The neonatal Fc receptor (FcRn) is a pan-arterivirus receptor

Shaw, Teressa M.; Huey, Devra; Mousa-Makky, Makky; Compaleo, Jared; Nennig, Kylie; Shah, Aadit P.; Jiang, Fei; Qiu, Xueer; Klipsic, Devon; Rowland, Raymond R. R.; Slukvin, Igor I.; Sullender, Meagan E.; Baldridge, Megan T.; Li, Haichang; Warren, Cody J.; Bailey, Adam L.

doi:10.1038/s41467-024-51142-x

Download PDF

Article
Open access
Published: 07 August 2024

The neonatal Fc receptor (FcRn) is a pan-arterivirus receptor

Nature Communications volume 15, Article number: 6726 (2024) Cite this article

2422 Accesses
28 Altmetric
Metrics details

Subjects

Abstract

Arteriviruses infect a variety of mammalian hosts, but the receptors used by these viruses to enter cells are poorly understood. We identified the neonatal Fc receptor (FcRn) as an important pro-viral host factor via comparative genome-wide CRISPR-knockout screens with multiple arteriviruses. Using a panel of cell lines and divergent arteriviruses, we demonstrate that FcRn is required for the entry step of arterivirus infection and serves as a molecular barrier to arterivirus cross-species infection. We also show that FcRn synergizes with another known arterivirus entry factor, CD163, to mediate arterivirus entry. Overexpression of FcRn and CD163 sensitizes non-permissive cells to infection and enables the culture of fastidious arteriviruses. Treatment of multiple cell lines with a pre-clinical anti-FcRn monoclonal antibody blocked infection and rescued cells from arterivirus-induced death. Altogether, this study identifies FcRn as a novel pan-arterivirus receptor, with implications for arterivirus emergence, cross-species infection, and host-directed pan-arterivirus countermeasure development.

Identification of CCZ1 as an essential lysosomal trafficking regulator in Marburg and Ebola virus infections

Article Open access 25 October 2023

The low-density lipoprotein receptor promotes infection of multiple encephalitic alphaviruses

Article Open access 04 January 2024

The continued threat of emerging flaviviruses

Article 04 May 2020

Introduction

Arteriviruses (Family: Arteriviridae) are enveloped viruses with a positive-sense non-segmented single-stranded (+ss)RNA genome that are distantly related to Coronaviruses (both belong to the Nidovirales Order)¹. The genetic diversity of known arteriviruses is vast, as is the diversity and geographic distribution of their many mammalian hosts^2,3,4. Arteriviruses are noteworthy for their ability to evade host immune responses, enabling their persistence in individuals and populations over long periods of time^5,6. Transmission of these viruses can occur via a variety of routes (respiratory droplet, sexual, vertical, blood-borne) and arterivirus infections can cause a wide variety of diseases ranging from long-term persistent viral shedding to acute pneumonia, abortion, encephalitis, hemorrhagic fever, and death⁷.

Host-vs-virus phylogenetic comparisons imply that arteriviruses have transmitted between hosts of different species on several occasions in the past². Indeed, two arteriviruses—simian hemorrhagic fever virus (SHFV) and porcine reproductive and respiratory syndrome virus (PRRSV)—highlight the potential of these viruses to infect new host species and cause disease. SHFV was discovered in 1964 following an outbreak of highly-lethal hemorrhagic fever in Asian-origin macaque monkeys (Macaca mulatta, Macaca fascicularis, and Macaca arctoides) at a primate quarantine facility in Bethesda, MD^8,9,10. Since this time, SHFV-like viruses have sporadically caused severe disease outbreaks in captive macaque colonies worldwide¹¹. Although African monkeys were long suspected to be the source of these outbreaks, it was not until the 2010s that SHFV-like viruses were found in wild monkeys throughout Africa^4,12.

In the 1980s, two distinct lineages of PRRSV emerged simultaneously in domesticated swine herds in Europe (PRRSV-1) and North America (PRRSV-2). Although most adult pigs exhibited mild-to-moderate signs of respiratory infection, these viruses transmit efficiently across the placenta with devastating effects on fetuses, resulting in herd-wide “abortion storms.” In recent years, several “highly pathogenic” PRRSV variants have emerged that kill ~20% of adult pigs that they infect^13,14. Annually, PRRSV infections cause billions of U.S. dollars in global economic losses¹⁵. Of note, the origins of both SHFV and PRRSV remain unknown¹⁶.

The surface topology of the arterivirion is remarkably complex for an RNA virus. Arteriviruses encode approximately seven membrane glycoproteins that coalesce to form at least two discrete (“major” and “minor”) complexes on the virion surface¹⁷. Additionally, SHFV (and all simian-infecting arteriviruses discovered to date) encode a paralogous set of minor glycoprotein genes (called “prime”) and it appears that all eleven of these membrane proteins are required for virion infectivity^18,19. Arteriviruses enter cells via clathrin-mediated endocytosis²⁰, but none of the arterivirus proteins contain a structure that resembles a typical class I, II, III, or IV viral fusion protein, suggesting a highly novel mechanism of entry.

Multiple host factors can influence arterivirus entry^17,21,22, but at least for PRRSV, infection of macrophages in vivo requires the presence of the hemoglobin-haptoglobin scavenger receptor CD163, as demonstrated by a complete lack of PRRSV-1 and PRRSV-2 replication in CD163^−/− pigs^23,24. Ectopic expression of porcine CD163 can also render non-permissive cell lines permissive to PRRSV infection in vitro^25,26,27, and we have recently shown that ectopic expression of human CD163 on certain human cell lines can sensitize these cells to infection with SHFV²⁸. Engagement of CD163 by the minor glycoprotein complex of PRRSV is thought to occur in the endosome and is presumed to mediate fusion of viral and host membranes^25,28,29. The virus-host interactions that initiate endocytosis of the virion prior to CD163 binding are less clear. For PRRSV, interactions between Siglec-1 (a.k.a., sialoadhesin, CD169) and sialic acids on GP5 can initiate internalization in vitro^30,31,32,33. Although Siglec-1 expression is largely restricted to macrophages, SIGLEC1^−/− pigs and porcine alveolar macrophages are fully susceptible to PRRSV infection³⁴. Furthermore, the MARC-145 cell line—a subpopulation of the grivet (Chlorocebus aethiops)-derived MA-104 cell line that is commonly used to propagate PRRSV—do not express Siglec-1^17,35,36. Given the large number of arterivirus envelope glycoproteins and the conspicuous gaps in our current knowledge of the arterivirus entry process, we hypothesized that interactions with additional pro-viral host factors remained to be discovered.

Results

FcRn is a pro-arteriviral host factor

The MA-104 cell line supports robust infection with SHFV and PRRSV-2, as demonstrated by production of infectious virus and the development of cytopathic effect following virus inoculation (Fig. 1A, B). We introduced a previously-described genome-wide pooled CRISPR-knockout library specific for the grivet genome into MA-104 cells, infected independent cultures with SHFV or PRRSV, and then performed deep sequencing to identify sgRNAs in surviving cells. Relative to the diversity of sgRNAs in the pre-infection library (Fig. 1C), a small number of single guide (sg)RNAs (and corresponding gene targets) were enriched post-infection, including CD163 (Fig. 1D, Supplementary Data 1). Two genes were identified as top-three hits in each screen: the Fc Gamma Receptor and Transporter Gene (FCGRT)—which encodes the neonatal Fc receptor (FcRn)—and beta-2-microglobulin (B2M)—which encodes the β2M protein that is required for proper expression of FcRn (Fig. 1D, E). Previously-reported pro-arterivirus host factors—including Siglec-1, CD151, Myosin Heavy Chain 9 (MYH9), Vimentin, DC-SIGN, or genes in the heparan sulfate synthesis pathway³⁷—were not identified as pro-viral in our screen.

To validate FcRn as a pro-viral host factor, we generated an FcRn-knockout MA-104 cell clone (MA-104ΔFcRn) using an FCGRT-targeting sgRNA. FCGRT editing was confirmed by deep sequencing and high-sensitivity mass spectrometry. Compared to cells transduced with an empty lentiviral vector, MA-104ΔFcRn cells did not produce virus (Fig. 1F) or display cytopathic effect (CPE) (Fig. 1G) when inoculated with SHFV, PRRSV, or equine arteritis virus (EAV)—a divergent arterivirus that does not use CD163 in its entry process. As expected, FcRn-knockout in MA-104 cells also conferred resistance to Echovirus-30, which is known to use FcRn as a cellular receptor^38,39. However, infection with SARS-CoV-2 (another virus in the Nidovirales Order) was unaffected by FcRn knockout, indicating that among nidoviruses, FcRn-dependence is specific to viruses in the Arteriviridae family. FcRn-knockout had no effect on the infectivity of unrelated RNA viruses that enter cells via clathrin-mediated endocytosis (yellow fever virus, (YFV)-Asibi) or a clathrin-independent mechanism (YFV-17D)⁴⁰. The human cell line ACHN is susceptible to SHFV infection when made to express human CD163 (hCD163)²⁸. Thus, we created and validated an ACHN+hCD163ΔFcRn line and showed that these cells were also completely resistant to SHFV infection as determined by lack of CPE and production of infectious virus (Fig. 1G, F), extending this finding to an additional cell line in a non-natural host species.

Transcomplementation of FcRn restores arterivirus infectivity in FcRn-knockout cells

We next reintroduced grivet (g)FcRn into our MA-104ΔFcRn cell line, resulting in substantially higher levels of FcRn expression compared to MA-104 wildtype cells (Figs. 2A, S1). FcRn overexpression rendered these cells hyper-susceptible to SHFV infection, as demonstrated by enhanced cytopathic effect (Fig. 2B) and a significantly higher proportion of cells infected (~80%) compared with wild-type MA-104s (~20%) 24 h after inoculation with SHFV, as determined by highly-sensitive RNA-FISH-flow-cytometry (Fig. 2C, D)⁴¹. This sensitizing effect was observed at early timepoints, suggesting that FcRn expression is a rate-determining step in arterivirus infection of MA-104 cells (Fig. 2E).

FcRn is involved in the entry step of the arterivirus life cycle

Lack of viral RNA accumulation in FcRn-knockout cells inoculated with SHFV suggested a role for FcRn early in the virus life cycle, prior to genome replication. Given the known localization of FcRn to the plasma membrane and early endosome⁴², and the known role of FcRn as a receptor for multiple unrelated viruses^38,39,43,44, we hypothesized that FcRn functions as an arterivirus attachment factor and/or internalization receptor. To test this, we first transfected cells with a cDNA-launch SHFV rescue plasmid¹⁸ to bypass receptor requirements for cellular entry. Indeed, the introduction of viral genomes into MA-104ΔFcRn cells resulted in the production of infectious virus into the cell supernatant (Fig. 3A, B). However, viral titers in MA-104ΔFcRn cells were diminished relative to wild-type transfected cells given that released virions were unable to infect new cells. Next, we performed internalization assays in wild-type, ΔFcRn, and ΔFcRn+gFcRn MA-104 cells demonstrating a relationship between FcRn expression and virion internalization (Fig. 3C). To demonstrate a direct interaction between FcRn and arterivirus particles, we screened a panel of anti-FcRn monoclonal antibodies, identifying orilanolimab as a promising arterivirus-blocking candidate. Further testing demonstrated that pre-treatment with orilanolimab blocks SHFV infection of MA-104 cells in a dose-dependent manner (Fig. 3D, H). We then extended this finding to multiple cell lines. First, we showed that orilanolimab blocks SHFV infection of the human ACHN+hCD163 cell line (Fig. 3E, H). We then demonstrated orilanolimab’s ability to block SHFV infection of a more physiologically-relevant cell type⁴⁵—induced-pluripotent stem cell (iPSC)-derived macrophages from macaques (mac iPSC-macs) (Fig. 3E, H, I). The use of mac iPSC-macs allowed us to expand orilanolimab blocking studies to include novel simian arteriviruses that do not infect immortalized cell lines (including MA-104) but can be cultivated on mac iPSC-macs. These viruses included Kibale Red Colobus Virus-1 (KRCV-1)—a virus discovered in a wild Ugandan red colobus monkey (Piliocolobus tephrosceles) in 2011^46,47—and Pebjah virus (PBJV), a virus that caused a highly-lethal outbreak at a primate research facility in 1989^11,48 that we recently isolated for the first time using mac iPSC-macs⁴⁹. Again, pre-treatment of mac iPSC-macs with orilanolimab significantly reduced SHFV, KRCV-1, and PBJV replication, prevented the induction of cytopathic effect, and enhanced overall survivability of mac iPSC-macs in the presence of arteriviruses (Fig. 3F–I).

FcRn overexpression enhances arterivirus infection

To explore the relationship between FcRn and CD163 in arterivirus entry in greater detail, we introduced gFcRn, gCD163, or both, into WT MA-104s, which naturally express very low levels of these pro-viral molecules (Figs. 4A, S2). We then inoculated these cells with a high dose of SHFV and stained cells for viral RNA using single-molecule (sm) RNA FISH 4 hrs after inoculation to capture events related to viral entry. Viral RNA (vRNA) was visualized via confocal microscopy (Fig. 4B) and quantification was performed on multiple images from each condition (Fig. 4C). Compared to WT cells, overexpression of gCD163 had minimal effect on the percentage of vRNA+ cells, the number of puncta per infected cell, or the fluorescent intensity per infected cell. In contrast, introduction of gFcRn (or gFcRn+gCD163) increased each of these parameters. Interestingly, gFcRn+gCD163 dual-overexpressing MA-104 cells did not produce significantly more virus than WT MA-104 cells (Fig. 4D). However, these cells exhibited markedly more severe CPE (Fig. 4E), which translated into larger and more well-defined plaques when these cells were used as a substrate for plaque assay (Fig. 4F). When used to quantify virus in a plaque assay, the enhanced sensitivity of gFcRn (and gFcRn+gCD163) overexpressing cells resulted in detection of 5-10-fold more virus in the same sample (Fig. 4F, G).

CD163 overexpression does not compensate for the absence of FcRn

Given these results, we wondered if FcRn overexpression could compensate for a complete lack of CD163, and vice versa. To evaluate this, we introduced gFcRn into MA-104ΔCD163 cells and gCD163 into MA-104ΔFcRn cells (Figs. 5A, S3). Compared to WT MA-104s, both of these cell lines were significantly impaired in their ability to produce infectious virus above background levels, with the MA-104ΔFcRn + gCD163 cells able to produce ~1 log of virus relative to background while the MA-104ΔCD163+gFcRn cells were completely incapable of supporting infection (Fig. 5B). Similar trends were also observed using smFISH to evaluate the percent of vRNA+ cells, the average puncta per cell, and the average intensity per puncta (Fig. 5C).

FcRn and CD163 synergize to sensitize non-susceptible cells to arterivirus infection

Vero cells are another Chlorocebus-derived kidney epithelial cell line that are widely used to culture many different types of viruses, but unlike MA-104s Vero cells are not susceptible to arterivirus infection. We wondered whether this resistance could be due to a lack of FcRn, CD163, or both. To explore this idea, we first performed a Western blot and confirmed the absence of FcRn and CD163 in WT Vero cells; we then introduced gFcRn, gCD163, or both into Vero cells (Figs. 6A, S4). The addition of gFcRn alone was unable to sensitize Veros to SHFV infection. Addition of gCD163 did allow for a small but measurable amount of productive infection, but titers only achieved ~1 log greater than our limit of detection and no CPE was noted. However, addition of both gFcRn+gCD163 had a synergistic effect, resulting in a ~ 4.5 log increase in SHFV production and CPE typical of an SHFV permissive cell line (Fig. 6B, C).

FcRn is a molecular barrier to arterivirus cross-species infection

Emerging evidence suggests that the ability of divergent arteriviruses to utilize CD163 orthologs from different host species may be an important determinant of cross-species infection²⁸. To examine whether FcRn represents a similar species-barrier, we cloned FCGRT cDNA from grivet, pig, human, and mouse tissue; we also synthesized the equine FCGRT ortholog. These cDNAs were ectopically expressed in MA-104ΔFcRn cells which were then inoculated with SHFV, PRRSV, and EAV (Fig. 7A). For comparison, we also performed a similar experiment using CD163 orthologs, introducing these genes into MA-104ΔCD163 cells (Fig. 7B). While SHFV could only use grivet and human CD163 orthologs for infection, PRRSV could utilize all CD163 orthologs tested and EAV infection was independent of CD163. A similar pattern emerged for FcRn, with SHFV productively utilizing grivet, human, and horse—but not mouse or pig FcRn. Interestingly, PRRSV could utilize all FcRn orthologs tested except for mouse, while EAV could utilize all orthologs. Thus, FcRn appears to represent a significant molecular barrier to arterivirus cross-species infection at the molecular level.

FcRn/CD163-overexpressing cells can be used to isolate fastidious arteriviruses

Among simian arteriviruses, SHFV is unique in its ability to be cultivated on immortalized cell lines. We wondered if overexpression of FcRn and CD163 could render MA-104 cells permissive to infection with highly-divergent simian arteriviruses. To test this, we inoculated MA-104+gFcRn+gCD163 cells with KRCV-1 and PJBV, using SHFV as a control. MA-104+gFcRn+gCD163 cells were able to support high-titer replication of KRCV-1, as evidenced by increasing concentrations of KRCV-1 RNA in the supernatant (Fig. 8A) and the induction of cytopathology (Fig. 8B). However, the same was not true for PJBV. The supernatant positive for KRCV-1 RNA formed plaques on MA-104+gFcRn+gCD163 cells (Fig. 8C, D), substantiating the production of infectious virus and enabling PFU-based quantification of KRCV-1.

**Fig. 8: FcRn/CD163-overexpressing cells can be used to isolate new arteriviruses.**

Discussion

FcRn plays several unique physiologic roles, the most prominent of these being the “recycling” of albumin and IgG molecules that are internalized by cells (mainly endothelial cells and macrophages) via nonspecific mechanisms like pinocytosis⁴². Upon acidification of the endosomal compartment, protonation of residues on IgG and albumin lead to enhanced affinity for FcRn, which “rescues” these molecules from proteasomal degradation. This common and highly orchestrated process clearly presents an attractive point of vulnerability that multiple unrelated groups of viruses are able to exploit to enter cells. This is particularly noteworthy given that non-enveloped viruses (i.e., echoviruses and astroviruses) and enveloped viruses (i.e., arteriviruses) have evolutionarily converged on this pathway as a means of cellular entry.

The specific way(s) in which each of these different viruses interacts with FcRn—and the unique and shared features amongst these interactions—is an important topic of ongoing investigation. Within the echoviruses, strains E2, E15, and E18 use FcRn for attachment and uncoating of the viral capsid⁴³, whereas most other echoviruses employ a two-step entry process in which CD55 mediates virion attachment and FcRn mediates uncoating following endosomal acidification^38,50. Our data imply that arterivirus entry is also a multistep process involving FcRn and CD163. Although CD163 has historically been referred to as a “receptor” for PRRSV⁵¹ and, more recently SHFV²⁸, there is little evidence that CD163 functions as the fusogenic receptor in arterivirus entry (i.e., mediates fusion of the viral and host membranes). Both FcRn and CD163 cycle between the cell surface and early endosomes^42,52, so the timing of FcRn and CD163 binding could plausibly happen in any order. Although binding of arteriviruses to CD163 and FcRn could occur simultaneously, multiple lines of evidence presented here (blocking SHFV infection of CD163-overexpressing cells with an anti-FcRn antibody; the requirement of both FcRn and CD163 to render non-permissive cells susceptible to infection) strongly suggests that interactions between arterivirus virions, FcRn, and CD163 occurs in a step-wise manner. Deciphering this process is made all the more complicated by the unusual preponderance of glycoproteins decorating arterivirions—none of which resemble a typical class I, II, III, or IV viral fusion protein⁵³. Nevertheless, determining the timing of these events is an immediate priority for arterivirus research.

In normal physiology, once IgG and albumin bind to FcRn, they are rescued from degradation and released back into circulation, effectively extending the halflife of circulating IgG and albumin by 3–5 fold⁴². Consequently, antagonism of FcRn (e.g., by anti-FcRn antibodies) dramatically reduces the halflife of albumin and IgG resulting in hypoalbuminemia and hypogammaglobulinemia^42,54,55. Thus, it is tempting to speculate that arteriviruses function as FcRn antagonists as part of their immune-evasion strategy, compromising humoral immunity and potentially contributing to arterivirus persistence in individual hosts. It is also possible that FcRn binding may traffic the virus into a non-degrading pathway, further promoting the virion’s survival upon endocytosis. In the absence of CD163 (i.e., in a non-permissive cell), it is theoretically plausible that arterivirus virions are treated simply as “cargo” by FcRn, which could have implications for arterivirus persistence and vertical transmission. For example, in FcRn⁺/CD163^– endothelial cells, this could result in the intracellular storage of arterivirus virions along with IgG and albumin, allowing for the slow release of virions back into circulation; thus creating a semi-“latent” reservoir of virus that could play an important role in persistence. In FcRn⁺/CD163^– syncytiotrophoblasts, FcRn may actively transport arterivirus virions across the blood-placental barrier in a manner similar to the transcytosis of maternal IgGs into fetal circulation; this could explain how PRRSV efficiently transmits across the placental barrier to infect fetal piglets⁵⁶.

Aside from the biological implications of our discovering FcRn as a pan-arterivirus receptor, this finding has practical implications for all virologists working with arteriviruses. Ectopic expression of FcRn enhances the sensitivity of cells to arterivirus infection, resulting in faster-growing and more well-defined plaques. Plaque assays performed on these cells also yield significantly greater virus titers compared to wild-type MA-104 cells, implying that wild-type MA-104 cells and their MARC-145 subclones—which have served as the gold-standard for plaquing arteriviruses for decades—inaccurately under-quantify infectious arterivirus titers. FcRn/CD163-overexpressing cells will also be a useful tool for isolating fastidious arteriviruses that refuse to grow in MA-104s, which includes the majority of simian arteriviruses.

With viral metagenomic surveys continuing to identify new arteriviruses, it will be interesting to see how (and if) these different viruses utilize FcRn in their entry process. Our data suggests that at least five divergent arteriviruses (SHFV, KRCV-1, PBJV, PRRSV-2, and EAV) use FcRn in their entry process. Understanding the nuances of species-specific FcRn utilization will be important in anticipating the spillover of arteriviruses into new hosts, as our data indicates that FcRn can function as a molecular barrier to cross-species arterivirus infection. FcRn utilization also represents a potential point of vulnerability in the arterivirus life cycle that could be targeted for therapeutic and/or prophylactic purposes. As we show, clinical and pre-clinical anti-FcRn antibodies can block infection of cells in vitro with diverse arteriviruses; thus, it may be possible to prevent arterivirus infection or transmission in vivo via injection of an anti-FcRn antibody. Given that no direct-acting antivirals for arteriviruses exist, a host-directed pan-arterivirus countermeasure (e.g., anti-FcRn monoclonal antibody) may prove particularly useful in the event of a novel arterivirus emergence.

Methods

Ethics statement

The use of animals for this research was reviewed and approved by the UW-Madison IACUC.

Cell lines

MA-104 cells used in this study came from two different sources. Experiments performed in the lab of ALB, which included the CRISPR-knockout screen and generation of FCGRT-knockout cells, used MA-104 cells from Megan Baldridge, originally from the lab of Harry Greenberg (Stanford). Experiments performed in the laboratory of CJW used MA-104 cells purchased from ATCC (catalog # CRL-2378.1). Most experiments were performed independently by each lab, and major differences between the two lineages of MA-104 cells were not observed. The creation and maintenance of ACHN+hCD163 cells was described previously²⁸. MA-104 and ACHN cells were maintained in DMEM (Gibco) supplemented with 10% FCS (Omega Scientific) + 1% L-Glutamine (Gibco), +1% Sodium Pyruvate (Gibco) + 1% Hepes (Gibco). iPSC macrophages were differentiated and maintained as previously described⁵⁷. MA104 cells that were trans-complemented with Sleeping Beauty constructs were selected in either 10 µg/mL puromycin (Gibco) or 250 µg/mL Hygromycin B (Gibco). ACHN and MA-104 CRISPR-knockout lines were maintained in 10 µg/mL or 5 µg/mL Blasticidin (Gibco) respectively. Grivet kidney Vero E6 cells (ATCC Cat# CRL-1586) were maintained in DMEM supplemented with 10% FBS and 1× penn/strep. Vero cells engineered to stably express CD163 and/or FcRn were selected using 200 µg/mL hygromycin and/or 10 µg/mL puromycin, respectively.

Viruses

SHFV strain LVR and PRRSV-2 strain VR-2332 were obtained from Dr. Kay Faaberg (USDA–Ames) and propagated/titrated on MA-104 cells. Human echovirus 30 was obtained from ATCC (catalog # VR-1660) and propagated/titrated on MA-104 cells. SARS-CoV-2 strain USA-WA1/2020 was obtained from BEI Resources (catalog # NR-52281) and propagated/titrated on Vero E6-TMPRSS2-T2A-ACE2 (BEI catalog # NR-54970). YFV strains Asibi and 17D were obtained from WRCEVA and propagated/titrated on Vero E6 cells from ATCC (CRL-1586). KRCV-1 and PBJV stocks were obtained from Jens Kuhn (NIH, NIAID)⁵⁸ and stocks prepared via inoculation of macaque iPSC cells described previously⁴⁹. A recombinant SHFV cDNA-launch plasmid expressing eGFP was provided by Jens Kuhn. To avoid autofluorescence with macrophage cell lines, eGFP was removed by restriction enzyme digest (NotI and SpeI, NEB #R3189S, #R3133S), and the gene for mCherry was added by gibson assembly (NEB, #E2621S). A stock was generated by transfecting MA-104 cells with 2 µg of plasmid using TransIT-LT1 (Mirus, #MIR 2304) following the manufacturer’s instructions.

Plaque assays

Prior to plaquing, MA-104 cells were seeded at a density of 2 × 10⁵ cells per well in a 24-well plate (TPP). Ten-fold serial dilutions were performed in DMEM + 2% FCS + 1%Hepes and 400 µL of diluted virus was added to each well. Plates were incubated for 1 hr at 37 °C with gentle rocking every 15 min. After 1 h, 400 µL of prewarmed 1% (w/v) methylcellulose (Sigma Aldrich) in 1× MEM (Gibco) was added to each well. Plates inoculated with SHFV, SARS-CoV-2, Echovirus 30 were cultured for 2 days. PRRSV and EAV were cultured for 3 and 4 days respectively. Prior to staining, cells were fixed in a final volume of 4% PFA in PBS then plaques were visualized using 0.05% crystal violet in methanol. Plaque counts were enumerated manually.

Focus forming assays

YFV focus-forming assay was performed as described previously⁵⁹, using 2D12 hybridoma (ATCC, CRL-1689) supernatant (1:1000) as primary antibody.

CRISPR-knockout screen in MA-104 cells

2.4 × 10⁷ MA-104 cells containing the grivet (Chlorocebus sabaeus) sgRNA Library (Addgene Pooled Library #178284) were inoculated with an MOI ≈ 1 for both SHFV and PRRSV. CPE was monitored daily. When CPE was nearly complete, all but 5 mL of media was removed and replenished with complete cell growth media. Cultures were observed to undergo multiple rounds of cytolysis followed by outgrowth of surviving cells; this ceased approximately three weeks after virus inoculation, at which time surviving cells were collected (~8 × 10⁶ cells) and DNA was extracted using the NucleoSpin Blood XL Kit (Macherey-Nagel) following manufacturer’s instructions. PCR reactions to amplify libraries were carried out using Platinum II Taq Hot Start DNA Polymerase (Invitrogen) in accordance with the “PCR protocol for Illumina sequencing preparation” associated with the sgRNA library on AddGene’s website. Illumina deep sequencing was performed at the UW–Madison Biotechnology Center on a shared 150 × 150 NovaSeq run targeting 1 M reads per condition. sgRNA sequences targeting specific genes were pre-processed (removal of adaptor sequences) and analyzed through the published tool MAGeCK version 0.5.9.5⁶⁰.

CRISPR-knockout of FcRn in cell lines

Sequence for an sgRNA targeting the Chlorocebus sabaeus FCGRT gene (AGAAAGAGACCACAGATCTG) was pulled from the library file associated with the Chlorocebus sabaeus CRISPR-knockout library⁶¹. Alternatively, the CRISPick algorithm (GRCh38, SpyoCas9) was used to design a sgRNA targeting the Homo sapiens FCGRT gene (ACTGGGCCCTGACAACACCT)^62,63. These sgRNA were cloned into the the LentiCRISPR_v2-blasticidin lentiviral vector (Addgene plasmid #83480) which was used to introduce sgRNAs into MA-104 and ACHN + CD163 cells, respectively. Knockout was confirmed by deep sequencing (Illumina NovaSeq) across the sgRNA-edited target region, high sensitivity mass spectrometry, and Western blot.

Genetic trans-complementation

RNA extracted from MA-104 cells (grivet), ACHN cells (human), primary peritoneal macrophages (mouse), and primary lung tissue (pig) was used to generate FCGRT cDNA for the amplification and cloning of FCGRT. The horse FCGRT gene was synthesized de novo (IDT). These DNA fragments were then cloned into the pSBbi Sleeping Beauty vector system (Addgene)⁶⁴, which was used to stably express FcRn orthologs in cell lines.

Western blot

Cells were lysed in Nonidet P-40 (NP-40) lysis solution composed of the following: 150 mM NaCl (Promega #VA4221), 50 mM tris-HCl pH 7.4, 1% NP-40 (G-Biosciences, #DG001), 1 mM DTT (IBI Scientific, #IB2104), 1 l/mL Benzonase (Sigma, #E1014-25KU), and 1× EDTA-Free Protease Inhibitor mixture (Sigma # 11873580001). Briefly, cells were detached from tissue-culture plates by trypsin treatment, inactivated with FBS-containing media, and then pelleted (300 × g for 5 min) and washed once with PBS. PBS-washed cells were resuspended in the NP-40 lysis solution and incubated on ice for 30 min. Cell lysates were cleared by centrifugation at 16,000 × g for 15 min at 4 ºC. Whole-cell extracts were quantified using a BCA protein assay (ThermoFisher Scientific, #23227). 10 µg of total protein was resolved with polyacrylamide gel electrophoresis using gels prepared with the SureCast gel handcast system (ThermoFisher Scientific, #HC1000SR). Proteins were electrophoretically transferred to Immobilon-P PVDF membranes using a wet transfer apparatus set at 20 V for 1 h. Membranes were blocked for 1 hr at ambient temperature in blocking agent (Nestle Carnation 5% nonfat dried milk in TBST [1× tris-buffered saline + 0.1% Tween 20]). Primary antibodies, including CD163 (goat polyclonal anti-CD163 antibody [R&D Systems, #AF1607]), FcRn (rabbit polyclonal anti-FcRn [Abcam, #ab193148]), and beta-actin (mouse monoclonal 8H10D10 [Cell Signaling Technology, #3700 S]) were diluted in TBST + 5% nonfat dried milk and incubated either overnight at 4 °C (CD163 and FcRn) or for 1 h at ambient temperature (beta-actin). After primary incubation, cells were washed 3 times for 5 min in TBST. Secondary antibodies donkey anti-goat IgG HRP conjugate (Thermo-Fisher, #A16005), anti-mouse IgG HRP conjugate (Cell Signaling, #7076 S), anti-rabbit IgG HRP conjugate (Cell Signaling, #7074 S) were diluted in TBST + 5% nonfat dried milk and incubated with the membrane for 1 h at ambient temperature. After secondary incubation, membranes were washed 3 times for 5 min in TBST, developed using (ECL western blotting detection reagent Amersham, #RPN2232), and imaged on a ChemiDoc imaging System (Bio-Rad).

RNA FISH-flow

RNA FISH-Flow assays were performed as described previously^28,41. Briefly, at the indicated times following virus exposure, the cell culture media was removed, and the cells were washed with PBS. Cells were detached with trypsin and then transferred to individual wells of a 96-well v-bottom plate. Cells were washed once with PBS and fixed with 4% PFA for 10 mins. After fixation, the cells were washed three times with PBS and then permeabilized with cold 70% EtOH for at least 1 h at 4 ºC. EtOH permeabilized cells were washed once with Wash Buffer A and resuspended in 50 µl of hybridization buffer containing probe (1:1000 dilution of SHFV-ORF1a-Atto633 labeled probes in hybridization buffer). The plate was incubated in the dark for 2 h at 37 ºC. After the incubation, 150 µl of wash buffer A was added and the cells were pelleted (500 × g for 5 min). Pelleted cells were resuspended in wash buffer A and incubated in the dark at 37 °C for 30 min. After incubation, the cells were pelleted, washed once in wash buffer B, and resuspended in FACS buffer (PBS + 2% FBS and 1 mM EDTA). Samples were analyzed on an Attune Flow Cytometer (ThermoFisher Scientific). At least 20,000 live cell events were collected following singlet discrimination. Data was analyzed with FlowJo v10.8.2.

Single-molecule FISH

Single-molecule FISH (smFISH) was performed as described previously²⁸. Briefly, cells were seeded onto acid-etched coverslips in 6-well plates at ~80% confluence. Cells were infected with SHFV (MOI = 30) or mock exposed for 1 h at 37 °C 5% C0₂. Following exposure, the cells were washed with PBS (3 times), the media was replaced (EMEM 2% FBS), and then the cells were allowed to continue incubating for 3 additional hours. After the incubations (4 h total), the cell growth medium was removed and the cells were washed once with PBS. The cells were then fixed (4% PFA in PBS for 10 min at room temperature), permeabilized (70% ice-cold ethanol for 1 h at 4 °C), and washed with Wash Buffer A (2× SSC, 10% deionized formamide, diluted in nuclease-free water). The coverslips were removed from the 6-well dish and inverted (cell side down) onto hybridization buffer (10% dextran sulfate, 10% deionized formamide, 2× SSC, diluted in nuclease-free water) containing ATTO633 labeled SHFV ORF1a RNA FISH-Flow probes (diluted 1:200) overnight (<16 h; in the dark at 37 °C) in a humidified chamber. For more details on probe design and buffer preparation, see ref. ⁴¹. The next day, the coverslips were transferred to a new six-well dish containing Wash Buffer A and incubated in the dark at 37 °C for 30 min. After incubation, the Wash Buffer A was removed and replaced with Wash Buffer B (2× SSC diluted in nuclease-free water) for 5 min. The coverslips were then mounted onto slides using ProLong Gold Antifade Mountant with DNA stain DAPI (Invitrogen) and imaged after an overnight curing step.

Confocal microscopy and image analysis

All images were captured using a Nikon Ti2 confocal microscope with a 60× oil lens. The data was analyzed using NIS-Elements AR 5.30.06 software (Nikon.inc). The number of cells and virus particles in each sample field was determined using the segmentation function. The intensity of virus particles (smFISH puncta) was quantified through binary processing, measurement, and data management functions. For all samples, the data was collected with identical parameters, and imaging and analysis followed a double-blind procedure.

Receptor-bypass transfection experiments

Cells were seeded in 6-well dishes at 3 × 10⁵ cells per well. The next day, cells were transfected with lipofectamine 3000 using the following conditions: Tube A (150 ul Opti-MEM, 4.5 μl lipofectamine 3000) and Tube B (150 μl Opti-MEM, 3 μg recombinant SHFV [rSHFV] expressing cDNA-launch plasmid, and 6 μl P3000). The contents of tube A were mixed into tube B, incubated for 10 min at ambient temperature, and then added dropwise to cells. To reduce the toxicity associated with residual transfection reagent, the media was changed to EMEM 2% FBS 4–6 h post transfection. The cells were allowed to incubate for the indicated timepoints, and then the cell supernatant was harvested for virus titrations by plaque assay.

Quantification of virus by RT-qPCR

For quantification of viral RNA in cell culture supernatants or sera, RNA was extracted from a 20- or 50-μL sample using a KingFisher Flex (Thermo Fisher Scientific) with the MagMAX Viral/Pathogen Nucleic Acid Isolation Kit (Thermo Fisher Scientific). RNA was eluted in 50 μL H₂O, of which 8.5 μL was carried forward for quantitative reverse-transcription PCR (RT-qPCR). Virus-specific TaqMan assays were designed for detection of each virus using GenBank-deposited simarterivirus genome sequence data, Primer3 (https://primer3.org/) for primer and probe design, and IDT for primer and probe synthesis based on the FAM and Zen/Iowa-Black dual-quencher system—KRCV-1-F: ACACGGCTACCCTTACTCC; KRCV-1-R: TCGAGGTTAARCGGTTGAGA; KRCV-1-P: TTCTGGTCCTCTTGCGAAGGC; PBJV-F: GAGGATGGTCGCCTCAACTA; PBJV-R: AAGGACCCTCGTCAAATTCA; PBJV-P: TGCTGTCATCACACCAGATG; SHFV-F: CGACCTCCGAGTTGTTCTACCT; SHFV-R: GCCTCCGTTGTCGTAGTACCT; SHFV-P: CCCACCTCAGCACACATCAAACAGCT. The TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) was used for RT-qPCR setup. Thermocycling was performed on a Quantstudio 6 Pro (Thermo Fisher Scientific) using the following conditions: reverse transcription at 48 °C for 15 min; initial denaturation at 95 °C for 10 min; 50 cycles at 95 °C for 15 s followed by incubation at 60 °C for 1 min, during which signal acquisition was performed. Using a custom-designed in vitro-transcribed RNA standard curve for SHFV, we determined that cycle threshold (Ct) values of ≈38–40 corresponded to ≈10 RNA copies per reaction and thus represented a generalizable limit of detection for the purposes of this study.

Blocking assays

Wild type MA-104 cells, ACHN + hCD163, iPSC macrophages were plated at a seeding density of 4 × 10⁴ cells in a 96-well plate (TPP Techno Plastic Products AG) in complete growth media. Prior to inoculation, plating media was removed and orilanolimab (Invitrogen, #MA5-42215) or IgG4,k isotype control (MedChemExpress, #HY-P99003) in serum free media was added. Cells were preincubated at 4 °C for 1 hr. After the initial incubation, SHFV and KRCV-1 (MOI 0.1) were added and the cells were incubated for 24 hrs at 37 C, 5% CO₂ without removal of virus or antibody. PBJV was tested using a MOI 0.10-equivalent-volume. Cell supernatant was collected and stored at −80 °C prior to titration by plaque assay or RT-qPCR.

Viability assay

Viability was assessed using CellTiter-Glo 2.0 (Promega #G9241) following the manufacturer’s instructions. Luminescence was measured using a CLARIOstar plate reader (BMG Labtech).

Statistics and reproducibility

Based upon the relatively large effect size observed in many of the experimental systems, group sizes of 2–4 were chosen based primarily on logistical and workflow considerations; no formal statistical analysis was used to predetermine sample sizes. To enhance rigor and reproducibility, we attempted to show a statistically significant effect in as many different virus and host systems as possible. We considered the number of groups and distribution of data when selecting statistical tests; we also followed best practices regarding multiple comparison testing. No data were excluded from the analyses and experiments were not randomized. The Investigators were not blinded to allocation during experiments and outcome assessment.

Data availability

The underlying data that support the findings of this study are freely available in the Dryad repository: https://doi.org/10.5061/dryad.h9w0vt4s6 and are also included as an accompanying “source data” file with this paper. Source data are provided with this paper.

References

Fields virology. (Wolters Kluwer/Lippincott Williams & Wilkins Health, Philadelphia, PA, 2013).
Shi, M. et al. The evolutionary history of vertebrate RNA viruses. Nature 556, 197–202 (2018).
Article ADS CAS PubMed Google Scholar
Kuhn, J. H. et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch. Virol. 161, 755–768 (2015).
Bailey, A. L. et al. Arteriviruses, pegiviruses, and lentiviruses are common among wild African monkeys. J. Virol. 90, 6724–6737 (2016).
Article CAS PubMed PubMed Central Google Scholar
Carossino, M. et al. Equine arteritis virus long-term persistence is orchestrated by CD8+ T lymphocyte transcription factors, inhibitory receptors, and the CXCL16/CXCR6 axis. PLoS Pathog. 15, e1007950 (2019).
Article CAS PubMed PubMed Central Google Scholar
Ke, H. & Yoo, D. The viral innate immune antagonism and an alternative vaccine design for PRRS virus. Vet. Microbiol. 209, 75–89 (2017).
Article CAS PubMed PubMed Central Google Scholar
Snijder, E. J., Kikkert, M. & Fang, Y. Arterivirus molecular biology and pathogenesis. J. Gen. Virol. 94, 2141–2163 (2013).
Article CAS PubMed Google Scholar
Palmer, A. E., Allen, A. M., Tauraso, N. M. & Shelokov, A. Simian hemorrhagic fever. I. Clinical and epizootiologic aspects of an outbreak among quarantined monkeys. Am. J. Trop. Med. Hyg. 17, 404–412 (1968).
Article CAS PubMed Google Scholar
Tauraso, N. M., Shelokov, A., Palmer, A. E. & Allen, A. M. Simian hemorrhagic fever. 3. Isolation and characterization of a viral agent. Am. J. Trop. Med. Hyg. 17, 422–431 (1968).
Article CAS PubMed Google Scholar
Allen, A. M., Palmer, A. E., Tauraso, N. M. & Shelokov, A. Simian hemorrhagic fever. II. Studies in pathology. Am. J. Trop. Med. Hyg. 17, 413–421 (1968).
Article CAS PubMed Google Scholar
Lauck, M. et al. Historical outbreaks of simian hemorrhagic fever in captive macaques were caused by distinct arteriviruses. J. Virol. 89, 8082–8087 (2015).
Article CAS PubMed PubMed Central Google Scholar
Bailey, A. L. et al. Zoonotic potential of simian arteriviruses. J. Virol. 90, 630–635 (2016).
Article CAS PubMed Google Scholar
Kappes, M. A. & Faaberg, K. S. PRRSV structure, replication and recombination: origin of phenotype and genotype diversity. Virology 479–480, 475–486 (2015).
Article PubMed Google Scholar
Tian, K. et al. Emergence of fatal PRRSV variants: unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PloS One 2, e526 (2007).
Article ADS PubMed PubMed Central Google Scholar
Holtkamp, D. J. et al. Economic impact of porcine reproductive and respiratory syndrome virus on U.S. pork producers. https://www.iastatedigitalpress.com/air/article/id/5752/ (2012).
Goyal, S. M. Porcine reproductive and respiratory syndrome. J. Vet. Diagn. Invest. 5, 656–664 (1993).
Article CAS PubMed Google Scholar
Dokland, T. The structural biology of PRRSV. Virus Res. 154, 86–97 (2010).
Article CAS PubMed Google Scholar
Cai, Y. et al. Development and characterization of a cDNA-launch recombinant simian hemorrhagic fever virus expressing enhanced green fluorescent protein: ORF 2b’ is not required for in vitro virus replication. Viruses 13, 632 (2021).
Article CAS PubMed PubMed Central Google Scholar
Vatter, H., Di, H., Donaldson, E., Baric, R. & Brinton, M. Each of the eight simian hemorrhagic fever virus minor structural proteins is functionally important. Virology 462–463, 351–362 (2014).
Article PubMed Google Scholar
Caì, Y. et al. Simian hemorrhagic fever virus cell entry is dependent on CD163 and uses a clathrin-mediated endocytosis-like pathway. J. Virol. 89, 844–856 (2015).
Article PubMed Google Scholar
Van Gorp, H., Van Breedam, W., Delputte, P. L. & Nauwynck, H. J. Sialoadhesin and CD163 join forces during entry of the porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 89, 2943–2953 (2008).
Article PubMed Google Scholar
Su, C.-M., Rowland, R. R. R. & Yoo, D. Recent advances in PRRS virus receptors and the targeting of receptor-ligand for control. Vaccines 9, 354 (2021).
Article CAS PubMed PubMed Central Google Scholar
Burkard, C. et al. Precision engineering for PRRSV resistance in pigs: macrophages from genome edited pigs lacking CD163 SRCR5 domain are fully resistant to both PRRSV genotypes while maintaining biological function. PLoS Pathog. 13, e1006206 (2017).
Article PubMed PubMed Central Google Scholar
Wells, K. D. et al. Replacement of porcine CD163 scavenger receptor cysteine-rich domain 5 with a CD163-like homolog confers resistance of pigs to genotype 1 but not genotype 2 porcine reproductive and respiratory syndrome virus. J. Virol. 91, e01521-16 (2017).
Article PubMed PubMed Central Google Scholar
Calvert, J. G. et al. CD163 expression confers susceptibility to porcine reproductive and respiratory syndrome viruses. J. Virol. 81, 7371–7379 (2007).
Article CAS PubMed PubMed Central Google Scholar
Lee, Y. J. et al. Generation of a porcine alveolar macrophage cell line for the growth of porcine reproductive and respiratory syndrome virus. J. Virol. Methods 163, 410–415 (2010).
Article CAS PubMed Google Scholar
Wang, X. et al. PK-15 cells transfected with porcine CD163 by PiggyBac transposon system are susceptible to porcine reproductive and respiratory syndrome virus. J. Virol. Methods 193, 383–390 (2013).
Article ADS CAS PubMed Google Scholar
Warren, C. J. et al. Primate hemorrhagic fever-causing arteriviruses are poised for spillover to humans. Cell 185, 3980–3991.e18 (2022).
Das, P. B. et al. The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory syndrome virus interact with the receptor CD163. J. Virol. 84, 1731–1740 (2010).
Article CAS PubMed Google Scholar
Vanderheijden, N. et al. Involvement of sialoadhesin in entry of porcine reproductive and respiratory syndrome virus into porcine alveolar macrophages. J. Virol. 77, 8207–8215 (2003).
Article CAS PubMed PubMed Central Google Scholar
Delputte, P. L. & Nauwynck, H. J. Porcine arterivirus infection of alveolar macrophages is mediated by sialic acid on the virus. J. Virol. 78, 8094–8101 (2004).
Article CAS PubMed PubMed Central Google Scholar
Delputte, P. L. et al. Porcine arterivirus attachment to the macrophage-specific receptor sialoadhesin is dependent on the sialic acid-binding activity of the N-terminal immunoglobulin domain of sialoadhesin. J. Virol. 81, 9546–9550 (2007).
Article CAS PubMed PubMed Central Google Scholar
Van Breedam, W. et al. The M/GP(5) glycoprotein complex of porcine reproductive and respiratory syndrome virus binds the sialoadhesin receptor in a sialic acid-dependent manner. PLoS Pathog. 6, e1000730 (2010).
Article PubMed PubMed Central Google Scholar
Prather, R. S. et al. An intact sialoadhesin (Sn/SIGLEC1/CD169) is not required for attachment/internalization of the porcine reproductive and respiratory syndrome virus. J. Virol. 87, 9538–9546 (2013).
Article CAS PubMed PubMed Central Google Scholar
Kim, H. S., Kwang, J., Yoon, I. J., Joo, H. S. & Frey, M. L. Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line. Arch. Virol. 133, 477–483 (1993).
Article CAS PubMed Google Scholar
Duan, X., Nauwynck, H. J., Favoreel, H. W. & Pensaert, M. B. Identification of a putative receptor for porcine reproductive and respiratory syndrome virus on porcine alveolar macrophages. J. Virol. 72, 4520–4523 (1998).
Article CAS PubMed PubMed Central Google Scholar
Ye, N., Wang, B., Feng, W., Tang, D. & Zeng, Z. PRRS virus receptors and an alternative pathway for viral invasion. Virus Res. 320, 198885 (2022).
Article CAS PubMed Google Scholar
Zhao, X. et al. Human neonatal Fc receptor is the cellular uncoating receptor for enterovirus B. Cell 177, 1553–1565.e16 (2019).
Article CAS PubMed PubMed Central Google Scholar
Morosky, S. et al. The neonatal Fc receptor is a pan-echovirus receptor. Proc. Natl. Acad. Sci. USA 116, 3758–3763 (2019).
Article ADS CAS PubMed PubMed Central Google Scholar
Fernandez-Garcia, M. D. et al. Vaccine and wild-type strains of yellow fever virus engage distinct entry mechanisms and differentially stimulate antiviral immune responses. MBio 7, e01956–01915 (2016).
Article CAS PubMed PubMed Central Google Scholar
Warren, C. J. et al. Quantification of virus-infected cells using RNA FISH-Flow. STAR Protoc. 4, 102291 (2023).
Article CAS PubMed PubMed Central Google Scholar
Pyzik, M. et al. The neonatal Fc receptor (FcRn): a misnomer? Front. Immunol. 10, 1540 (2019).
Article CAS PubMed PubMed Central Google Scholar
Chen, X. et al. Human FcRn is a two-in-one attachment-uncoating receptor for echovirus 18. mBio 13, e01166-22 (2022).
Article PubMed PubMed Central Google Scholar
Haga, K., Takai-Todaka, R., Kato, A., Nakanishi, A. & Katayama, K. Neonatal Fc receptor is a functional receptor for human astrovirus. bioRiv http://biorxiv.org/lookup/doi/10.1101/2022.11.13.516297 (2022).
Yang, Q. et al. Macrophages derived from human induced pluripotent stem cells (iPSCs) serve as a high-fidelity cellular model for investigating HIV-1, dengue, and influenza viruses. J. Virol. 98, e0156323 (2024).
Lauck, M. et al. Novel, divergent simian hemorrhagic fever viruses in a wild Ugandan red colobus monkey discovered using direct pyrosequencing. PloS One 6, e19056 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Bailey, A. L. et al. High genetic diversity and adaptive potential of two simian hemorrhagic fever viruses in a wild primate population. PLoS One 9, e90714 (2014).
Article ADS PubMed PubMed Central Google Scholar
Renquist, D. Outbreak of simian hemorrhagic fever. J. Med. Primatol. 19, 77–79 (1990).
Article CAS PubMed Google Scholar
Shaw, T. M. et al. Isolation of diverse simian arteriviruses causing hemorrhagic disease. Emerg. Infect. Dis. 30, 4 (2024).
Wang, K. et al. Structures of Echovirus 30 in complex with its receptors inform a rational prediction for enterovirus receptor usage. Nat. Commun. 11, 4421 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Welch, S.-K. W. & Calvert, J. G. A brief review of CD163 and its role in PRRSV infection. Virus Res. 154, 98–103 (2010).
Article CAS PubMed Google Scholar
Schaer, C. A., Schoedon, G., Imhof, A., Kurrer, M. O. & Schaer, D. J. Constitutive endocytosis of CD163 mediates hemoglobin-heme uptake and determines the noninflammatory and protective transcriptional response of macrophages to hemoglobin. Circ. Res. 99, 943–950 (2006).
Article CAS PubMed Google Scholar
Snijder, E. J. & Meulenberg, J. J. The molecular biology of arteriviruses. J. Gen. Virol. 79, 961–979 (1998).
Article CAS PubMed Google Scholar
Roopenian, D. C. et al. The MHC class I-like IgG receptor controls perinatal IgG transport, IgG homeostasis, and fate of IgG-Fc-coupled drugs. J. Immunol. 170, 3528–3533 (2003).
Article CAS PubMed Google Scholar
Ulrichts, P. et al. Neonatal Fc receptor antagonist efgartigimod safely and sustainably reduces IgGs in humans. J. Clin. Investig. 128, 4372–4386 (2018).
Article PubMed PubMed Central Google Scholar
Balasuriya, U. B. & Carossino, M. Reproductive effects of arteriviruses: equine arteritis virus and porcine reproductive and respiratory syndrome virus infections. Curr. Opin. Virol. 27, 57–70 (2017).
Article PubMed Google Scholar
Choi, K.-D., Vodyanik, M. & Slukvin, I. I. Hematopoietic differentiation and production of mature myeloid cells from human pluripotent stem cells. Nat. Protoc. 6, 296–313 (2011).
Article CAS PubMed PubMed Central Google Scholar
Wahl-Jensen, V. et al. Divergent simian arteriviruses cause simian hemorrhagic fever of differing severities in macaques. mBio 7, e02009–e02015 (2016).
Article CAS PubMed PubMed Central Google Scholar
Bailey, A. L. et al. Consumptive coagulopathy of severe yellow fever occurs independently of hepatocellular tropism and massive hepatic injury. Proc. Natl. Acad. Sci. USA 117, 32648–32656 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Li, W. et al. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol. 15, 554 (2014).
Article PubMed PubMed Central Google Scholar
Wei, J. et al. Genome-wide CRISPR screens reveal host factors critical for SARS-CoV-2 infection. Cell 184, 76–91.e13 (2021).
Article CAS PubMed Google Scholar
Doench, J. G. et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 34, 184–191 (2016).
Article CAS PubMed PubMed Central Google Scholar
Sanson, K. R. et al. Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities. Nat. Commun. 9, 5416 (2018).
Article ADS CAS PubMed PubMed Central Google Scholar
Kowarz, E., Löscher, D. & Marschalek, R. Optimized sleeping beauty transposons rapidly generate stable transgenic cell lines. Biotechnol. J. 10, 647–653 (2015).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This work was funded in part by grants from the National Institutes of Health (NIH): R00AI151256 (C.J.W.) and R21AI180295 (A.L.B. & C.J.W.). Startup funds (A.L.B.) via the Department of Pathology and Laboratory Medicine and the School of Medicine and Public Health at the University of Wisconsin–Madison were utilized for the study. M.T.B. was supported by The G. Harold and Leila Y. Mathers Foundation and the Burroughs Wellcome Fund Pathogenesis of Infectious Disease Program. The authors utilized the University of Wisconsin–Madison Biotechnology Center for deep sequencing and mass spectrometry.

Author information

These authors contributed equally: Cody J. Warren, Adam L. Bailey.

Authors and Affiliations

Department of Pathology and Laboratory Medicine, University of Wisconsin–Madison School of Medicine and Public Health, Madison, WI, USA
Teressa M. Shaw, Kylie Nennig, Xueer Qiu, Igor I. Slukvin & Adam L. Bailey
Department of Veterinary Biosciences, The Ohio State University, Columbus, OH, 43210, USA
Devra Huey, Makky Mousa-Makky, Jared Compaleo, Fei Jiang, Haichang Li & Cody J. Warren
Viruses and Emerging Pathogens Program, Infectious Diseases Institute, The Ohio State University, Columbus, OH, USA
Devra Huey, Makky Mousa-Makky, Jared Compaleo & Cody J. Warren
Stanford University School of Medicine, Stanford, CA, 94305, USA
Aadit P. Shah
Research Animal Resources and Compliance (RARC), University of Wisconsin–Madison, Madison, WI, USA
Devon Klipsic
Department of Pathobiology, College of Veterinary Medicine, University of Illinois Urbana-Champaign, Urbana, IL, USA
Raymond R. R. Rowland
Division of Infectious Diseases, Department of Medicine, Edison Family Center for Genome Sciences & Systems Biology, Washington University School of Medicine, St. Louis, MO, 63110, USA
Meagan E. Sullender & Megan T. Baldridge
Department of Surgery, The Ohio State University College of Medicine, Columbus, OH, 43210, USA
Haichang Li
Center for RNA Biology, The Ohio State University, Columbus, OH, USA
Cody J. Warren
Center for Retrovirus Research, The Ohio State University, Columbus, OH, USA
Cody J. Warren

Authors

Teressa M. Shaw
View author publications
You can also search for this author in PubMed Google Scholar
Devra Huey
View author publications
You can also search for this author in PubMed Google Scholar
Makky Mousa-Makky
View author publications
You can also search for this author in PubMed Google Scholar
Jared Compaleo
View author publications
You can also search for this author in PubMed Google Scholar
Kylie Nennig
View author publications
You can also search for this author in PubMed Google Scholar
Aadit P. Shah
View author publications
You can also search for this author in PubMed Google Scholar
Fei Jiang
View author publications
You can also search for this author in PubMed Google Scholar
Xueer Qiu
View author publications
You can also search for this author in PubMed Google Scholar
Devon Klipsic
View author publications
You can also search for this author in PubMed Google Scholar
Raymond R. R. Rowland
View author publications
You can also search for this author in PubMed Google Scholar
Igor I. Slukvin
View author publications
You can also search for this author in PubMed Google Scholar
Meagan E. Sullender
View author publications
You can also search for this author in PubMed Google Scholar
Megan T. Baldridge
View author publications
You can also search for this author in PubMed Google Scholar
Haichang Li
View author publications
You can also search for this author in PubMed Google Scholar
Cody J. Warren
View author publications
You can also search for this author in PubMed Google Scholar
Adam L. Bailey
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization: A.L.B. and C.J.W.; methodology: A.L.B., C.J.W., T.M.S., A.P.S., M.T.B.; investigation: T.M.S., D.H., M.M.M., J.C., K.N., A.P.S., F.J., X.Q., D.K., M.E.S., M.T.B., H.L., C.J.W., A.L.B.; writing–original draft: A.L.B., C.J.W.; writing–review & editing, all authors; funding acquisition: A.L.B. & C.J.W.; resources: A.L.B., C.J.W., R.R.R.R., M.B., I.I.S.; supervision: A.L.B. and C.J.W.

Corresponding authors

Correspondence to Cody J. Warren or Adam L. Bailey.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Jay Calvert and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Description of Additional Supplementary Files

Supplementary Data 1

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Shaw, T.M., Huey, D., Mousa-Makky, M. et al. The neonatal Fc receptor (FcRn) is a pan-arterivirus receptor. Nat Commun 15, 6726 (2024). https://doi.org/10.1038/s41467-024-51142-x

Download citation

Received: 13 March 2024
Accepted: 31 July 2024
Published: 07 August 2024
DOI: https://doi.org/10.1038/s41467-024-51142-x