Article PubMed PubMed Central CAS Google Scholar
Chen, V. B. et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr. D Biol. Crystallogr. 66, 12–21 (2010).
Article ADS PubMed CAS Google Scholar
Kosinski, J. et al. Xlink Analyzer: software for analysis and visualization of cross-linking data in the context of three-dimensional structures. J. Struct. Biol. 189, 177–183 (2015).
Article PubMed PubMed Central CAS Google Scholar
Chen, Z. L. et al. A high-speed search engine pLink 2 with systematic evaluation for proteome-scale identification of cross-linked peptides. Nat. Commun. 10, 3404 (2019).
Article ADS PubMed PubMed Central Google Scholar
Combe, C. W., Fischer, L. & Rappsilber, J. xiNET: cross-link network maps with residue resolution. Mol. Cell Proteom. 14, 1137–1147 (2015).
Article CAS Google Scholar
Tsunaka, Y., Kajimura, N., Tate, S. & Morikawa, K. Alteration of the nucleosomal DNA path in the crystal structure of a human nucleosome core particle. Nucleic Acids Res. 33, 3424–3434 (2005).
Article PubMed PubMed Central CAS Google Scholar

Download references

Acknowledgements

We thank the Center of Cryo-Electron Microscopy, Core Facility of Shanghai Medical College, Fudan University. This work was supported by grants from the National Key R&D Program of China (2021YFA1300100), the National Natural Science Foundation of China (32030055, 31830107, 31821002), the XPLORER Prize (Y. X.), the New Cornerstone Investigator Program (Y. X.).

Author information

These authors contributed equally: Ke Chen, Li Wang, Zishuo Yu.

Authors and Affiliations

Fudan University Shanghai Cancer Center, Institutes of Biomedical Sciences, State Key Laboratory of Genetic Engineering and Shanghai Key Laboratory of Medical Epigenetics, Shanghai Medical College of Fudan University, Shanghai, 200032, China
Ke Chen, Li Wang, Zishuo Yu, Jiali Yu, Yulei Ren, Qianmin Wang & Yanhui Xu
The International Co-laboratory of Medical Epigenetics and Metabolism, Ministry of Science and Technology, China, Department of Systems Biology for Medicine, School of Basic Medical Sciences, Shanghai Medical College of Fudan University, Shanghai, 200032, China
Yanhui Xu

Authors

Ke Chen
View author publications
You can also search for this author in PubMed Google Scholar
Li Wang
View author publications
You can also search for this author in PubMed Google Scholar
Zishuo Yu
View author publications
You can also search for this author in PubMed Google Scholar
Jiali Yu
View author publications
You can also search for this author in PubMed Google Scholar
Yulei Ren
View author publications
You can also search for this author in PubMed Google Scholar
Qianmin Wang
View author publications
You can also search for this author in PubMed Google Scholar
Yanhui Xu
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

K. C. and L. W. prepared the samples with the help of J. Y.; K. C. and Q. W. performed the cryo-EM analyses and the model building with the help of Z. Y. and Y. R.; K. C., L. W., Q. W., and Y. X. designed the experiments, analyzed the data and wrote the paper; Y. X. supervised the project.

Corresponding authors

Correspondence to Li Wang, Qianmin Wang or Yanhui Xu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Francis O Reilly, Ali Hamiche and the other, anonymous, reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Description of additional supplementary files

Supplementary Data 1

Supplementary Movie 1

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Chen, K., Wang, L., Yu, Z. et al. Structure of the human TIP60 complex. Nat Commun 15, 7092 (2024). https://doi.org/10.1038/s41467-024-51259-z

Download citation

Received: 08 January 2024
Accepted: 02 August 2024
Published: 17 August 2024
DOI: https://doi.org/10.1038/s41467-024-51259-z