Abstract
Cancer incidence escalates exponentially with advancing age; however, the underlying mechanism remains unclear. In this study, we build a chronological molecular clock at single-cell transcription level with a mammary stem cell-enriched population to depict physiological aging dynamics in female mice. We find that the mammary aging process is asynchronous and progressive, initiated by an early senescence program, succeeded by an entropic late senescence program with elevated cancer associated pathways, vulnerable to cancer predisposition. The transition towards senescence program is governed by a stem cell factor Bcl11b, loss of which accelerates mammary ageing with enhanced DMBA-induced tumor formation. We have identified a drug TPCA-1 that can rejuvenate mammary cells and significantly reduce aging-related cancer incidence. Our findings establish a molecular portrait of progressive mammary cell aging and elucidate the transcriptional regulatory network bridging mammary aging and cancer predisposition, which has potential implications for the management of cancer prevalence in the aged.
Similar content being viewed by others
Introduction
Aging has been recognized as the greatest risk factor for the vast majority of cancer types. As a significant extension of global lifespan, the burden of cancer incidence and cancer mortality have been rapidly increasing as major challenges to human health worldwide1,2. Despite extensive advances in aging studies at the molecular, cellular and organismal levels, the exponential association between cancer occurrence and age3,4,5 has persisted for years, and the underlying biology of this etiological phenotype remains largely unclear. Understanding how physiological aging programs impact carcinogenesis is therefore of particular interest and an imperative research direction for preventing cancer prevalence.
In contrast to the uncontrolled proliferation of cancer cells, in aging tissue, a senescence program is frequently activated, which suppresses cell proliferation, through the p53-p21 and p16Ink4a-Rb pathways6,7 and is accompanied by activated β-galactosidase8, global alteration of H3K9me3 abundance9,10, induction of senescence-associated secretory phenotype (SASP) factor activity11 and disturbed immune ecosystem12. In general, these pathways impair long-term stem cell self-renewal ability13, induce chronic inflammation14 and interfere with tissue homeostasis15, ultimately leading to the acquisition of degenerative phenotypes. The prevailing idea to explain aging-caused cancer involves accumulation of mutations during aging, which promotes the transformation of cells into cancer cells16,17,18,19; however, the degree to which this transformation drives cancer is not clear20, largely because concordance between mutation rates and cancer profiles for aged individuals is lacking and because increased longevity is associated with lower cancer incidence3,21. Alternatively, aging tissue may secrete a plethora of SASP factors, forming a fertile environment for neighboring cells to promote cancer initiation22. Intriguingly, recent discoveries have indicated that the stemness program can be triggered by senescence during embryonic development23,24, wound healing25,26,27,28,29, and drug treatment in cancer30. Whether this reprogramming underpins the physiological aging process and whether it contributes to cancer initiation remain unclear. Understanding chronological aging dynamics under physiological conditions and the underlying driving force mediating aging are crucial in establishing a biological connection between aging and cancer.
In this study, we address the potential connection between aging and cancer by building a chronological transcriptome map at the single-cell level with a stem cell-enriched mammary population in mice of various ages (from 2 to 29 months). We identify heterogeneous cell states in mice at each individual age with distinct senescence programs (early or late) vulnerable to breast cancer predisposition. In addition, we identify a master transcription factor, Bcl11b, that comprehensively suppresses both early and late senescence programs and find that loss of Bcl11b expression dramatically accelerates aging and tumor formation. Reversing the senescence program by TPCA-1 treatment efficiently reduces the cancer incidence and extends the cancer latency time. Our study establishes a molecular aging trajectory for mouse mammary cells and reveals an intrinsic molecular link between aging and cancer, which may shed light on preventive strategies against breast cancer occurrence in the future.
Results
A chronological single-cell transcriptome analysis reveals asynchronous dynamics of a mammary stem cell-enriched population during aging
Recently, single-cell studies have revealed hallmarks of aging in mammary gland cells at discrete ages, defined as young and old31,32,33,34,35; however, the chronological aging process of mammary gland cells has not been well documented. Because initial oncogenic mutations occur in long-lived stem cells/progenitors36,37, we were particularly interested in the molecular progression of aging in a mammary stem cell-enriched population. We therefore sorted mammary stem cell-enriched populations (CD49fhighEpCAMlow)38,39, which included all the mammary stem cells identified to date40,41,42,43, from mice of various biological ages spanning from 2 months to 29 months and performed single-cell RNA sequencing (RNA-seq) with 3’ UTR Smartseq44,45,46 (Fig. 1a; Supplementary Fig. 1a; Supplementary Data 1). We extracted transcriptome information of 1981 cells from 25 mice (1–4 mice at each age) and detected 20629 genes. A subsequent t-distributed stochastic neighbor embedding (t-SNE) analysis revealed that the vast majority of the mammary cells obtained from mice of various ages were thoroughly intermingled (Fig. 1b). These cells shared a similar transcriptome and uniformly expressed Keratin14 and Keratin5 across different age groups (Fig. 1c, Supplementary Fig. 1h), suggesting that they share the same fate.
To build a molecular clock and thus gauge dynamic transcriptomic changes with age, we performed a trajectory analysis with Monocle 2 and reconstructed a linear pseudotime ordering of mammary cells at different mouse ages. Remarkably, the mammary cells at different mouse ages clearly followed a chronological order, with the cells isolated from younger mice aligning with the early pseudotime stage and the cells isolated from older mice aligning with the later pseudotime stage (Fig. 1d). This finding indicates that an age-related transcriptome program defines the intrinsic cell state. Indeed, when we clustered the differentially expressed genes on the basis of the pseudotime, the signature genes in the mammary cells were classified into four different states with distinct gene expression patterns (Fig. 1e, f and Supplementary Fig. 1c). Interestingly, the mammary cells of each individual mouse comprised all four-state cells, with their relative abundance being the only difference (Fig. 1g, h and Supplementary Fig. 1b). We then quantified the relative abundance of the cells in each cell state throughout the aging process and found that the number of State 1 cells kept decreasing with age and that of the State 4 cells showing an increasing trend (State 1: p = 0.0052; State 2: p = 0.73; State 3: p = 0.72; State 4: p = 0.05). The number of state 2 cells remained relatively constant, while that of State 3 cells temporarily increased and then decreased (Fig. 1i and Supplementary Fig. 1b, d–g). Even in the individual mice of same age, we observed variation of relative abundance of the four cell states, suggesting that the ageing of mice was not synchronous. But when they were analyzed as age groups, the trend was clear. These data suggest that the mammary CD49hiEpCAMlow cells are heterogeneous with distinct cell states and that the aging phenotype may be manifested by the relative abundance of various cell states.
Distinct senescent mammary cell states induce progressive aging dynamics
To further characterize the biological identities of each individual cell state, we performed pathway analysis. We plotted the activity of each signaling pathway over pseudotime to visualize the chronological dynamics, and we identified six distinct dynamic patterns (Fig. 2a). Pattern 1 pathways exhibited the highest activity in State 1, gradually declined throughout the entire time course to the last state. These pathways included ‘DNA replication’, ‘mismatch repair’, ‘oxidative phosphorylation’, ‘beta-alanine metabolism’ and ‘valine, leucine and isoleucine degradation’. The decreased activity of ‘DNA replication’ and ‘mismatch repair’ with increased pseudotime aligned with the notion that DNA mutations accumulate during aging47,48. In addition, this finding indicated that State 1 cells are younger cells with higher DNA repair ability and metabolic activity. Consistent with Pattern 1, Pattern 2 pathways showed a transient increase in activity during the State1-2 transition, followed by a rapid decline. Pattern 2 exhibited only one activated pathway, ‘mitochondria ribosome’. The low pathway enrichment level may suggest low transcriptional activity and a relatively quiescent state. Indeed, when we plotted metabolism-related pathways, we found that State 2 cells exhibited relatively low metabolic lipid, amino acid and carbon activity but higher TGFbeta signaling pathway activity (Fig. 2b) than State 1 cells. In addition, a cell cycle analysis49 suggested that State 2 cells contain a relatively high portion of cells in the G0 phase compared to that of the other cells (Fig. 2c, d). Given the low metabolism in State 2 cells, we labeled these cells quiescent young (q-Young) cells, and we labeled State 1 cells active young (a-Young) cells.
Patterns 3–5 shared a similar increase in activity with nuanced differences. The activity of Pattern 3 pathways, including the ‘NF-kappaB signaling pathway’, ‘p53 signaling pathway’, ‘HIF1 signaling pathway’ and ‘ferroptosis’, peaked in State 3 and then quickly decreased in State 4 (Fig. 2a). Notably, activation of the NF-kB and p53 pathways correlated with aging phenotypes50,51. Pattern 4 pathways were activated in State 3 and then reached a plateau level that persisted into State 4. This pattern included ‘cellular senescence’, ‘cytokine–cytokine receptor interaction’ and ‘Toll-like receptor signaling pathway’ (Fig. 2a). This finding suggests that both State 3 and State 4 cells had an activated senescence program. In accordance with this supposition, the expression of SASP program genes, a hallmark of senescent cells, was elevated in both State 3 and State 4 cells (Fig. 2e–f, Supplementary Fig. 3a-b). Pattern 5 included pathways continuously increased activity in both States 3 and 4. These pathways included ‘IL-17 signaling’, ‘JAK-STAT signaling’, ‘mTOR signaling’, ‘PI3K-Akt signaling’, ‘MAPK signaling’, ‘Ras signaling’, ‘TGFbeta signaling’, ‘breast cancer’ and, most notably, ‘signaling pathways regulating pluripotency of stem cells’ (Fig. 2a). The activation of these gene pathways suggests that State 4 cells, despite expressing the senescence program, had acquired stem cell traits and cell growth/survival programs, which may have predisposed them to a precancerous phenotype. We therefore named State 3 cells early senescence (e-Sen) cells, while State 4 cells were called late senescence (l-Sen) cells. Pattern 6 contained pathways activated later, between State 3 and State 4, indicating that they might be functionally involved in driving the transition from the e-Sen phenotype to the l-Sen phenotype (Fig. 2g). These pathways included ‘Hedgehog signaling’, ‘Notch signaling’ and ‘Wnt signaling’ (Fig. 2a). All of the six pathway patterns dynamics remained the same in different age groups (Supplementary Fig. 2), suggesting that the dynamics were intrinsic to the cell state irrespective of their biological age. Some of the signaling pathways were confirmed by immunohistochemical (IHC) staining (Fig. 2h–k and Supplementary Fig. 3c-f).
These intriguing distinct senescence programs suggest that senescent cells are heterogeneous and that physiological aging progresses in a sophisticated manner with altered homeostasis among four different cellular states, not through a young-old binary switch. This unique physiological aging process is consistent with the in vitro senescence dynamics induced by oncogenes52,53, as well as the aberrant activation of senescence and stem cell programs during embryogenesis23,24, wound healing26,28 and cancer drug treatment30, indicating a pervasive underlying mechanism.
Breast cancer initiation is associated with l-Sen program
l-Sen cells exhibited aberrantly activated cancer- and stem cell-related programs, and have reduced P53 activity and enhanced PI3K-Akt activity. Considering that P53 and PIK3CA are the two most prominent mutation genes in breast cancer54, we speculate that l-Sen cells have increased their vulnerability toward cancer transformation. This prompted us to ask, do these programs predispose cells to a precancer state? We therefore analyzed the paired human breast samples (tumor and tumor adjacent normal tissue) in TCGA database for pathway activity and transcription factor activity (Fig. 3a). Interestingly, compared to the adjacent normal tissue, breast tumors were significantly elevated for various senescence related pathways, and the l-Sen program related pathways, including Notch signaling, Wnt signaling (TCF7L1, LEF1), Hedgehog signaling (GLI1, GLI2), and pluripotency related factors (MYC, SOX2 and KLF4), while e-Sen specific NFkB pathway was tuned down (Fig. 3b and Supplementary Fig. 4a-c). This suggests that breast tumor tissues are closely associated with l-Sen signature.
To ask whether the l-Sen program is turned on at the initiation stage of breast tumor, we used a dimethylbenz(a)anthracene (DMBA)-mediated breast cancer development model55,56, which was shown to predominantly trigger breast tumors57, and analyzed tumor initiation foci at very early stage (Fig. 3c). Consistent with human breast tumors, the senescence related signals and pluripotency related signals were all upregulated at the onset of tumor formation (Fig. 3d–h). Meanwhile, we found that DMBA, besides its function causing genetic mutations, also triggered mammary cell senescence with a prominent l-Sen cell expansion and senescence related pathway activation, suggesting the tumor initiation process is accompanied with l-Sen program activation (Fig. 3i–n). Consistent with this idea, we found that mammary cells colony formation ability significantly decreased from young to old mice, but recovered in the geriatric mice where they have significant expansion of l-Sen population (Fig. 3o, p).
To further characterize the kinetics of the physiological aging process, we employed a single-cell signaling entropy algorithm58 to profile the dynamics of cellular entropy (Fig. 3q, r). The cellular entropy of a-Young, q-Young and e-Sen cells remained at a relatively low level, with a slight decrease from the a-Young to the q-Young cells (p < 0.01) and an increase from the q-Young to the e-Sen cells (p < 0.05). Remarkably, the entropy of the l-Sen cells was strikingly elevated compared with that of the e-Sen cells (p < 0.001), indicating a drastic systemic disorder and a potential chromatin reorganization59. The increase in entropy suggests that e-Sen cells transition to the l-Sen state in a passive spontaneous manner in the absence of extrinsic inputs. Therefore, we speculated that mammary aging might be initiated and determined during the early q-Young-to-e-Sen transition, which is crucial for subsequent l-Sen state commitment.
The q-Young-to-e-Sen cell transition is mediated by the mammary stem cell factor Bcl11b
To determine the factors that drive the transition from the q-Young to the e-Sen state, we constructed a limited gene regulation network using the chromatin immunoprecipitation followed by sequencing (ChIP-seq) ENCODE and ChEA databases, along with the text curated database TRRUST of transcriptional regulatory networks, and we superimposed our network onto the expression matrix of the four aging-cell states to infer the key transcription factors in each cell state (Fig. 4a; Supplementary Data 2). The highest fidelity factors supported by multiple databases were selected (Fig. 4b).
With a transcriptional inference algorithm, we pinpointed 38 state-specific fate determinants in total (Fig. 4b), of which the majority were found in l-Sen state cells (Supplementary Fig. 4d). Interestingly, the factors in young state cells, such as Hcfc1 and Srf, have been previously associated with longevity60,61. In the l-Sen state cells, we found that factors such as Cebpb, Cebpd and Cebpz were associated with SASP secretion52,62; Stat3, which is the downstream effector in the Jak-stat pathway; Tcf3 and Tcf7l2, which are key effectors in the Wnt signaling pathway; and Kdm5b, which is a histone demethylase that contributes to Rb-mediated cellular senescence63. Most interestingly, we observed Nanog and Pou5f1 which were associated with pluripotent stem cells. These factors were consistent with the pathway analysis, reinforcing the idea that in l-Sen state cells, the stem cell program is aberrantly activated.
In identifying the factors critical for the initiation of the e-Sen cell state, we concentrated our attention on e-Sen transcription factors. The activity plot showed that Tcf7l2, Rnf2, Fosl1, Gata3 and Hsf1 were all increasing their activity during the q-Young-to-e-Sen transition, with the exception that Bcl11b sharply decreased its activity (Fig. 4c; Supplementary Data 3). Bcl11b is a previously identified modulator of mammary stem cell self-renewal and quiescence, the loss of which results in stem cell exhaustion41. As Bcl11b is a predominant transcriptional repressor64,65,66, a decreased Bcl11b activity is a reflection of the activation of Bcl11b-repressed targets. This finding suggests that the initiation of early senescence may be mediated by the loss of Bcl11b function.
Accelerated mammary ageing phenotypes was triggered by loss of Bcl11b
We then wondered whether Bcl11b is a key factor mediating the mammary senescence switch. To determine the mechanism of Bcl11b function, Bcl11b expression was knocked out in mammary glands, and the Bcl11b-knockout (KO) mammary tissues exhibited reduced ductal width (Supplementary Fig. 5d–h), enhanced β-galactosidase activity (Fig. 4d), and elevated p16Ink4a (Fig. 4e and Supplementary Fig. 5a), which are typical markers of senescent cells7,8. In multiple aging organs, the stem cell population has been frequently shown to expand with declining functionality67,68,69,70. Specific to aging mammary glands, a phenotype of an increased basal percentage has been reported to be acquired with age71, which is consistent with our observation of the mammary gland as the mice aged (Fig. 4f and Supplementary Fig. 5b). We analyzed Bcl11b-KO cells in a Krt14-cre Bcl11bfl/fl mT/mG mouse, in which the green fluorescent cells represented Bcl11b-KO cells, and the red fluorescent cells were the Bcl11b WT control cells (Supplementary Fig. 5c). We found that, compared with the control cells in the same mouse, the Bcl11b-KO cells exhibited significant increase of basal percentage at a young age (Fig. 4g). Given that our previous data showed that knocking out Bcl11b expression significantly reduced mammary stem cell self-renewal ability and promoted stem cell exhaustion41, consistent with aging mammary stem cells (Supplementary Fig. 5i-j), these apparently expanded basal cells may undergo functional decline. Overall, these data collectively suggest that loss of Bcl11b function triggered an accelerated aging process.
Ageing has usually been defined on the basis of certain biomarkers or functional assays; however, these methods are of limited value when aging cells are heterogeneous. Because we built a molecular clock of mammary cell aging, we tried to use a chronological map to gauge the aging grades of the Bcl11b-KO cells. When we included the Bcl11b-KO cells in the aging pseudotime analysis and reconstructed the trajectory, we found that the vast majority of the Bcl11b-KO cells spontaneously accumulated at the later stage and coclustered with l-Sen cells (Supplementary Fig. 6), with a notably diminished q-Young peak (Fig. 4h, p < 0.000001). Hence, quantification of each aging stage revealed that the number of a-Young and q-Young cells was drastically reduced compared with that of the age-matched wild-type (WT) cells, while the number of e-Sen and l-Sen cells was profoundly increased (Fig. 4h, i and Supplementary Fig. 6 f). This finding suggested that Bcl11b-KO underwent substantially accelerated aging progression, and cells rapidly entered a state very similar to that of senescent cells.
To determine which aging-related molecular pathways were altered by knocking out Bcl11b, we performed a pathway analysis (Fig. 4j and Supplementary Fig. 7; Supplementary Data 4). The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the activity levels of the typical aging-related pathways, including ‘MAPK signaling’, ‘PI3K-Akt signaling’, ‘IL17 signaling’, ‘cellular senescence’, ‘NF-kB signaling’, and ‘p53 signaling’, were all significantly upregulated in the Bcl11b-KO cells, indicating a systemic aging state. In addition, the senescence-related SASP program was also elevated in the Bcl11b-KO cells, which was accompanied by increased cellular entropy (Fig. 4k, l). Overall, these data demonstrate that Bcl11b may be a molecular switch regulating the q-Young-to-e-Sen transition, ultimately promoting the l-Sen chaos.
Senescent mammary cells induced by Bcl11b KO are susceptible to cancer transformation
Next, we try to address whether the accelerated mammary ageing is intrinsically coupled with cancer in the DMBA based treatment cancer initiation model. In this tumor model, we found that the DMBA induced tumor cells predominantly originated from Krt14+ basal cells (Supplementary Fig. 8a–c), and the mammary cells showed prominent age-related susceptibility to chemical induced cancer transformation (Fig. 5a–c). We therefore determined to address whether the senescent mammary cells caused by Bcl11b loss are vulnerable to cancer transformation with the DMBA-induced breast tumor formation assay for WT and Bcl11b-KO cells. We tried to prevent microenvironmental factors from influencing the results by transplanting control and Bcl11b-KO cells into recipient mice at a saturated dose and then performed DMBA treatment after full mammary tree formation (Fig. 5d). Intriguingly, the mice that received the Bcl11b-KO cells acquired tumors much earlier and faster than the control recipient mice, ultimately exhibiting a much higher cancer incidence with age (Fig. 5e, f). We further characterized the WT and Bcl11b-KO tumors by scRNA-seq to address the possibility that the tumors originated from cells neighboring senescent cells (Supplementary Fig. 8d). We reasoned that if neighboring cells give rise to tumors, then WT and Bcl11b tumor cells likely have a similar phenotype. Interestingly, a gene set enrichment assay (GSEA) showed that WT tumor cells were significantly enriched with a-Young signature genes, while Bcl11b-KO tumor cells were enriched with l-Sen genes (Fig. 5g). In addition, the Bcl11b-KO tumor cells themselves exhibited high levels of senescence-associated cytokine IL6 and high NF-kB activity (Fig. 5h, i). Bcl11b-KO also increased immune checkpoint pathway (PD-L1 and PD-1) (Supplementary Fig. 8e), consistent with its role in promoting tumor formation. These data support the idea that the l-Sen cells induced by knocking out Bcl11b expression were intrinsically susceptible to transformation into cancer cells.
Multiple aging- and longevity-related pathways are governed by Bcl11b
We then asked, how does Bcl11b play such a striking role in mammary cell senescence? To answer this question, we performed ChIP-seq analysis to profile the targets of Bcl11b in mammary cells. We detected 1197 Bcl11b binding sites in the genome, with 918 promoter binding sites and 279 enhancer binding sites (Fig. 6a, b; Supplementary Data 3). The KEGG and GO pathway enrichment analysis revealed that many of the aging-associated pathways were the direct targets of Bcl11b, including the energy/nutrient sensing pathways ‘PI3K-Akt signaling’, ‘mTOR signaling’, ‘AMPK signaling’, which have been implicated in longevity regulation72; the inflammation pathway ‘TNF signaling’; the fate determination pathway ‘Notch signaling”, and ‘Wnt signaling’ and cancer-related pathways (Fig. 6c, d; Supplementary Data 5). We also identified targets associated with pluripotency and the NF-kB pathway that were regulated by Bcl11b activity (Supplementary Fig. 9a). These pathways were also associated with both the q-Young-to-e-Sen and e-Sen-to-l-Sen cell transitions. These findings suggest that Bcl11b is a master regulator of aging progression by comprehensively repressing aging-associated pathways.
As a stress sensing pathway, ‘NF-kB signaling’ has been recognized as an important contributor to the aging process; therefore, we wondered whether Bcl11b physiologically regulates NF-kB’s activity. A NF-kB luciferase activity assay suggested that induced expression of Bcl11b efficiently repressed NF-kB activity that had been triggered by TNFα, lipopolysaccharide (LPS) or phorbol myristate acetate (PMA) (Fig. 6e–h). Bcl11b regulates NF-kB expression by upstream of the signaling pathway, as indicated by the nuclear transport of RelA, the degradation of IkBa, and the activation of IKKa/b all blocked by Bcl11b expression (Fig. 6i–k and Supplementary Fig. 9b). When we analyzed our ChIP-seq data, we found that Bcl11b directly bound to the promoter regions of Irak2 (an essential NF-kB signaling mediator), Nfkbia and Nfkb2, suggesting direct transcriptional regulation (Supplementary Fig. 9a). Indeed, when we induced the expression of Bcl11b, the mRNA expression of Irak2 was significantly suppressed (Fig. 6l and Supplementary Fig. 9c). These data collectively demonstrate that Bcl11b directly regulates the mammary cell stress response program as one of the mechanisms to slow down aging progression.
NF-kB promotes stem cell exhaustion in the absence of Bcl11b
NF-kB signaling is a well-characterized stress-sensing pathway73 and plays pleiotropic roles in a variety of biological processes74. This pathway is aberrantly activated during aging through an unclear mechanism. We asked, under what conditions does NF-kB activation convert a cell from a young state to a senescent state? To answer this question, we first tested stem cell activity after NF-kB activation in WT cells and Bcl11b-KO cells and found that the enforced expression of IKKb triggered NF-kB activation (Supplementary Fig. 10a–c) but did not significantly reduce the mammary reconstitution ability in the WT cells (1 in 32 of the control cells vs. 1 in 67 of the IKKb-overexpressing cells, p > 0.05) (Fig. 6m, Supplementary Fig. 10d, f, i, j). However, when the activation of NF-kB was performed in cells with a Bcl11b-KO background, the mammary reconstitution ability was significantly reduced (1 in 2455 Bcl11b-KO cells vs. 1 in 11401 Bcl11b-KO+IKKb-positive cells, p < 0.01) (Fig. 6n, Supplementary Fig. 10e, g, i, k, l). The differential NF-kB activation effects in cells with different backgrounds imply that NF-kB activity alone is not sufficient to drive stem cell exhaustion, and the reduced regeneration ability, which is a frequent hallmark of tissue aging, is initiated through a specific epigenetic modification program involving multiple signaling pathways that depend on Bcl11b expression. In accordance with this idea, we observed differential colony formation rates of IKKb-expressing WT and Bcl11b-KO cells (Fig. 6o and Supplementary Fig. 10h), indicating that Bcl11b may protect mammary cells from aging in response to NF-kB activation.
Manipulation of l-Sen cells regulates aging-related cancer transformation
We then explored the possibility of reversing the progressive aging process as a strategy to reduce cancer vulnerability. As the Bcl11b activity declined with age, we screened a small customized drug pool to identify a chemical drug that would enable us to reduce the number of senescent cells and increase the number of young cells. We tested PI3K-Akt-mTOR inhibitors, NF-kB pathway inhibitors, Jak-Stat inhibitors, wnt inhibitors, notch inhibitors and hedgehog inhibitors to evaluate their roles in enhancing Bcl11b expression, which is an indication of a young cell state. We found that TPCA-175,76, a dual NF-kB and Jak-Stat inhibitor, exerted the most striking effect in restoring Bcl11b expression, while other NF-kB or Jak-Stat single pathway inhibitors played minimal roles in Bcl11b expression, indicating that aging is a progressive and coordinated process that might require the input of multiple pathways (Fig. 7a and Supplementary Fig. 11a). Consistent with the role played by TPCA-1 in promoting Bcl11b expression in vitro (Fig. 7b and Supplementary Fig. 11b), when we administered TPCA-1 to 12 month-old mice continuously for 1 month, mammary CD49fhighEpCAMlow cells were clearly younger, showing a remarkable increase in a-Young cells accompanied by a dramatic reduction in the number of e-Sen and l-Sen cells (Fig. 7c, d and Supplementary Fig. 11c–i). The Bcl11b activity score and metabolic pathways were clearly restored after TPCA-1 treatment, while aging-related pathways, including the senescence, NF-kB, Jak-Stat, MAPK and PI3K-Akt pathways, were all significantly suppressed (Fig. 7e–h; Supplementary Data 6). This molecular profile is very similar to that of the 2 month-old mammary glands, suggesting that TPCA-1 can change the senescence profile of mammary gland cells under physiological conditions. In contrast, this rejuvenation effect cannot be achieved by NF-kB inhibition alone (Supplementary Fig. 13). To test whether TPCA-1’s rejuvenation effect is dependent on Bcl11b expression, we performed TPCA-1 treatment on 3 month-old Bcl11b KO mice continuously for 1 month, we found that the ageing phenotype of Bcl11b KO mammary cells on the pseudotime can be efficiently rescued by TPCA-1 treatment (Supplementary Fig. 12). The l-Sen cells of TPCA-1 treated mice were significantly reduced compared with Bcl11b KO cells, and the SASP pathway, NF-kB signaling pathway, JAK-STAT signaling pathway were all efficiently suppressed. This suggests that when Bcl11b’s downstream target signaling pathways were inhibited, it can play a similar role as the Bcl11b expression and block the accelerated ageing progression.
To determine whether TPCA-1 induced younger mammary gland can efficiently reduce cancer incidence, we performed 7 weeks of intraperitoneal administration of TPCA-1 after medroxyprogesterone acetate (MPA)- and DMBA-treatment, and tracked the rate of cancer incidence (Fig. 7i). We found that TPCA-1 treatment successfully and efficiently decreased the tumor burden and significantly increased tumor-free mouse survival (Fig. 7j, k, p < 0.05). These data demonstrate that mammary cancer formation can be controlled with a strategy that reshape the aging tissue transcriptome to that of tissue in the juvenile state to reduce cancer susceptibility.
Discussion
The global aging trend has become increasingly common worldwide, with an anticipated increase in cancer burden. The biological relationship between aging and cancer has been a critical issue to clarify to guide prophylactic measures. Our chronological single-cell transcriptome analysis of the mammary gland enabled us to reconstruct a molecular portrait of the physiological aging process, which revealed heterogeneous senescent cell states and progressive aging processes intrinsic to epithelial cells. This molecular map bridges cellular senescence and cancer initiation and answers the long-standing question, why do aging cells with degenerative activities paradoxically foster cancer formation? Our study implies that the senescent state is a heterogeneous, dynamic and entropic cell state with functional deterioration, accompanied by cell cycle arrest at early stage and activated stem cell/cancer programs at later stage. The paradox can be explained by a progressive ageing model that senescence and cancer are successive biological steps in the same linear developmental trajectory, not bifurcating biological processes (Fig. 7l). This understanding can help us design innovative strategies to block aging and cancer at various intersections.
Our study led us to rethink the prevailing mutation accumulation model for explaining the aging–cancer relationship77. In the last century, Carl Nordling proposed the theoretical framework that carcinogenesis is driven by mutation of the genome78. This seminal concept was first developed into a multistage model for malignancy transformation79. However, this theory does not explain why a substantial portion of mutations occur early in life, while cancers arise exponentially later in life80,81. Neither does it explain the disproportion between cancer frequency and animal body size, as well as the scaling of cancer incidence to animal lifespan82. These facts implicate that there might be more factors beyond genetic mutations involved in determination of cancer initiation77. In this study, we clearly observed transcriptome alterations during aging, and these were biologically correlated with cancer initiation, and we identified a master fate determinant, Bcl11b, which is involved in epigenetic regulation83 in aging and cancer. In addition, we demonstrated that after mutation, modulation of epigenetic reprogramming with chemical inhibitors targeting NF-kB and Jak-stat efficiently reduced cancer formation. This outcome suggests that although mutation is essential and may be indispensable for triggering cancer formation, epigenetic programs might be equally crucial to cancer development and may be more manageable. Therefore, modulating epigenetic modifications may be a better and more feasible way than genetic intervention to control cancer incidence at the population level. We envision that a comprehensive molecular understanding of epigenetic regulation in aging may help us find diverse and promising targets to eventually reduce cancer occurrence.
Previous single cell analyses on ageing reported that ageing program is tissue and cell type dependent33,34,35, which argues against the point that the Bcl11b is a universal ageing regulator in various tissues. However, data mining of TCGA database suggests, across various tissues/tumors, Bcl11b’s activity (indicated by its ChIP-seq targets) is frequently reduced in tumors compared with normal tissues (Supplementary Fig. 14). Consistent with this data, the related senescence pathways, oncogenic factors and pathways are also elevated in tumors compared with normal tissues. Although Bcl11b may not be a global ageing gene, we think Bcl11b’s downstream pathways might be conserved in the ageing process across various tissues.
We normally regard ‘senescence’ as a certain static cellular state associated with cell cycle arrest. However, increasing evidence suggest that the senescent cell cycle arrest may not be terminal, in certain conditions, senescence cells can reenter cell cycle7,30,84; in addition, senescent features are heterogeneous including aberrant epigenetics, abnormal secretome, functional decline etc. Cell-cycle arrest is one of the features, but not the only feature. Senescence is also a dynamic process showing different features at different stages, which has been reviewed85. According to our data, cell cycle arrest is a feature of early senescent cells, at later senescence stage, these cells acquire ability to reenter cell cycle.
While our study successfully identified senescence heterogeneity using single-cell transcriptomic analysis, it is important to acknowledge its limitations. Future experiments that experimentally separate senescent cells with distinct cell fates and observe their behavior under physiological conditions would provide valuable insights. Additionally, our investigation focused on a specific cell population in the mammary gland during the longitudinal aging process, and we established molecular connections between aging and cancer using a DMBA treatment-based cancer initiation model. It would be intriguing and promising to explore whether the aging dynamics we discovered extend to other mammary populations or even other organs in diverse cancer models. This avenue of research holds great potential for further understanding the broader implications of aging in cancer development.
Methods
Mice and in vivo models
Animals were housed in a specific pathogen-free conditions and fed standard mouse chow. All animal experiments were carried out in compliance with China laws and regulations. The local institutional animal ethics board (Institutional Animal Care and Use Committee of Westlake University) approved all mouse experiments (permission numbers: 19-001-2-CS). Experiments were performed in accordance with government and institutional guidelines and regulations. All mice are housed at 20–24 °C with 40–60% humidity, and 12 h cycle of light/darkness (7 a.m. – 7 p.m.).
The Bcl11bflox/flox mice (C57BL/6 background) were generously provided by Mark Leid’s lab and the B6N.Cg-Tg (KRT14-cre)1Amc/J (stock number 018964) were purchased from Jackson Laboratory. mTmG mice (B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J, 007676) were purchased from The Jackson Laboratory (The Jackson Laboratory, Bar Harbor, Maine, USA). Female C57BL/6 mice, 2–6 months old were purchased from Jackson Laboratory, and were maintained till 29 months.
Tissue processing and flow cytometry
Mammary glands were collected from 2nd, 3rd, 4th pair of mammary glands of C57/BL6 mice, and were dissected and processed according to the published protocol86 with minor revision. Mammary glands were minced into 1 mm3 size using a tissue cutting blade and digested with 0.5 mg/mL Collagenase type III (Worthington, LS004182) and 50 U/mL hyaluronidase (Worthington, LS002592) for 2 h with gentle pipetting every 30 min. Digested mammary homogenate was collected and treated with ACK lysing buffer for 5 min on ice, then was digested using 0.25% Trypsin-EDTA (GIBCO) for 5 min, followed by DNase I (Worthington, LS002139) digestion. After filtered by 70 μm strainer, the dissociated mammary cells were stained with CD45 (560501, BD, 1:200), CD31 (562939, BD, 1:200), Ter119 (560504, BD, 1:200), EpCAM (118220, BioLegend, 1:200), CD49f (313606, BioLegend, 1:200) for 20 min on ice. Cells were washed and resuspended in HBSS + 2% FBS + 1% PSA + DAPI (1 μg/mL), then were sorted using FACS Aria II (BD Bioscience). FACS data was analyzed by FlowJo (V10).
Transplantation
For transplantation assay of young and aged mammary gland, 3 month-old and 18 month-old WT C57BL/6 mice were lineage depleted using Mammary Epithelium Enrichment Kit (Stem Cell Technologies) and resuspended in injection media (HBSS + 2% FBS + 1% PSA + 50% Matrigel) to 50 k/5 μL, and serially diluted to 20 k/5 μL, 5 k/5 μL and 2 k/5 μL. Cells were subjected to limiting dilution transplant to the cleared fat pad of 3 week-old recipient mice (C57BL/6). Briefly, the recipient mice were anesthetized with pentobarbital sodium at a dose of 70 mg/kg. The inguinal rudimentary tree was removed and 5 μL of cell suspension was injected onto the residual fat pad using 25 μL Hamilton Syringe. 7 weeks later, the recipient mice were analyzed using mammary gland whole mount carmine staining. The MRU frequency and confidence interval were determined by ELDA.
For transplantation of Bcl11b knockout cells, mammary cells from 4 month-old wild-type and Krt14-cre Bcl11bflox/flox mice were resuspended in injection media (HBSS + 2% FBS + 1% PSA + 50% Matrigel) to 200 k/5 μL. Cells were injected into the cleared fat pad of 3 week-old recipient mice (C57BL/6). 7 weeks later, the recipient mice were subsequently mated with WT male mice for 3 rounds. Mammary Tissues were collected at designated time points and subjected to whole mount analysis.
For transplant assay of IKKb overexpression cells, CD49fhighEpCAMlowLin- cells from 2 month-old C57BL/6 WT mice were sorted using FACS and resuspended in culture media (DMEM/F12 + 2% FBS + 1% PSA + 2% B27) supplemented with EGF (10 ng/ mL, BD Bioscience), Rspo1(250 ng/mL, R&D), ROCK inhibitor Y27632 (10 uM, Sigma) to 100 k/200 μL/well in 96-well non-adherent culture plate (Corning). Cells were transduced with lentivirus-pCDH or lentivirus-pCDH-IKKb at MOI 20 overnight. The next day, cells were seeded on top of the Matrigel to do the colony culture. One week later, colonies were digested using DispaseII 1 mg/mL (Sigma, D4693) for 1 h followed by treatment of 400 μL TrypLE™ Select (GIBCO)/eppendorf tube at 37 °C for 5 min. Dissociated cells were neutralized with HBSS + 2% FBS + 1% PSA and stained with DAPI. GFP+ cells were sorted and then resuspended with injection media (HBSS + 2% FBS + 1% PSA + 50% Matrigel) to 2.5k/5 μL, and serially diluted to 500 cells/5 μL, 100 cells/5 μL and 50 cells/5 μL. Cells were subjected to limiting dilution transplant to recipient mice. Mice were maintained in aseptic sterile condition for 7 weeks before whole mount analysis. For secondary transplant, mammary fat pad at 2.5 k/5 μL dilution, which exclusively gave rise to full tree, were collected and digested to single cell suspension. Cells from one fat pad of 2.5k/5 μL dilution group were divided equally to six parts and transplanted to 6 cleared fat pad of recipient mice, respectively. Mice were maintained for 7 weeks before whole mount analysis. The mammary gland area percentage was determined by the outgrowth area divided by cleared fat pad area. The area was measured by Image J software.
Colony formation assay
For colony formation assay, 35 μL/well growth factor reduced Matrigel (Corning, 356231) was overlaid on the 96-well plate and solidified at 37 °C for 10 min. CD49fhighEpCAMlowLin- cells were collected from FACS and cultured in 200 μL culture media (DMEM/F12 + 2% FBS + 1% PSA + 2% B27) supplemented with 10 ng/ mL EGF (BD Bioscience), 250 ng/ mL Rspo1(R&D), 10 μM ROCK inhibitor Y27632 (Sigma), and then were plated on top of the Matrigel. Cells were cultured at 37 °C incubator with 5% CO2 for 7 days.
For colony formation ability test of aging CD49fhighEpCAMlowLin- cells, CD49fhighEpCAMlowLin- cells were sorted from 2–4 months, 12-13 months and 22–29 months mice, seeded on Matrigel in 96-well plates, 3000 cells per well, three replicates for each mouse sample. Colony number was counted after 7 days culture.
For colony formation assay of IKKb overexpression cells, mammary CD49fhighEpCAMlowLin- cells were sorted from 2–4 months WT or K14-Cre Bcl11bfl/fl mice and transduced with pCDH and pCDH-IKKb virus for 7 days. 9000 GFP positive cells were sorted and seeded to 3000 cells/200 μL/well equally in three wells in the culture medium. Colony number was counted after 7 days culture. Each group was repeated with three biological replicates.
Mammary gland whole mount carmine staining
Mammary gland was dissected and fixed in Carnoy’s solution (60% Ethanol, 30% CHCl3,10% Acetic Acid) for 4hrs, washed with 70% ethanol and ddH2O, and then stained with carmin-alum staining solution (0.2% wt/vol carmine (Sigma, C1022), 0.5% wt/vol aluminum potassium sulfate (Sigma, A7176) and 0.01% wt/vol thymol in ddH2O) overnight. Tissue was dehydrated through 75%, 95% and 100% ethanol, and then placed in xylene to remove the fat tissue. For long-term preservation, tissue was mounted by Permount® (Fisher Scientific). Images were obtained using a stereomicroscope (Nikon, SMZ18).
β-Galactosidase staining
Mammary gland was dissected and immediately fixed by 2% formalin containing 0.25% glutaraldehyde for 1.5 h followed by 30% sucrose infiltration overnight, and then was embedded in O.C.T. compound (Tissue-Tek) and frozen at −80 °C. Frozen tissue was sectioned to 14 μm using Cryostat Leica CM3050 S (LEICA). Frozen sections were hydrated with PBS for 10 min at RT and stained using Senescence β-Galactosidase staining kit according to manufacturer’s instructions (Cell signaling technology, 9860). The sections were incubated at 37 °C in a dry incubator (no CO2) for 48 h and photographed.
Western blot
Comma D beta cell line87 was kindly provided by Dr. Medina, and was described previously. Comma D beta cell line was cultured in DMEM-F12 (Invitrogen) supplemented with 2% of Fetal Bovine Serum (Hyclone), 1% PSA (Invitrogen), 10 ng/mL EGF(BD) and 5 μg/mL Insulin (Sigma), at 37 °C with 5% CO2. Comma D beta cells were harvested and lysed using 2X Laemmli SDS sample buffer (100 mM Tris pH6.8, 10% glycerol, 4% SDS, 0.01% Bromophenol Blue), and boiled on heat block at 100°C for 15 min. Samples were loaded to 4%–20% precast gradient gel (Bio-Rad) and electrophoresed at 200 v for 45 min, and transferred to Odyssey® nitrocellulose membrane (LI-COR). After being blocked by PBS + 0.1% tween 20 + 5% Non-fat dry milk for 1 h at RT, the membrane was subjected to primary antibody staining beta Actin (Santa Cruz), Rat anti-Bcl11b (abcam, ab18465, 1:1000), Rb anti-IKKβ (Cell signaling technology, 2370, 1:1000), Rb anti-p-IKKα/β (Cell signaling technology, 2697, 1:1000), Rb anti-p-p65 (Cell signaling technology, 3033, 1:1000), Rb anti-p65 (Cell signaling technology, 8242, 1:1000), Mouse anti-IκBα (Cell signaling technology, 9247, 1:1000) at 4 °C overnight. Membrane was washed using PBST (PBS + 0.1% Tween 20) 3 × 10 min, and stained with secondary antibodies HRP-Donkey anti mouse (Cell signaling technology, 7076 S, 1:10000), HRP-Donkey anti rat (Cell signaling technology, 7077 S, 1:1000) or rabbit (Cell signaling technology, 7074 S, 1:1000) at RT for 1 hr. Membrane was subsequently washed 3 × 10 min by PBST and developed using SuperSignal® West Dura Extended Duration Substrate (Thermo Scientific, 34094) and imaged by Gel imaging system (GE, AI680RGB).
RNA extraction and Real-Time PCR
For the TNFα and LPS treatment assay, after starvation for 12 h, pInducer-Bcl11b Comma D beta cells were treated with 50 ng/mL doxycycline for 12 h to induce Bcl11b expression. Cells were then treated 20 ng/mL TNFα or 103 EU/mL LPS-EB for 10 h before lysed by 400 μL Trizol (Life Technologies),. RNA was extracted according to the manufacturer’s instruction with addition of ultrapure glycogen (Thermo Scientific, R0551) as carrier. RNA was reverse transcribed to cDNA using PrimeScriptTM RT reagent kit (TaKaRa, RR037A) according to the manufacturer’s instructions. cDNA was then subjected to the real time PCR for specific gene target by TB Green Premix Ex Taq (TaKaRa, RR420B) according to manufacturer’s instructions using Real Time PCR system (SIS-PCR005, Jena).
For the drug screening assay, Comma D beta cells were treated with Rapamycin (0.1 μM, 1 μM, 10 μM, Selleck, S1039), Dactolisib (0.1 μM, 1 μM, 10 μM, Selleck, S1009), LY2409881 (0.1 μM, 1 μM, 10 μM, Selleck, S7697), BMS-345541 (0.01 μM, 0.1 μM, 1 μM, Selleck, S8044), QNZ (0.01 μM, 0.1 μM, 1 μM, Selleck, S4902), Asprin (1 μM, 10 μM, 100 μM, Selleck, S3017), C188-9 (0.1 μM, 1 μM, 5 μM, Selleck, S8605), SH-4-54 (0.01 μM, 0.1 μM, 1 μM, Selleck, S7337), TPCA-1 (1 μM, 5 μM, 25 μM, Selleck, 2824), Scutellarin (1 μM, 5 μM, 25 μM, Selleck, S3810), IWR-1-endo (0.1 μM, 1 μM, 5 μM, Selleck, S7086), LY411575 (0.1 μM, 1 μM, 10 μM, Selleck, S2714), Vismodegib (0.1 μM, 1 μM, 5 μM, Selleck, S1082) and Sonidegib (0.1 μM, 1 μM, 10 μM, Selleck, S2151) for 24 h. For primary mammary cell validation experiment, CD49fhighEpCAMlowLin- cells from 4 month-old, 14 month-old, 24 month-old WT mice and 4 month-old K14-Cre Bcl11bfl/fl mice were sorted into the 96-well Ultra-Low attachment culture plate (Corning, 3474) (10,000 cells/200 μL/well) and cultured in the culture media (DMEM/F12 + 2% FBS + 1% PSA + 2% B27 + 10 ng/mL EGF + 250 ng/ mL Rspo1 + 10 μM Y27632) with 25 μM TPCA-1 or DMSO for 24 h. DAPI negative cells were then sorted to perform RT-PCR assay.
Data was analyzed by Excel and GraphPad Prism 7.00. The relative gene expression was normalized by β-actin expression. Target gene Sybrgreen primers were designed by IDT (Integrated DNA Technologies) and the primers are listed below: Bcl11b (Exon1-2): Forward ATGCCAGAATAGATGCCGG, Reverse CTCTATCTCCAGACCCTCGTC; Bcl11b (Exon2-4): Forward AGGAGAGTATCTGAGCCAGTG, Reverse GTTGTGCAAATGTAGCTGGAAG; Irak2: Forward TGTCACCTGGAACTCTACCG, Reverse TTTCTCCTGTTCATCCTTGAGG; Tnfrsf1b: Forward ACTCCAAGCATCCTTACATCG, Reverse TTCACCAGTCCTAACATCAGC; β-actin: Forward ACCTTCTACAATGAGCTGCG, Reverse CTGGATGGCTACGTACATGG.
Luciferase assay
Comma D beta cell line which was stably expressed pInducer Bcl11b plasmid and NFκB-inducible Luciferase reporter plasmid was used for this experiment. After starvation for 12 h, cells were treated with Doxycycline (Sigma, D9891) at various doses followed by 20 ng/mL TNFα (Biolegend, 575204), 1 μg/mL LPS-PG (Invivogen, tlrl-ppglps), 103 EU/mL LPS-EB (Invivogen, tlrl-3pelps), and 100 ng/mL PMA (InvivoGen, tlrl-pma) treatment, as indicated. Cells were washed with 1 × PBS and lysed with PLB according to the manufacturer’s instruction for 15 min (Promega, E1910). Cells were transferred to a 96-well plate, 20 μL/well. After added with 100 μL/well LAR II, the sample was measured by the luciferase activity using the microplate reader (Thermo, Varioskan LUX).
Immunofluorescence
For frozen section, mammary gland was dissected and immediately fixed using 4% formalin for 2 hrs followed by PBS washing and 30% sucrose infiltration overnight. The fixed mammary tissue was then embedded in O.C.T. compound (Tissue-Tek) and frozen at −80 °C. Frozen tissue block was sectioned to 14 μm at −35 °C using Cryostat Leica CM3050 S (LEICA). For immunofluorescence assay, frozen sections were rehydrated with PBS for 10 min at RT. Sections were blocked with TBS + 0.1% Triton X-100 + 2% BSA + 10% Donkey serum for 1 hr at RT, and then stained with primary antibody mouse anti-p16Ink4a (Santa Cruz, sc-1661), Rb anti-p65 (Cell signaling technology, 8242), Rat anti-Bcl11b (Abcam, ab18465) 1:200 overnight at 4 °C. After washed by TBST (TBS + 0.1%Triton X-100) three times, sections were stained with secondary antibody Donkey anti-mouse, rat, rabbit 1:200 (Jackson ImmunoResearch) for 1 hr at RT. After 3 × TBST washing and brief 1 μg/mL DAPI staining, sections were mounted with Antifade Mounting Medium (Beyotime).
Immunohistochemistry and HE staining
Mammary tissue was collected and immediately fixed using 4% formalin overnight at 4 °C and dehydrated by gradient ethanol solution (70%, 85%, 95%, 100%). Dehydrated tissue was infiltrated by Xylene solution and embedded with paraffin. Tissue block was sectioned to 5 μm using Rotary Microtome Leica RM2255 (LEICA). Paraffin section was de-paraffinized using Xylene and rehydrated followed by gradient ethanol solution (100%, 95%, 85%, 70%, 0%) and subjected to immunohistochemistry staining according to the Histostain-Plus IHC Kit (NeoBioscience, ENS003.120, ENS004.300). Antigen was retrieved in citrate buffer (10 mM Sodium Citrate, 0.05% Tween 20, pH 6.0) for 20 min at 100 °C in microwave. The sections were treated with 3% H2O2 for 10 min, washed and blocked for 1 h, sections were incubated with Rb anti-p-p65 (Abcam, ab131100, 1:50), Rb anti-Il-6 (NOVUS, NB600-1131, 1:100), Mouse anti-Ssea1 (Abcam, ab16258, 1:200) and Rb anti-Oct4 (Abcam, ab19857, 1:200) overnight at 4 °C. Then sections were washed using TBST, secondary antibody incubation, HPR incubation, DAB incubation, Hematoxylin dyeing, gradient dehydration and mounted by CV5030 CoverSlipper (LEICA). Images were obtained using Eclipse Ti2 inverted microscope (Nikon).
For the HE staining assay, after de-paraffinize and rehydration, paraffin section was stained using ST5020 muti-stainer (LEICA) and mounted by CV5030 CoverSlipper (LEICA).
ChIP-seq
8 × 107 pInducer Bcl11b Comma D beta cells were treated with 100 ng/mL Doxycycline overnight and harvested. Rabbit anti-IgG (Abcam, ab172730) and rabbit anti-Bcl11b (Benthyl laboratories.inc, A300-384A) were used for ChIP-seq pull-down. Briefly, after cross-linked by 1% (wt/vol) formaldehyde solution, cells were quenched by glycine (0.12 M), washed one time with PBS and resuspended in PBS. Cells were lysed using SDS lysis buffer (50 mM Tris-HCl 8.0, 5 mM EDTA 8.0, 0.1%SDS and 1 × protease/phosphatase Inhibitor Cocktail (CST, 5872 S)). Then chromatins were sheared with AFA Focused-ultrasonicator using Covaris ME220 with 70 peak power, 20% duty factor, 14 average power for 3 min at 1 × 107 cells/tube. Add 9 × ChIP dilution buffer (50 mM Tris-HCl 8.0, 167 mM NaCl, 0.11% Triton X-100, 0.11% Sodium Deoxycholate and 1 × protease/phosphatase Inhibitor Cocktail) to the sonicated chromatin. 10% of the slurry was taken as input and 90% sonicated chromatin were divided equally to two parts. The sonicated chromatin was incubated in the cold room overnight with 50 μL protein G-Dynabeads (Invitrogen,10004D) which had been conjugated with 50 μg appropriate IgG or Bcl11b antibody. Beads were then washed with RIPA buffer 1(50 mM Tris-HCl 8.0, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% Sodium Deoxycholate and 1 × protease/phosphatase Inhibitor Cocktail), RIPA buffer 2 (50 mM Tris-HCl 8.0, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% Sodium Deoxycholate and 1 × rotease/phosphatase Inhibitor Cocktail), LiCl buffer (100 mM Tris-HCl 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% NP-40, 0.5% Sodium Deoxycholate and 1× protease/phosphatase Inhibitor Cocktail) and TE buffer (10 mM Tris-HCl 8.0, 1 mM EDTA), and were eluted into 200uL of ChIP direct elution buffer (10 mM Tris-HCl 8.0, 300 mM NaCl, 5 mM EDTA, 0.5% SDS, 0.2% Sodium Deoxycholate). Samples were reverse cross-linked at 65 °C overnight, treated with 4uL RNase A (1 mg/mL) at 37 °C for 30 min, incubated with 1 uL proteinase K (10 mg/mL) at 55 °C for 1 h, and extracted by phenol/chloroform. ChIP DNA library was constructed by VAHTS Universal DNA Library Prep Kit for Illumina V2 (Vazyme, ND606). Briefly, samples were subjected to adapter ligation, ChIP DNA was then amplified 12 cycles and purified using AMpure XP beads (Beckman, A63881) twice and then were submitted for150 bp paired-end sequencing on an Illumina novaseq 6000 platform (Novogene).
Single cell RNAseq library preparation and sequencing
A modified Smart-seq2 protocol was applied for single-cell RNA-seq45,46 according to previously reported protocol. Briefly, single CD49fhighEpCAMlowLin- cell from various age (2,4,9,11,13,15,17,19,22,24, 29 months old) mice or DMBA tumors were directly sorted into 96-well plate containing lysis buffer (0.05 uL RNase Inhibitor (40 U/μL), 0.095 uL 10% Triton X-100, 0.5 uL dNTP (10 mM), 0.1 uL ERCC (3 × 105) and 0.555 uL Nuclease-free water) using FACS. Single cell was immediately lysed at 70 °C for 3 min in the PCR system (TAdvanced 96SG, analytikjena). The sample was reverse transcribed to cDNA using SuperScriptIIreverse transcriptase (invitrogen, 18064-071) with a template switch oligo (TSO) primer and a sample-specific 25 nt oligo dT reverse transcription primer (TCAGACGTGTGCTCTTCCGATCTXXXXXXXX-NNNNNNNN-T25, X representing sample-specific barcode and N representing unique molecular identifier (UMI)). Then the cDNA was amplified by 18 cycles of PCR with 3’P2 primer and IS primer using KAPA HiFi HotStart Ready Mix (Kapa Biosystem, KK2602). After being pooled together and purified by AMpure XP beads (Beckman, A63881) twice, the barcoded DNAs were amplified using biotinylated pre-index primers by 4 cycles of PCR to introduce biotin tags to the 3′ ends of the amplified cDNAs. After purified by AMpure XP beads, cDNA was sonicated to ~300 bp fragments using Covaris ME220. 3’ terminal of the cDNA was enriched using Dynabeads® MyOne Streptavidin C1 beads (Invitrogen, 65001). The RNAseq libraries were constructed using the Kapa Hyper Prep Kit (Kapa Biosystem, KK8504) according to the manufacturer’s instructions. Briefly, after end repair and A-tailing, Streptavidin conjugated DNA was ligated to the appropriate concentration adapter (1:10) (NEB, 7335 L). Then, after USER enzyme treatment and post-ligation cleanup, DNA was amplified with QP2 primer and short universal primer by 6 cycles of PCR and released from the streptavidin beads. Finally, AMpure XP beads were used to purify the DNA and DNA library quality was verified by Fragment Analyzer-12/96 (AATI) and then the DNA library was submitted to 150 bp paired-end sequencing on an Illumina NovaSeq 6000 platform (Novogene).
In vivo ageing clock rescue assay
To test TPCA-1’s (GW683965) (Selleck, S2824)75,76 effect on mammary ageing, 12 month-old virgin female WT mice or 3 month-old K14-cre Bcl11bfl/fl mice were treated by 10 mg/kg TPCA-1 or 4% DMSO in PBS intraperitoneally every day for 30 days. Mammary cells were then dissociated and harvested for single cell RNAseq and pseudotime analysis.
To test BMS-345541 (Selleck, S8044)88 effect on mammary ageing, 3 month-old K14-cre Bcl11bfl/fl mice were gavaged with 35 mg/kg BMS-345541 or 4% DMSO in PBS. Mammary cells were then dissociated and harvested for single cell RNAseq.
DMBA induced tumor formation
Mouse mammary tumors induced by MPA and DMBA assay were performed according to the previous published paper55,56 with minor modifications. Briefly, the cleared fat pad of 3 week-old female mice (C57BL/6) were transplanted with WT or K14-cre Bcl11bfl/fl cells according to the transplantation assay methods described above in the Transplantation session. The recipient mice were implanted subcutaneously with a 50 mg 90 day-release MPA pellet (Innovative Research of America, NP-161-50 mg). Three weeks later, DMBA (200 μL, 5 mg/mL) (Sigma-Aldrich, D3254-1G) was administered by oral gavage 4 times throughout the following 5 weeks at -4, -3, -1, 0 weeks. Tumors were determined by manual palpation. Cancer incidence was calculated by the number of tumor cases within a designated latency period. The latency time was calculated from the last DMBA treatment day. Mice were euthanized before the tumor size reaching 2 cm in diameter according to our animal protocol 19-001-2-CS approved by IACUC (Institutional Animal Care and Use Committee of Westlake University).
To test TPCA-1’s effect on DMBA induced tumor formation, female mice induced by MPA and DMBA, then followed by treatments with 10 mg/kg TPCA-1 or 4% DMSO in PBS intraperitoneally every day for 7 weeks. Tumors were determined by manual palpation. Cancer incidence was calculated by the number of tumor cases within a designated latency period. The latency time was calculated starting from the last DMBA treatment day.
To test the vulnerability of ageing mammary cells to cancer, we transplanted 3 month old young mixed with old mammary cells to syngeneic recipient mice. Briefly, to avoid the influence of the environmental stromal cells, we transplanted 2 month old young mammary cells (wt) with 24 month old mammary cells (with GFP reporter) to syngeneic recipient mice (n = 11) at equal MRUs and induced cancer formation by DMBA treatment. We repeat this experiment with 2 month old young mammary cells (with tdTomato reporter) and 12 month old mammary cells (wt). The recipient mice number is 22.
To test whether basal cells could be the origin of DMBA induced cancer using Krt14rtTA-TetOcre-mTmG mice (n = 33). We first labeled basal cells with doxycycline induction, and then treat mice with DMBA.
Single cell RNA-seq analysis
Raw reads were first processed using TrimGalore (Ver.0.6.7) (https://github.com/FelixKrueger/TrimGalore) to remove adapter sequences with paired end mode and default parameter. Quality control was evaluated with FastQC (Ver.0.11.9) (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). For each sequencing batch, the top 100 barcode ranked by read counts were retained using whitelist tool in UMI-tools (Ver.1.1.1)89. Then barcode and UMI information were extracted from read2 using extract tool in UMI-tools and added to read1. Subsequently, read1 were aligned to the mm10 genome using STAR aligner with default parameter except for the outFilterMultimapNmax = 1. Mapped reads were assigned to genes using featureCounts89. Finally, we used count tools in UMI-tools to generate count matrix, which the number of UMIs represents the transcript number of each gene within each individual cell.
After getting the count matrix, we applied four criterions to further exclude cells with low data quality: first, cells with barcode not included in the barcode sequence list were removed; second, cells with ERCC percentage larger than 10% or mitochondria percentage larger than 5% were filtered out; third, cells with gene number less than 200 or more than 6000 were removed; lastly, cells with stromal gene (Pecam1, Ptprc, Lyve1, Col1a1) expression level higher than 0.1 were removed. As for gene, we removed those detected in less than 10 cells. Finally, for young and aged single cell RNA-seq assay, 1981 cells passed the quality control. The same filtering criterion was used for K14-Cre Bcl11bfl/fl, tumor and TPCA-1 treatment single cell RNA-seq assay. 149 K14-Cre Bcl11bfl/fl CD49fhighEpCAMlowLin-cells, 310 CD49fhighEpCAMlowLin- tumor cells, 373 DMSO treated and 367 TPCA-1 treated CD49fhighEpCAMlowLin- cells were used for analysis.
We used the Seurat (Ver 4.2.0)90 to carry out the abovementioned filtering, data normalization, and all downstream analysis including dimensionality reduction, clustering, tSNE plot overlaying, and differential gene expression. More specifically, UMI counts in each cell were normalized with NormalizeData function with default parameter and vars.to.regress parameter was used to regress out the cell cycle, ERCC percentage, mitochondria percentage, batch and gene number effect. For dimension reduction, RunPCA function was used and the top 10 principal components were passed to tSNE analysis by RunTSNE function. Finally, clustering was performed by FindNeighbors and FindClusters functions with original Louvain algorithm and the resolution was set to 1.
Single cell trajectory analysis
Single cell trajectory was inferred by Monocle2 (Ver 2.24.1)91. Count matrix was input to Monocle2 and negative binomial distribution was used for building statistical distribution for read counts with lower detection limit set as 0.5. PhenoData was exported from Seurat object. Dimension reduction was done with DDRTree and the effect of Size_Factor, num_genes_expressed, ERCC percentage, mitochondria percentage, cell cycle and batcheffect were regressed out. The root of the pseudo-time trajectory was selected as the most abundant cell state in the cells from the 2 month-old batch. Genes significantly changed along pseudo-time were selected using differentialGeneTest function with qval < 0.05, resulting in 1932 differentially expressed genes. A new count matrix was generated from the original to include only differentially expressed genes. The count matrix was then smoothed using genSmoothCurves function, log transformed using a base of 10 and pseudo-count of 1 to prevent logarithm of zero value. All elements in the transformed count matrix were further truncated by a straightforward way that all elements larger than 3 or smaller than -3 were set as 3 or -3 respectively. Gene hierarchical clustering was performed on the transformed matrix with Heatmap in ComplexHeatmap package92. Genes were clustered into 4 clusters according to gene expression in cells along with pseudo-time increasing. Based on intersecting point of the average expression of genes in each cluster, cells were separated into 4 states. The same pipeline for combined aging & Bcl11b ko data and aging & TPCA-1 treatment data.
Pathway enrichment analysis
All gene symbols were mapped to their Entrez gene ids using biomaRt93,94. Then, both GO and KEGG pathway enrichment analysis were performed by clusterProfiler95. For simplicity, only biological process (BP) terms in GO were used for enrichment analysis. To do GSEA analysis, genes ordered according to decreased foldchange were fed to GSEA function. To do GSEA enrichment of Bcl11b-KO vs WT tumor CD49fhighEpCAMlowLin- cells on 4 state marker genes, marker genes of each state were considered as one pathway. For enriched results from enrichGO, enrichKEGG or GSEA, only pathways with BH-adjusted p-value <0.05 were retained. Pathway activity of each cell was got with AddmoduleScore function in Seurat package90. When showing pathway activity along with pseudotime, the activity was also smoothed with genSmoothCurves function in monocle package91.
Cell cycle state determination
We re-implemented the method previously used in Kowalczyk et al.49 to determine the cell cycle state for each cell. First, filtered count matrix after Seurat was transferred into TPM using calculateTPM function in scater package96 and then log-transformed by log2(TPM + 1). The cycle gene list in human was taken from the previously published paper by Whitfield97. All human gene symbols were transformed to mouse using biomaRt package93,94. Genes were filtered by the correlation with the average gene expression of corresponding cell cycle stage. To retain mammary gland specific cell cycle genes, the correlation threshold was set to 0.25. Finally, we got 14, 13, 21, 19, 13 genes for G1/S, G2, G2/M, M/G1 and S phase, respectively. The average cell cycle gene expression of each stage was calculated. We identified cells with G1/S score < 0 & G2/M < 0 as G0 cells. Other cells were defined as the corresponding stage according to gene maximum expression.
SASP gene score calculation
The SASP gene list in human was taken from the previously published paper by Coppe et al.11. All human gene symbols were mapped to mouse symbols by biomaRt package93,94. Then, the SASP score for each cell were calculated using AddModuleScore function in Seurat package90.
Pathway score and transcription factor activity score calculation in human BRCA
BRCA fpkm data was downloaded with TCGAbiolinks98, in which we only used the paired samples, then pathway score was calculated as mean expression of pathway genes. The result was shown with ggplot2 (https://ggplot2.tidyverse.org). Statistical analysis was performed using two-tailed paired t-tests. To calculate transcription factor activity, we used the transcription factor target genes from Transcription Factor Target Gene Database99.
scEntropy analysis
We compute single cell entropy according to the public paper58,100. Briefly, single cell count expression profile from R was exported as.mat format which can be loaded into MATLAB. For calculating the entropy of cells from different ages, we constructed the gene co-expression network and apply it to Bcl11b ko cells. After computing the entropy of each cell, we visualize these results in R with ggplot2.
Transcription factor activity analysis
We got transcription factor target genes from the following three public databases: ENCODE101, ChEA102, and TRRUST v2103. For each cluster of genes changing along with pseudo-time, TFs were enriched with hypergeometric test which was implemented with phyper function in R. Transcription factor activity was calculated with transcription factor target genes from the combined databases using AddModuleScore function in Seurat package90. To calculate Bcl11b activity score, we did ChIP-seq assay for Bcl11b to find Bcl11b target genes. Based on scRNA-seq of wild type CD49fhighEpCAMlowLin- cells and Bcl11b ko CD49fhighEpCAMlowLin- cells from 4 month-old mice, we got Bcl11b positively regulated genes (genes with pval<0.05, ko <wt intersect with Bcl11b targets) and negatively regulated genes (genes with pval < 0.05, ko > wt intersect with Bcl11b targets). Then Bcl11b activity was computed as weighted average expression of the negatively regulated genes.
ChIP-seq data processing
ChIP-seq reads were trimmed with TrimGalore(https://github.com/FelixKrueger/TrimGalore) with paired end mode and default parameter and QC was done with FastQC(https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Trimmed reads were aligned to the mm10 mouse genome with bowtie2 (Ver.2.4.2) (https://github.com/BenLangmead/bowtie2) with default parameter. Then, the alignment was filtered using samtools104 with the following parameter: -F 1804 -f 2 -q 30. Duplicated reads were marked with MarkDuplicates in picard-tools (http://broadinstitute.github.io/picard/) and filtered out with samtools. Finally, we found bcl11b binding sites on the genome based on input signal by MACS2 (Ver.2.2.7.1) using following parameter: -f BAMPE -g mm --keep-dup all --nomodel. Bcl11b binding sites were analyzed using ChIPseeker package105. ChIP-seq signals were visualized using Integrative Genomics Viewer (IGV) software106.
Quantification and statistical analysis
Log-rank test was used between WT and K14-Cre Bcl11bfl/fl group tumor formation kinetics by GraphPad Prism 7.00. For limiting dilution analyses, the frequency of mammary repopulating unit was calculated using ELDA software107. Statistical analyses were performed using GraphPad Prism 7.00 with unpaired or paired two-tailed Student’s t-test, as indicated in the figure legends. Bar graphs represent mean ± SD or mean ± SEM, as indicated. The box plots in Figs. 2b, e, f, 3b, l, r, 4k, l, 5i, 7e–g, and Supplementary Fig. 3a–b, 4a–c, 8e, 11d, 12b, 13b–d, 14 show the center line corresponds to the median, the lower and upper lines correspond to the first and third quartiles, and the whiskers extend to 1.5 times IQR (interquartile range), and each dot represents one cell. For Supplementary Fig. 1d-1g, stat_smooth was used to get non-linear regression with method set to loess. Pvalue was added by stat_regline_equation. For Supplemental Data 4, Supplemental Data 5, and Supplemental Data 6, pathways with p.adjust(BH-adjusted) < 0.05 were considered as significantly enriched.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
scRNA-seq and ChIP-seq data were deposited in GEO database under the accession number GSE195647. To review GEO accession GSE195647: Go to https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE195647. TCGA data is from https://www.cancer.gov/ccg/research/genome-sequencing/tcga. The datasets used to perform transcription factor enrichment analysis are from the following site: ENCODE, https://maayanlab.cloud/Harmonizome/dataset/ENCODE+Transcription+Factor+Binding+Site+Profiles; TRRUST v2, https://www.grnpedia.org/trrust; CHEA, https://maayanlab.cloud/chea3/. The mouse genome mm10(M25) was obtained from GENCODE database. Source data are provided as a Source Data file (https://doi.org/10.6084/m9.figshare.25521706). The remaining data are available within the Article, Supplementary Information or Source Data file.
Code availability
The custom code used for this paper is available on GitHub (https://github.com/Liuxiaoqin95/MaSC_aging).
References
Sung, H. et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer J. Clin. 71, 209–249 (2021).
Kocarnik, J. M. et al. Cancer incidence, mortality, years of life lost, years lived with disability, and disability-adjusted life years for 29 cancer groups from 2010 to 2019: a systematic analysis for the global burden of disease study 2019. JAMA Oncol. 8, 420–444 (2022).
DePinho, R. A. The age of cancer. Nature 408, 248–254 (2000).
Frank, S. A. In Dynamics of Cancer: Incidence, Inheritance, and Evolution 1st edn, 400, pp. 17–20 (Princeton University Press, 2007).
Siegel, R. L., Miller, K. D., Fuchs, H. E. & Jemal, A. Cancer statistics, 2021. CA: A Cancer J. Clin. 71, 7–33 (2021).
Serrano, M., Lin, A. W., McCurrach, M. E., Beach, D. & Lowe, S. W. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88, 593–602 (1997).
Beauséjour, C. M. et al. Reversal of human cellular senescence: roles of the p53 and p16 pathways. Embo J. 22, 4212–4222 (2003).
Dimri, G. P. et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl Acad. Sci. USA 92, 9363–9367 (1995).
Narita, M. et al. Rb-Mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 113, 703–716 (2003).
Zhang, W. et al. Aging stem cells. A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging. Science 348, 1160–1163 (2015).
Coppe, J. P. et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, 2853–2868 (2008).
Ma, S. et al. Caloric restriction reprograms the single-cell transcriptional landscape of Rattus norvegicus aging. Cell 180, 984–1001.e1022 (2020).
Akala, O. O. et al. Long-term haematopoietic reconstitution by Trp53-/-p16Ink4a-/-p19Arf-/- multipotent progenitors. Nature 453, 228–232 (2008).
Freund, A., Orjalo, A. V., Desprez, P. Y. & Campisi, J. Inflammatory networks during cellular senescence: causes and consequences. Trends Mol. Med. 16, 238–246 (2010).
Baar, M. P. et al. Targeted apoptosis of senescent cells restores tissue homeostasis in response to chemotoxicity and aging. Cell 169, 132–147.e116 (2017).
Adams, P. D., Jasper, H. & Rudolph, K. L. Aging-induced stem cell mutations as drivers for disease and cancer. Cell Stem Cell 16, 601–612 (2015).
Sperka, T., Wang, J. & Rudolph, K. L. DNA damage checkpoints in stem cells, ageing and cancer. Nat. Rev. Mol. Cell Biol. 13, 579–590 (2012).
Martincorena, I. & Campbell, P. J. Somatic mutation in cancer and normal cells. Science 349, 1483–1489 (2015).
Vogelstein, B. et al. Genetic alterations during colorectal-tumor development. N. Engl. J. Med. 319, 525–532 (1988).
Rozhok, A. I. & DeGregori, J. The evolution of lifespan and age-dependent cancer risk. Trends cancer 2, 552–560 (2016).
Christensen, K. et al. Cancer and longevity–is there a trade-off? a study of cooccurrence in Danish twin pairs born 1900-1918. J. Gerontol. A Biol. Sci. Med Sci. 67, 489–494 (2012).
Coppé, J. P., Desprez, P. Y., Krtolica, A. & Campisi, J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu. Rev. Pathol. 5, 99–118 (2010).
Storer, M. et al. Senescence is a developmental mechanism that contributes to embryonic growth and patterning. Cell 155, 1119–1130 (2013).
Muñoz-Espín, D. et al. Programmed cell senescence during mammalian embryonic development. Cell 155, 1104–1118 (2013).
Jun, J. I. & Lau, L. F. The matricellular protein CCN1 induces fibroblast senescence and restricts fibrosis in cutaneous wound healing. Nat. Cell Biol. 12, 676–685 (2010).
Demaria, M. et al. An essential role for senescent cells in optimal wound healing through secretion of PDGF-AA. Dev. cell 31, 722–733 (2014).
Ritschka, B. et al. The senescence-associated secretory phenotype induces cellular plasticity and tissue regeneration. Genes Dev. 31, 172–183 (2017).
Mosteiro, L. et al. Tissue damage and senescence provide critical signals for cellular reprogramming in vivo. Science 354, aaf4445 (2016).
Chiche, A. et al. Injury-induced senescence enables in vivo reprogramming in skeletal muscle. Cell Stem Cell 20, 407–414.e404 (2017).
Milanovic, M. et al. Senescence-associated reprogramming promotes cancer stemness. Nature 553, 96–100 (2018).
Tabula Muris, C. A single-cell transcriptomic atlas characterizes ageing tissues in the mouse. Nature 583, 590–595 (2020).
Li, C. M. et al. Aging-associated alterations in mammary epithelia and stroma revealed by single-cell RNA sequencing. Cell Rep. 33, 108566 (2020).
Zhang, M. J., Pisco, A. O., Darmanis, S. & Zou, J. Mouse aging cell atlas analysis reveals global and cell type-specific aging signatures. eLife 10, e62293 (2021).
Ximerakis, M. et al. Single-cell transcriptomic profiling of the aging mouse brain. Nat. Neurosci. 22, 1696–1708 (2019).
Kimmel, J. C. et al. Murine single-cell RNA-seq reveals cell-identity- and tissue-specific trajectories of aging. Genome Res. 29, 2088–2103 (2019).
Reya, T., Morrison, S. J., Clarke, M. F. & Weissman, I. L. Stem cells, cancer, and cancer stem cells. Nature 414, 105–111 (2001).
Visvader, J. E. Cells of origin in cancer. Nature 469, 314–322 (2011).
Stingl, J. et al. Purification and unique properties of mammary epithelial stem cells. Nature 439, 993–997 (2006).
Shackleton, M. et al. Generation of a functional mammary gland from a single stem cell. Nature 439, 84–88 (2006).
Fu, N. Y. et al. Identification of quiescent and spatially restricted mammary stem cells that are hormone responsive. Nat. Cell Biol. 19, 164–176 (2017).
Cai, S. et al. A quiescent Bcl11b high stem cell population is required for maintenance of the mammary gland. Cell Stem Cell 20, 247–260.e245 (2017).
Chakrabarti, R. et al. Notch ligand Dll1 mediates cross-talk between mammary stem cells and the macrophageal niche. Science 360, eaan4153 (2018).
Wang, D. et al. Identification of multipotent mammary stem cells by protein C receptor expression. Nature 517, 81–84 (2015).
Picelli, S. et al. Smart-seq2 for sensitive full-length transcriptome profiling in single cells. Nat. Methods 10, 1096–1098 (2013).
Picelli, S. et al. Full-length RNA-seq from single cells using Smart-seq2. Nat. Protoc. 9, 171–181 (2014).
Li, L. et al. Single-cell RNA-seq analysis maps development of human germline cells and gonadal niche interactions. Cell Stem Cell 20, 858–873.e854 (2017).
Lodato, M. A. et al. Aging and neurodegeneration are associated with increased mutations in single human neurons. Science 359, 555–559 (2018).
Schumacher, B., Pothof, J., Vijg, J. & Hoeijmakers, J. H. J. The central role of DNA damage in the ageing process. Nature 592, 695–703 (2021).
Kowalczyk, M. S. et al. Single-cell RNA-seq reveals changes in cell cycle and differentiation programs upon aging of hematopoietic stem cells. Genome Res. 25, 1860–1872 (2015).
Tyner, S. D. et al. p53 mutant mice that display early ageing-associated phenotypes. Nature 415, 45–53 (2002).
Adler, A. S. et al. Motif module map reveals enforcement of aging by continual NF-kappaB activity. Genes Dev. 21, 3244–3257 (2007).
Hoare, M. et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat. Cell Biol. 18, 979–992 (2016).
Schmitt, C. A. The persistent dynamic secrets of senescence. Nat. Cell Biol. 18, 913–915 (2016).
Pereira, B. et al. The somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapes. Nat. Commun. 7, 11479 (2016).
Aldaz, C. M., Liao, Q. Y., LaBate, M. & Johnston, D. A. Medroxyprogesterone acetate accelerates the development and increases the incidence of mouse mammary tumors induced by dimethylbenzanthracene. Carcinogenesis 17, 2069–2072 (1996).
Gonzalez-Suarez, E. et al. RANK ligand mediates progestin-induced mammary epithelial proliferation and carcinogenesis. Nature 468, 103–107 (2010).
Abba, M. C. et al. DMBA induced mouse mammary tumors display high incidence of activating Pik3caH1047 and loss of function Pten mutations. Oncotarget 7, 64289–64299 (2016).
Jin, S., MacLean, A. L., Peng, T. & Nie, Q. scEpath: energy landscape-based inference of transition probabilities and cellular trajectories from single-cell transcriptomic data. Bioinformatics 34, 2077–2086 (2018).
Liu, Z. et al. Large-scale chromatin reorganization reactivates placenta-specific genes that drive cellular aging. Dev. cell 57, 1347–1368.e1312 (2022).
Li, J. et al. Caenorhabditis elegans HCF-1 functions in longevity maintenance as a DAF-16 regulator. PLoS Biol. 6, e233 (2008).
Lahoute, C. et al. Premature aging in skeletal muscle lacking serum response factor. PLoS One 3, e3910 (2008).
Stein, B. & Yang, M. X. Repression of the interleukin-6 promoter by estrogen receptor is mediated by NF-kappa B and C/EBP beta. Mol. Cell Biol. 15, 4971–4979 (1995).
Chicas, A. et al. H3K4 demethylation by Jarid1a and Jarid1b contributes to retinoblastoma-mediated gene silencing during cellular senescence. Proc. Natl Acad. Sci. USA 109, 8971–8976 (2012).
Avram, D. et al. Isolation of a novel family of C(2)H(2) zinc finger proteins implicated in transcriptional repression mediated by chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan nuclear receptors. J. Biol. Chem. 275, 10315–10322 (2000).
Krasteva, V. et al. The BAF53a subunit of SWI/SNF-like BAF complexes is essential for hemopoietic stem cell function. Blood 120, 4720–4732 (2012).
Cismasiu, V. B. et al. BCL11B functionally associates with the NuRD complex in T lymphocytes to repress targeted promoter. Oncogene 24, 6753–6764 (2005).
Liang, Y., Van Zant, G. & Szilvassy, S. J. Effects of aging on the homing and engraftment of murine hematopoietic stem and progenitor cells. Blood 106, 1479–1487 (2005).
Morrison, S. J., Wandycz, A. M., Akashi, K., Globerson, A. & Weissman, I. L. The aging of hematopoietic stem cells. Nat. Med. 2, 1011–1016 (1996).
de Haan, G., Nijhof, W. & Van Zant, G. Mouse strain-dependent changes in frequency and proliferation of hematopoietic stem cells during aging: correlation between lifespan and cycling activity. Blood 89, 1543–1550 (1997).
Biteau, B., Hochmuth, C. E. & Jasper, H. JNK activity in somatic stem cells causes loss of tissue homeostasis in the aging Drosophila gut. Cell Stem Cell 3, 442–455 (2008).
Dong, Q. et al. Aging is associated with an expansion of CD49f(hi) mammary stem cells that show a decline in function and increased transformation potential. Aging 8, 2754–2776 (2016).
Kenyon, C. J. The genetics of ageing. Nature 464, 504–512 (2010).
Mercurio, F. & Manning, A. M. NF-kappaB as a primary regulator of the stress response. Oncogene 18, 6163–6171 (1999).
Taniguchi, K. & Karin, M. NF-kappaB, inflammation, immunity and cancer: coming of age. Nat. Rev. Immunol. 18, 309–324 (2018).
Podolin, P. L. et al. Attenuation of murine collagen-induced arthritis by a novel, potent, selective small molecule inhibitor of IkappaB Kinase 2, TPCA-1 (2-[(aminocarbonyl)amino]-5-(4-fluorophenyl)-3-thiophenecarboxamide), occurs via reduction of proinflammatory cytokines and antigen-induced T cell Proliferation. J. Pharm. Exp. Ther. 312, 373–381 (2005).
Nan, J. et al. TPCA-1 is a direct dual inhibitor of STAT3 and NF-kappaB and regresses mutant EGFR-associated human non-small cell lung cancers. Mol. Cancer Ther. 13, 617–629 (2014).
Marongiu, F. & DeGregori, J. The sculpting of somatic mutational landscapes by evolutionary forces and their impacts on aging-related disease. Mol. Oncol. 16, 3238–3258 (2022).
Nordling, C. O. A new theory on cancer-inducing mechanism. Br. J. Cancer 7, 68–72 (1953).
Armitage, P. & Doll, R. The age distribution of cancer and a multi-stage theory of carcinogenesis. Br. J. Cancer 8, 1–12 (1954).
Horvath, S. DNA methylation age of human tissues and cell types. Genome Biol. 14, R115 (2013).
Vijg, J., Busuttil, R. A., Bahar, R. & Dollé, M. E. Aging and genome maintenance. Ann. N. Y. Acad. Sci. 1055, 35–47 (2005).
Vincze, O. et al. Cancer risk across mammals. Nature 601, 263–267 (2022).
Daher, M. T., Bausero, P., Agbulut, O., Li, Z. & Parlakian, A. Bcl11b/Ctip2 in Skin, Tooth, and craniofacial system. Front Cell Dev. Biol. 8, 581674 (2020).
Sage, J., Miller, A. L., Pérez-Mancera, P. A., Wysocki, J. M. & Jacks, T. Acute mutation of retinoblastoma gene function is sufficient for cell cycle re-entry. Nature 424, 223–228 (2003).
Lee, S. & Schmitt, C. A. The dynamic nature of senescence in cancer. Nat. Cell Biol. 21, 94–101 (2019).
Prater, M., Shehata, M., Watson, C. J. & Stingl, J. Enzymatic dissociation, flow cytometric analysis, and culture of normal mouse mammary tissue. Methods Mol. Biol. 946, 395–409 (2013).
Campbell, S. M., Taha, M. M., Medina, D. & Rosen, J. M. A clonal derivative of mammary epithelial cell line COMMA-D retains stem cell characteristics of unique morphological and functional heterogeneity. Exp. Cell Res. 177, 109–121 (1988).
Yang, J., Amiri, K. I., Burke, J. R., Schmid, J. A. & Richmond, A. BMS-345541 targets inhibitor of kappaB kinase and induces apoptosis in melanoma: involvement of nuclear factor kappaB and mitochondria pathways. Clin. Cancer Res. 12, 950–960 (2006).
Smith, T., Heger, A. & Sudbery, I. UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Res. 27, 491–499 (2017).
Hao, Y. et al. Integrated analysis of multimodal single-cell data. Cell 184, 3573–3587.e3529 (2021).
Qiu, X. et al. Reversed graph embedding resolves complex single-cell trajectories. Nat. Methods 14, 979–982 (2017).
Gu, Z., Eils, R. & Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 32, 2847–2849 (2016).
Durinck, S., Spellman, P. T., Birney, E. & Huber, W. Mapping identifiers for the integration of genomic datasets with the R/bioconductor package biomaRt. Nat. Protoc. 4, 1184–1191 (2009).
Durinck, S. et al. BioMart and bioconductor: a powerful link between biological databases and microarray data analysis. Bioinformatics 21, 3439–3440 (2005).
Yu, G., Wang, L. G., Han, Y. & He, Q. Y. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics: A J. Integr. Biol. 16, 284–287 (2012).
McCarthy, D. J., Campbell, K. R., Lun, A. T. & Wills, Q. F. Scater: pre-processing, quality control, normalization and visualization of single-cell RNA-seq data in R. Bioinformatics 33, 1179–1186 (2017).
Whitfield, M. L. et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol. Biol. Cell 13, 1977–2000 (2002).
Colaprico, A. et al. TCGAbiolinks: an R/bioconductor package for integrative analysis of TCGA data. Nucleic Acids Res. 44, e71 (2016).
Plaisier, C. L. et al. Causal mechanistic regulatory network for glioblastoma deciphered using systems genetics network analysis. Cell Syst. 3, 172–186 (2016).
Teschendorff, A. E. & Enver, T. Single-cell entropy for accurate estimation of differentiation potency from a cell’s transcriptome. Nat. Commun. 8, 15599 (2017).
Rouillard, A. D. et al. The harmonizome: a collection of processed datasets gathered to serve and mine knowledge about genes and proteins. Database (Oxf.) 2016, baw100 (2016).
Lachmann, A. et al. ChEA: transcription factor regulation inferred from integrating genome-wide ChIP-X experiments. Bioinformatics 26, 2438–2444 (2010).
Han, H. et al. TRRUST v2: an expanded reference database of human and mouse transcriptional regulatory interactions. Nucleic Acids Res. 46, D380–D386 (2018).
Li, H. et al. The sequence alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
Yu, G., Wang, L. G. & He, Q. Y. ChIPseeker: an R/bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics 31, 2382–2383 (2015).
Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24–26 (2011).
Hu, Y. & Smyth, G. K. ELDA: extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J. Immunol. Methods 347, 70–78 (2009).
Acknowledgements
This work was supported by National Natural Science Foundation of China NSFC grant 32170803, 81872405. This work was supported by Westlake Education Foundation. We thank Dr. Fuchou Tang for sharing single cell RNAseq protocol. We thank Peng Guo, Dandan Liao and Yanan Tang at the Flow Cytometry Facility of Westlake University for assistance in FACS sorting. We thank Haiyan Zhang at the Genomics Core Facility of Westlake University for assistance in library quality testing. We thank Shuying Li for assistance with the TPCA-1 treatment in Bcl11b KO mice. We thank Tingting Dong and Yue Zhang for their assistance in p16 knockout cell construction. We thank the Westlake Animal Facility for their support in mouse husbandry. We are grateful for Dr. Dangsheng Li, Dr. Zhen Qi for valuable discussions and suggestions.
Author information
Authors and Affiliations
Contributions
S.C. and H.B. conceptualized the project and developed the methodology; H.B. performed most of the experiments; S.C. and H.B. conceptualized the bioinformatic analysis. X.L. and N.L. performed scRNA-seq and ChIP-seq data analysis; Y.M. and M.L. conducted the experiments for revision, including immunofluorescence, and immunohistochemical analysis; R.T. executed tumor induction assay in Krt14rtTA-TetOcre-mTmG mice; Y.G performed mouse genotyping; M.F.C. revised the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks Martin Zhang and the other anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Bai, H., Liu, X., Lin, M. et al. Progressive senescence programs induce intrinsic vulnerability to aging-related female breast cancer. Nat Commun 15, 5154 (2024). https://doi.org/10.1038/s41467-024-49106-2
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-024-49106-2
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.