RETRACTED ARTICLE: Polymerase θ inhibition activates the cGAS-STING pathway and cooperates with immune checkpoint blockade in models of BRCA-deficient cancer

Patterson-Fortin, Jeffrey; Jadhav, Heta; Pantelidou, Constantia; Phan, Tin; Grochala, Carter; Mehta, Anita K.; Guerriero, Jennifer L.; Wulf, Gerburg M.; Wolpin, Brian M.; Stanger, Ben Z.; Aguirre, Andrew J.; Cleary, James M.; D’Andrea, Alan D.; Shapiro, Geoffrey I.

doi:10.1038/s41467-023-37096-6

Download PDF

Article
Open access
Published: 13 March 2023

RETRACTED ARTICLE: Polymerase θ inhibition activates the cGAS-STING pathway and cooperates with immune checkpoint blockade in models of BRCA-deficient cancer

Nature Communications volume 14, Article number: 1390 (2023) Cite this article

12k Accesses
11 Citations
45 Altmetric
Metrics details

Subjects

This article was retracted on 11 December 2023

This article has been updated

Abstract

Recently developed inhibitors of polymerase theta (POLθ) have demonstrated synthetic lethality in BRCA-deficient tumor models. To examine the contribution of the immune microenvironment to antitumor efficacy, we characterized the effects of POLθ inhibition in immunocompetent models of BRCA1-deficient triple-negative breast cancer (TNBC) or BRCA2-deficient pancreatic ductal adenocarcinoma (PDAC). We demonstrate that genetic POLQ depletion or pharmacological POLθ inhibition induces both innate and adaptive immune responses in these models. POLθ inhibition resulted in increased micronuclei, cGAS/STING pathway activation, type I interferon gene expression, CD8⁺ T cell infiltration and activation, local paracrine activation of dendritic cells and upregulation of PD-L1 expression. Depletion of CD8⁺ T cells compromised the efficacy of POLθ inhibition, whereas antitumor effects were augmented in combination with anti-PD-1 immunotherapy. Collectively, our findings demonstrate that POLθ inhibition induces immune responses in a cGAS/STING-dependent manner and provide a rationale for combining POLθ inhibition with immune checkpoint blockade for the treatment of HR-deficient cancers.

Immune checkpoint blockade in triple negative breast cancer influenced by B cells through myeloid-derived suppressor cells

Article Open access 12 July 2021

In vivo CRISPR screens reveal the landscape of immune evasion pathways across cancer

Article 23 September 2022

Mutations in BRCA1 and BRCA2 differentially affect the tumor microenvironment and response to checkpoint blockade immunotherapy

Article 16 November 2020

Introduction

Tumors deficient in homologous recombination (HR) repair secondary to mutations in genes such as BRCA1 or BRCA2, are dependent on alternative DNA damage response (DDR) pathways to maintain genomic integrity, rendering them susceptible to synthetic lethal targeting of these pathways^1,2,3. Over the past several years, the principle of synthetic lethality has been successfully employed as a therapeutic strategy, leading to the FDA approval of inhibitors of poly (ADP-ribose) polymerase (PARP) for clinical use in BRCA-deficient breast, ovarian, pancreatic, and prostate cancers⁴. More recently, inhibitors of polymerase theta (POLθ, encoded by POLQ), the critical enzyme in microhomology-mediated end-joining (MMEJ), have been shown to abrogate MMEJ, and are similarly synthetic lethal in tumors with HR repair deficiency^5,6. The dependence of HR repair-deficient cancers on MMEJ is reflected by their high levels of POLθ expression^7,8. Furthermore, HR-deficient tumors that acquire resistance to PARP inhibition may retain increased POLθ expression and MMEJ dependence, so that POLθ inhibition may overcome PARP inhibitor resistance⁵.

Multiple cell-intrinsic and cell-extrinsic mechanisms account for the synthetic lethality between PARP inhibition or POLθ inhibition and HR-deficiency^4,9,10,11. Regarding cell-extrinsic mechanisms, DNA damage mediated by PARP inhibition in BRCA1-deficient cancers induces T-cell infiltration and activation via the cyclic GMP-AMP synthase (cGAS)/stimulator of interferon genes (STING) innate immunity pathway, leading to increased expression of type I interferons^12,13. Consequently, the addition of PD-1 or PD-L1 blockade enhances the therapeutic efficacy of PARP inhibition in preclinical models^12,13,14,15. Notably, Polq knockout mice exhibit increased micronucleation^16,17 and therefore a source of immunostimulatory DNA. Based on this phenotype, as well as the synthetic lethality between POLθ inhibition and HR-deficiency, and recent data demonstrating activation of the cGAS/STING pathway upon combined knockout of POLQ and FANCD2 in esophageal cancers¹⁸, we hypothesized that POLθ inhibition in BRCA-deficient cancers would likewise activate the cGAS/STING pathway and lead to increased T-cell infiltration and activation, with sensitization to immune checkpoint blockade.

In this study, we used human cell lines and mouse models representative of BRCA1-deficient triple-negative breast cancer (TNBC) and BRCA2-deficient pancreatic ductal adenocarcinoma (PDAC) to demonstrate that pharmacological inhibition of POLθ using either novobiocin (NVB), an inhibitor of the POLθ ATPase domain for which we have previously established biochemical and biological specificity⁵, or ART558, an inhibitor of the POLθ polymerase domain⁶, as well as genetic depletion of POLQ, all induce cGAS/STING pathway activation. Consequently, POLθ inhibition drives the expression of type I interferon response elements, including PD-L1, and increases CD8⁺ T-cell tumor infiltration and activation, as well as activation of antigen-presenting dendritic cells (DCs) in a paracrine fashion. Depletion of CD8⁺ T cells decreased the antitumor efficacy of NVB. In contrast, the antitumor activity of NVB was augmented with the addition of an anti-PD-1 antibody. Thus, our study uncovers a novel mechanism contributing to the activity of POLθ inhibition in BRCA-deficient breast and pancreatic cancers that is mediated by host immune responses and that can be enhanced by immune checkpoint blockade.

Results

POLθ inhibition enhances PD-L1 expression in vitro and in vivo and synergizes with anti-PD-1 immunotherapy in HR-deficient cancers

Given the synthetic lethal relationship between HR deficiency and POLθ inhibition, as well as the known stimulation of antitumor immune responses by DNA damage, we hypothesized that POLθ inhibition would promote antitumor immunity^7,19,20. To investigate the interactions of POLθ inhibition with the immune microenvironment in HR-deficient cancers, we first determined the effect of POLθ inhibition on PD-L1 expression in two different BRCA-deficient cancer cell lines. We treated both BRCA1-deficient MDA-MB-436 TNBC cells and BRCA2-deficient CAPAN-1 PDAC cells with the POLθ ATPase domain inhibitor NVB and analyzed PD-L1 expression by immunoblot and quantitative PCR (qPCR)⁵. Treatment with NVB significantly increased the total level of PD-L1 protein (Fig. 1a, b, left panels) and CD274/PDL1 mRNA expression (Fig. 1a, b, right panels) in both cell lines. To confirm that PD-L1 induction was specifically due to POLθ inhibition by NVB and not by an off-target effect, we also knocked down POLQ using siRNA in both MDA-MB-436 and CAPAN-1 cells. Consistent with NVB-mediated pharmacological inhibition, PD-L1 expression was increased in POLQ-depleted MDA-MB-436 (Supplementary Fig. 1a) and CAPAN-1 (Supplementary Fig. 1b) cells. In addition, PD-L1 upregulation upon POLθ inhibition was confirmed by treatment of MDA-MB-436 (Supplementary Fig. 1c) and CAPAN-1 cells (Supplementary Fig. 1d) with an inhibitor of the POLθ polymerase domain, ART558, demonstrating that results are similar regardless of the use of an ATPase inhibitor or a polymerase domain inhibitor of POLθ⁶.

**Fig. 1: POLθ inhibition induces PD-L1 expression in vitro and in vivo and is enhanced by anti-PD-1 immunotherapy in HR-deficient cancers.**

We next determined whether upregulation of PD-L1 upon NVB treatment requires the synthetic lethal relationship between HR-deficiency and POLθ inhibition. We reasoned that upregulation of PD-L1 expression would be abrogated if this relationship were rescued by HR proficiency. To investigate this hypothesis, we utilized isogenic pairs of parental and BRCA1 or BRCA2-reconstituted MDA-MB-436 and CAPAN-1 cells^21,22. Treatment with NVB did not increase the total level of PD-L1 protein in BRCA1-reconstituted MDA-MB-436 cells or BRCA2-reconstituted CAPAN-1 cells by immunoblot analysis (Fig. 1c, d, left panels). These results were again validated by quantitative PCR, demonstrating absence of increased CD274/PDL1 expression with NVB treatment in BRCA-reconstituted cells (Fig. 1c, d, right panels). The underlying mechanism of this loss of increased PD-L1 expression is likely decreased POLQ expression in BRCA-reconstituted (i.e., HR-proficient) cancer cells (Supplementary Fig. 1e, f), which correlates with decreased sensitivity to NVB-mediated POLθ inhibition^7,8.

To determine whether NVB-mediated POLθ inhibition in HR-deficient cancer cells would upregulate PD-L1 expression in vivo, we employed two HR-deficient immunocompetent mouse models. To recapitulate BRCA1 deficiency in breast cancer, tumors derived from the K14-Cre-Brca1^f/f;Trp53^f/f immunocompetent genetically engineered mouse model of TNBC were orthotopically implanted into the mammary fat pads of FVB/129P2 syngeneic mice. To recapitulate BRCA2 deficiency in pancreatic cancer, Brca2 was knocked out by CRISPR/Cas9 in a murine PDAC cell line derived from late-stage primary tumors from an autochthonous mouse model of Kras^G12D and Trp53^R172H-mutated PDAC (KPC)²³ (Fig. 1f). Brca2-null KPC cells were subcutaneously injected into immunocompetent C57BL/6 mice. In both models, mice were treated with vehicle or NVB for 5 days. Analysis of Brca1-deficient breast tumors from NVB-treated mice demonstrated significant upregulation of PD-L1 expression by immunohistochemistry (IHC) (Fig. 1e) and by flow cytometry (Fig. 1h; Supplementary Fig. 1g, h). Whole-tumor Cd274/Pd-l1 mRNA expression was also significantly increased in NVB-treated mice compared to vehicle-treated mice (Fig. 1i). Consistent with these results, Brca2-deficient PDAC from NVB-treated mice also demonstrated significantly upregulated PD-L1 expression by IHC (Fig. 1g) and by flow cytometry (Fig. 1j). Similarly, whole-tumor Cd274/Pdl1 mRNA expression was significantly increased in NVB-treated compared to vehicle-treated mice (Fig. 1k). Altogether, these results demonstrate that NVB-mediated POLθ inhibition upregulates PD-L1 expression in HR-deficient cancers both in vitro and in vivo.

Given that PD-L1 expression was significantly increased following NVB treatment in HR-deficient cancers both in vitro and in vivo, we hypothesized that PD-1 blockade might augment the antitumor activity of NVB. Brca2-deficient KPC cells were subcutaneously injected into immunocompetent C57BL/6 and treated with vehicle or NVB, with or without anti-PD-1 blockade, for 28 days, all of which were well tolerated (Supplementary Fig. 1i). Mice treated with vehicle or anti-PD-1 alone showed no antitumor response. Mice treated with NVB-alone demonstrated tumor growth inhibition (Fig. 1l) and overall survival (Fig. 1m) that was significantly improved with the addition of anti-PD-1 blockade. Thus, NVB-mediated POLθ inhibition increases PD-L1 expression and demonstrates enhanced antitumor activity when combined with anti-PD-1 immunotherapy in HR-deficient cancers.

Efficacy of POLθ inhibition in HR-deficient cancers requires CD8⁺ T cells

Given the effects of NVB-mediated POLθ inhibition on PD-L1 expression and the interaction with anti-PD-1 blockade in HR repair-deficient cancers, we reasoned that the antitumor activity of NVB may depend on tumor cell-extrinsic responses in addition to the known cell-intrinsic mechanisms. To this end, we sought to further characterize the effects of NVB on the tumor immune microenvironment of Brca1-deficient TNBC and Brca2-deficient PDAC by IHC and flow cytometry, with particular emphasis on T-cell subsets given the induction of PD-L1 upon POLθ inhibition (Fig. 1). IHC analyses of Brca1-deficient TNBC or Brca2-deficient PDAC tumors from NVB-treated immunocompetent mice showed increased CD3⁺, CD4⁺, and CD8⁺ T-cell infiltrates (Fig. 2a, b), confirmed in both models by flow cytometry (Fig. 2c–f; Supplementary Fig. 2a–d). Importantly, the recruited CD8⁺ T cells were cytolytically active, as demonstrated by increased Granzyme B staining (Fig. 2c, d). Although the number of CD4⁺ T cells was increased, the proportion of regulatory FOXP3⁺, CD4⁺ T cells (Treg) was not significantly affected, suggesting that conventional CD4⁺ T were recruited and may also contribute to NVB-mediated antitumor effects (Fig. 2e, f). Indeed, many types of immune cells may be engaged in mediating immune responses upon POLθ inhibition, as the proportions of CD11c⁺CD11b⁻ dendritic cells (DCs) and CD11b⁺CD11c⁻ macrophages were also increased (Fig. 2g, h; Supplementary Figs. 2a, 3a, b). To evaluate the importance of a T-cell-mediated immune response for the antitumor efficacy of NVB, we depleted CD8⁺ T cells using an anti-CD8 antibody in both syngeneic models of BRCA-deficient cancers and treated with vehicle or NVB. Antibody-mediated depletion of CD8⁺ T cells decreased the tumor growth inhibition mediated by NVB (Fig. 2i, j; Supplementary Fig. 2c–e). Thus, we conclude that CD8⁺ T cells are required for NVB-mediated POLθ inhibition to be fully effective in vivo.

POLθ inhibition activates the cGAS/STING pathway in HR-deficient cancers

Mammalian Polq was first identified in a mutagenesis screen for chromosome instability mutants using a flow cytometric peripheral blood micronucleus assay¹⁶. Micronuclei are a known source of immunostimulatory cytosolic DNA that activates the cGAS/STING pathway, leading to increased expression of type I interferons, as can occur after exposure to other DNA repair pathway inhibitors^12,13,17,24. Accordingly, we sought to determine whether NVB-induced cytotoxic T-cell recruitment and synergy with anti-PD-1 therapy is mediated by the cGAS/STING pathway, as PD-L1 is an interferon response gene^25,26. To test this hypothesis, we first examined cGAS/STING pathway activation in the MDA-MB-436 and CAPAN-1 isogenic paired cell lines (Fig. 3; Supplementary Fig. 4). NVB-mediated POLθ inhibition significantly increased cytosolic dsDNA contained in micronuclei in MDA-MB-436 HR-deficient but not BRCA1-reconstituted HR-proficient cells (Fig. 3a; Supplementary Fig. 4a). Similar results were observed in CAPAN-1 HR-deficient and BRCA2-reconstituted cells (Fig. 3b; Supplementary Fig. 4b). This free DNA was sensed by the cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthetase (cGAS) in HR-deficient MDA-MB-436 and CAPAN-1 cells but not in their BRCA-reconstituted derivatives (Fig. 3a-d; Supplementary Fig. 4a, b)^27,28,29,30. cGAS mediates the synthesis of cGAMP in response to increased cytosolic dsDNA, and NVB consequently significantly increased cGAMP production only in HR-deficient cells, but not in their HR-proficient counterparts (Fig. 3e, f). cGAMP binds to and activates stimulator of interferon genes (STING), triggering phosphorylation of TBK1 and ultimately of IRF3. Phosphorylated IRF3 subsequently translocates to the nucleus, where it activates the expression of type I interferon and interferon-responsive genes^{23,28,29,30,31}. Treatment of HR-deficient cell lines with NVB led to activation of the STING pathway, as evidenced by phosphorylation of STING, STAT1, and TBK1 (Fig. 3g). Similar results were observed with siRNA-mediated knockdown of POLQ (Fig. 3h) or with ART558-mediated inhibition of POLθ (Fig. 3i) in both MDA-MB-436 and CAPAN-1 cells, indicating that the consequences of NVB treatment were unlikely due to off-target effects. To demonstrate that POLθ inhibition also leads to the activation of IRF3 in HR-deficient but not HR-proficient cells, we performed immunofluorescence for phosphorylated IRF3 in MDA-MB-436 or CAPAN-1 cell lines and their BRCA-reconstituted derivatives treated with NVB (Fig. 3j, k; Supplementary Fig. 4c, d). Increased phosphorylation and activation of IRF3 correlated with DNA damage accumulation, as evidenced by formation of γH2AX foci upon NVB treatment (Fig. 3l, m).

**Fig. 3: POLθ inhibition activates the cGAS/STING pathway in BRCA-deficient cancers.**

Since phosphorylated IRF3 is a transcription factor for type I interferon genes, we predicted that NVB would lead to increased mRNA expression of type I interferon genes³². Indeed, NVB treatment of BRCA1-deficient MDA-MB-436 or BRCA2-deficient CAPAN-1 cells significantly increased mRNA expression of a panel of type I interferon genes (ISG15, IRF7, CCL5, CXCL10, and IFNB1) (Fig. 4a, b). Consistently, siRNA-mediated depletion of POLQ or treatment with ART558 similarly increased type I interferon gene mRNA expression (Fig. 4c–f; Supplementary Fig. 4e–h).

**Fig. 4: POLθ inhibition induces an in vitro pro-inflammatory response in BRCA-deficient cancers.**

Although BRCA-reconstituted cells no longer have MMEJ dependence or NVB sensitivity, we have previously shown that BRCA-deficient cells exposed to graded concentrations of a PARP inhibitor until acquired resistance emerges retain high levels of POLQ expression and NVB sensitivity⁵. We therefore asked whether NVB-mediated POLθ inhibition would also activate the cGAS/STING pathway in the setting of acquired PARP inhibitor resistance, using MDA-MB-436 rucaparib-resistant (MDA-MB-436-RR) cells that are cross-resistant to other PARP inhibitors and cisplatin²¹. Consistent with the persistent sensitivity of PARP inhibitor-resistant cells to POLθ inhibition, we observed robust activation of the cGAS/STING pathway in response to NVB in the resistant cells (Fig. 4g, h; Supplementary Fig. 4i).

To determine whether NVB would activate the cGAS/STING pathway in HR-deficient cancers in vivo, we performed flow cytometric analysis of both Brca1-deficient TNBC tumors and Brca2-deficient PDAC tumors from immunocompetent mice treated for 5 days with NVB. Consistent with the in vitro data, POLθ inhibition significantly increased the proportion of pTBK1⁺ CD45⁻ (Fig. 5a, b) and pIRF3⁺ CD45⁻ cells (Fig. 5c, d; Supplementary Fig. 5a–c). In vivo activation of the cGAS/STING pathway consequently led to increased expression of a panel of type I interferon genes (Fig. 5e, f).

**Fig. 5: POLθ inhibition induces an in vivo pro-inflammatory response in BRCA-deficient cancers.**

In summary, we conclude that POLθ inhibition activates the cGAS/STING pathway in HR-deficient cancers, accounting for the increased production of type I interferons and recruitment of CD8⁺ T cells and underlying the decreased efficacy of NVB when combined with anti-CD8 treatment.

POLθ inhibition in HR-deficient tumors activates the cGAS/STING pathway in dendritic cells (DCs)

NVB treatment of immunocompetent mice bearing Brca-deficient tumors also resulted in an increased proportion of CD11c⁺CD11b⁻ DCs in the tumor microenvironment (Supplementary Fig. 2a). Furthermore, NVB-mediated POLθ inhibition led to increased concentration of a potent DC chemokine, CCL5³³, in the media of both MDA-MB-436 or CAPAN-1 cells (Supplementary Fig. 5d, e). Given that the cGAS/STING pathway can be activated in DCs and that NVB treatment activates this pathway in tumor cells, we asked whether cGAS/STING pathway activation is also increased in response to NVB in DCs. Consequent expression of type I interferons would be expected to facilitate tumor antigen presentation on DCs and help activate DCs²⁸. Flow cytometric analysis of the CD11c⁺CD11b⁻ cells derived from either Brac1-deficent TNBC or Brca2-deficient PDAC tumors demonstrated a significant increase in the proportion expressing pTBK1, pIRF3, and PD-L1 after NVB exposure (Fig. 6a, b; Supplementary Fig. 5f–h).

**Fig. 6: POLθ inhibition in HR-deficient tumors induces the cGAS/STING pathway in dendritic cells.**

To determine if the activation of the cGAS/STING pathway in DCs is a direct effect of NVB, we treated human DCs with increasing concentrations of NVB ex vivo. As a positive control, DCs were also treated with the STING agonist ADU-S100. Whereas treatment of DCs with ADU-S100 enhanced type I interferon gene expression, there was no change in type I interferon gene expression upon NVB treatment (Fig. 6c). This result suggests that POLθ inhibition does not directly activate the cGAS/STING pathway in DCs. We therefore performed co-culture experiments with DCs together with vehicle- or NVB-treated BRCA1-deficient MDA-MB-436 cells or BRCA2-deficient CAPAN-1 cells (Fig. 6d). We observed significant enhancement of type I interferon gene expression in DCs co-cultured with NVB compared to vehicle-treated BRCA1-deficient TNBC cells (Fig. 6e) or BRCA2-deficient CAPAN-1 cells (Fig. 6f), likely secondary to the increased 2,3 cGAMP observed upon NVB-mediated POLθ inhibition (Fig. 3e, f). These results indicate NVB-mediated POLθ inhibition in BRCA-deficient cancer activates the cGAS/STING pathway in dendritic cells in a paracrine fashion.

cGAS/STING pathway activation is required for the pro-inflammatory response and PD-L1 upregulation mediated by POLθ inhibition

We next sought to directly link the pro-inflammatory response and consequent upregulation of PD-L1 expression observed in NVB-treated BRCA-deficient cancers to cGAS/STING pathway activation. To establish dependence of these events on the cGAS/STING pathway, we depleted STING by siRNA in BRCA1-deficient MDA-MB-436 cells and in BRCA2-deficient CAPAN-1 cells and assayed phosphorylated TBK1 levels by immunoblot in response to NVB. Depletion of STING by siRNA abrogated NVB-mediated phosphorylation of TBK1 in both cell lines (Fig. 7a, b). We then determined if STING depletion would prevent the enhanced type I interferon gene expression observed upon NVB-mediated POLθ inhibition. As predicted, qPCR demonstrated that the enhanced type I interferon gene expression seen upon NVB treatment was abrogated upon STING depletion (Fig. 7c, d). To confirm that activation of the cGAS/STING pathway is dependent on POLθ inhibition, we depleted POLQ, STING, or both in MDA-MB-436 or CAPAN-1 cells. As expected, POLQ depletion was accompanied by STING pathway activation, evidenced by TBK1 phosphorylation. However, combined deletion of POLQ and STING abrogated TBK1 phosphorylation (Fig. 7e, f). Additionally, whereas POLQ depletion alone resulted in upregulation of PD-L1 expression, this was also abrogated by combined POLQ and STING depletion (Fig. 7e, f). These results reflect the ability of type I interferons to upregulate PD-L1 expression²⁵. Taken together, these data are consistent with reduced POLθ activity leading to cGAS/STING pathway activation that is required for PD-L1 upregulation.

**Fig. 7: cGAS/STING pathway activation is required for POLθ inhibition-mediated pro-inflammatory response.**

To determine if STING pathway activation is required for NVB-mediated antitumor efficacy in vivo, we generated Sting KO cells using CRISPR/Cas9 in KPC Brca2 KO cells (Fig. 8a). KPC Brca2 KO cells were employed since NVB-mediated POLθ inhibition did not activate the cGAS/STING pathway in KPC cells (Supplementary Fig. 6). We next confirmed that these KPC Brca2 Sting double knockout (DKO) cells did not activate a pro-inflammatory response upon NVB treatment compared to KPC Brca2 KO cells. As expected, CRISPR/Cas9-mediated depletion of Sting abrogated both NVB-mediated phosphorylation of TBK1 and enhanced type I interferon gene expression (Fig. 8b; Supplementary Fig. 7a). Consequently, CRISPR/Cas9-mediated depletion of Sting abrogated NVB-mediated upregulation of PD-L1 expression (Fig. 8c). To directly assess the requirement of cGAS/STING pathway activation in the antitumor efficacy of NVB, we implanted KPC Brca2 KO or KPC Brca2 Sting DKO cells into syngeneic mice and treated with NVB. Consistent with our previous results, NVB treatment significantly increased the mRNA expression of pro-inflammatory type I interferons in KPC Brca2 KO tumors (Fig. 8d, Supplementary Fig. 7b) and the proportion of infiltrating T cells (Fig. 8e, f), an effect that was lost in the Brca2 Sting DKO PDAC tumors (Fig. 8d–f; Supplementary Fig. 7b). Notably, PD-L1 expression was also significantly decreased in the Brca2 Sting DKO PDAC tumors despite NVB-mediated POLθ inhibition, consistent with our in vitro data, supporting a direct role for POLθ inhibitor-mediated cGAS/STING activation in the upregulation of PD-L1 (Fig. 8e, f). As previously observed, tumor volume was significantly reduced in response to NVB in mice bearing KPC Brca2 KO cells; however, the antitumor efficacy of NVB was significantly impaired in STING-depleted tumors (Fig. 8g; Supplementary Fig. 7c). These results demonstrate that NVB-mediated POLθ inhibition activates the cGAS/STING pathway leading to a pro-inflammatory response that is required for antitumor efficacy in vivo.

**Fig. 8: cGAS/STING pathway activation is required for POLθ inhibition-mediated antitumor efficacy and immune checkpoint activation.**

Discussion

Here we report that POLθ inhibition enhances PD-L1 expression in BRCA1-deficient breast and BRCA2-deficient pancreatic cancer cells but not in BRCA-reconstituted isogenic pairs. Consequentially and significantly, the antitumor activity of POLθ inhibition is augmented by anti-PD-1 immunotherapy in a Brca2-deficient mouse model of PDAC, representing a novel therapeutic strategy to sensitize HR-deficient cancers to immunotherapy. This effect is mediated through recruitment of cytotoxic granzyme B-positive CD8⁺ T cells, along with paracrine activation of DCs. Depletion of CD8⁺ T cells decreased the antitumor efficacy of POLθ inhibition. Mechanistically, POLθ inhibition in BRCA-deficient, but not in BRCA-proficient cancer cells, induced significant micronucleation likely related to the recently recognized role of POLθ in DSB repair during mitosis³⁴, causing progression through mitosis with residual DSBs, which leads to micronuclei formation³⁵. This resulted in intratumoral activation of the cGAS/STING pathway and enhanced expression of type I interferon genes, including PD-L1. Depletion of STING in tumor cells abolished the pro-inflammatory response mediated by POLθ inhibition, prevented recruitment of CD8⁺ T cells, and abrogated increased PD-L1 expression. Importantly, results were similar with two different POLθ inhibitors, NVB and ART558, indicating that inhibition of either the ATPase domain or the polymerase domain of POLθ can modulate the tumor immune microenvironment. Our findings demonstrate that POLθ inhibition combined with immunotherapy has significant antitumor effects, suggesting that this combination could be clinically valuable in cancers not thought historically responsive to immunotherapy, such as PDAC.

In addition to harboring mutations in BRCA1 or BRCA2, which is associated with increased POLQ expression (Supplementary Fig 1e, f)^8,11, HR-deficient TNBC and PDAC are more likely to harbor mutations in TP53, which leads to even more pronounced expression of POLQ^36,37. Indeed, increased expression of POLQ is a biomarker of NVB sensitivity^5,37. Thus, it would be expected that BRCA- and TP53-deficient cancers would be particularly sensitive to NVB-mediated POLθ inhibition, leading to micronucleation and potential synergy with immunotherapies such as anti-PD-1 blockade. POLθ inhibitors are under active clinical development, and these hypotheses can now be tested in HR repair-deficient patient populations.

Preclinically, POLθ inhibitors, such as NVB or ART558, have demonstrated substantial benefits in HR-deficient models of breast and ovarian cancers, secondary to the synthetic lethality induced by combined loss of HR and MMEJ leading to accumulation of single-stranded DNA intermediates and non-functional RAD51 foci^5,6. We have now extended these findings to demonstrate that POLθ inhibition in HR-deficient TNBC and PDAC cancers in vivo display a cell-extrinsic antitumor mechanism involving the activation of local and systemic antitumor immune responses. This mechanism of POLθ inhibitor-mediated antitumor activity is dependent on underlying HR deficiency, activation of the cGAS/STING pathway, and the recruitment of cytotoxic CD8⁺ T cells.

Our results raise several caveats, as well as new avenues of research. First, our findings were dependent on HR deficiency, as POLθ inhibition in HR-proficient TNBC and PDAC cancers did not activate the cGAS/STING pathway. These results are consistent with the lack of cGAS/STING pathway activation seen upon PARP inhibition in HR-proficient breast or ovarian cancers^12,13. Given the synergy observed between POLθ and PARP inhibition by us and others, it would be expected that combined POLθ and PARP inhibition would even more robustly activate the cGAS/STING pathway in HR-deficient cancers. Additionally, since POLθ inhibition can reverse acquired PARP inhibitor resistance, particularly when mediated by DNA end-resection rewiring^5,6, it will be important to determine if POLθ inhibitors can also modulate the immune microenvironment of PARP inhibitor-resistant cancers in vivo. Our in vitro results suggest this will be the case, as NVB was able to induce cGAS/STING activation in BRCA1-mutant MDA-MB-436 cells with acquired PARP inhibitor resistance. Therefore, in both PARP inhibitor-sensitive and -resistant backgrounds, a PARP inhibitor/POLθ inhibitor/anti-PD-1 antibody triplet may lead to robust and durable antitumor responses.

Second, the pro-inflammatory response mediated by POLθ inhibition was dependent on the cGAS/STING pathway. Depletion of STING by siRNA prevented phosphorylation of TBK1 and consequent type I interferon gene expression and prevented increased PD-L1 expression in response to POLθ inhibition or POLQ depletion. Consistent with these effects, intratumoral CRISPR knockout of Sting decreased PD-L1 expression upon NVB treatment of Brca2-deficient PDAC in vivo. Thus, upregulation of PD-L1 expression secondary to POLθ inhibition or depletion likely occurs directly by cGAS/STING activation through the observed upregulation of IFNB1. Although PD-L1 upregulation has been more strongly linked to type II interferons, it may also be upregulated by a type I response²⁵. Similar findings were observed with PARP or CHK1 inhibition²⁴, reinforcing the importance of cGAS/STING pathway activation in mediating the response to DNA damage inhibitors^12,24. STING agonists are currently under clinical investigation in combination with chemotherapy or with immunotherapy³⁴, raising the question of whether the antitumor efficacy of NVB-mediated POLθ inhibition could be augmented by STING agonism, similar to the improved antitumor response of combined STING agonism and PARP inhibition in Brca1-deficient TNBC³⁸.

Finally, our work has largely interrogated the T-cell component of the tumor microenvironment in response to POLθ inhibition. Other DNA repair inhibitors, including PARP inhibitors, have been reported to also modulate other immune cell populations, with complex effects on the phenotype of tumor-associated macrophages³⁹. In fact, PARP inhibition in Brca1-deficient TNBC resulted in the recruitment of immune-suppressive macrophages^39,40. This avenue of research is especially important given that preliminary data from clinical trials have not yet confirmed that the addition of immunotherapy to PARP inhibition improves antitumor responses compared to PARP inhibitor monotherapy⁴¹, raising the possibility that depletion or repolarization of macrophages will be necessary to realize the full potential of combined PARP and immune checkpoint blockade. Indeed, we observed increased infiltration of macrophages in response to POLθ inhibition, not only in the same immunocompetent model of Brca1-deficient TNBC, but also in Brca2-deficient PDAC. Further work will be required to assess the phenotype of this macrophage population and whether it is programmed as antitumor or immunosuppressive⁴². Additional studies will be necessary to carefully assess whether other immune cell populations are modulated by POLθ inhibition and whether they are immunostimulatory or suppressive, so that the immune microenvironment can be manipulated to maximize antitumor responses.

In summary, POLθ inhibition in HR-deficient TNBC and PDAC mouse models led to cGAS-STING-mediated expression of type I interferons known to be required for optimal immunological control of cancer, thereby resulting in increased immunogenicity of otherwise immunosuppressed tumors such as PDAC⁴³. Activation of the cGAS/STING pathway also led to enhanced expression of PD-L1, providing a rationale for investigating the role of immunotherapy in combination with POLθ inhibition. Moreover, our results demonstrating the improved efficacy of the combination of PD-1 blockade with POLθ inhibition provide a strong scientific rationale for combining these modalities in clinical trials. Since POLθ inhibitors are only just entering early phase clinical trials (e.g., NCT04991480 and NCT05687110), it will be important to confirm our preclinical findings of cGAS/STING pathway activation and increased CD8⁺ T-cell recruitment using paired tumor biopsies to interrogate the immune microenvironment. Such efforts to understand the scope of biological effects mediated by POLθ inhibition will ultimately inform patient stratification, predictive biomarkers, and rational combinatorial strategies.

Methods

Cell lines

Human TNBC BRCA1-deficient MDA-MB-436 isogenic pairs were grown in RPMI (Gibco) supplemented with 10% FBS and have been previously described²¹. Human MDA-MB-436 rucaparib-resistant (MDA-MB-436-RR) cells that are cross-resistant to other PARP inhibitors and cisplatin were grown in RPMI supplemented with 10% FBS as previously described²¹. Human pancreatic cancer BRCA2-deficient CAPAN-1 isogenic pairs were a gift from Dr. Christopher Lord and were grown in DMEM (Gibco) supplemented with 20% FBS. The murine pancreatic cancer cell line (Kras^LSL-G12D; Trp53 ^LoxP-; Pdx1-Cre; Rosa26YFP/YFP, referred to as KPC) was derived from late-stage primary tumors from an autochthonous mouse model of Kras and TP53-mutated PDAC, as previously described²³. These cells were cultured in DMEM (Gibco) supplemented with 10% FBS and were used to generate Brca2-deficient KPC cells using the CRISPR-based multi-guide Gene Knockout Kit v2 (Synthego). Three guides (AAAGCUCCUCAAACCAAUUG, UUAUACUCAGAUUCCUCCGG, GAAGCAAACUGAUGGUAGGG) targeting murine Brca2 were electroporated. 48 h post-electroporation, genomic DNA was extracted and analyzed by DNA sequencing to confirm the disruption of the functional Brca2 allele and confirmed by Western blot analysis. Similarly, KPC Brca2 cells were used to generate KPC Brca2/Sting DKO cells, also utilizing 3 guides (GCGAGGCUAGGUGAAGUGCU, GAUGAUCCUUUGGGUGGCAA, ACCUGCAUCCAGCCAUCCCA). Human dendritic cells were obtained from Lonza (CC-2701) and cultured in RMPI (Gibco) containing 10% FBS, 800 U/mL GM-CSF (R&D Systems), and 800 U/mL IL-4 (R&D Systems). For co-culture of tumor cells and dendritic cells, 3 × 10⁵ tumor cells were cultured in a 6-well plate and treated with DMSO or NVB. After 48 h, media was removed, and tumor cells washed twice with PBS. Media containing 3 × 10⁵ human dendritic cells was added and co-cultured for 24 h. Co-cultured cells were harvested for flow cytometry analysis and floating cells and floating cells (representing ~90% dendritic cells) were collected for mRNA analysis. All cell lines were regularly tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit from Lonza and identified by the DFCI Molecular Diagnostics Core Human Cell Line Authentication service at periodic intervals during the course of the study.

In vivo experiments

All animal experiments were approved by the Institutional Animal Care and Use Committee at the Dana-Farber Cancer Institute (protocol 17-032). Animals were maintained in housing rooms under controlled environmental conditions (temperature: 20+/− 2 °C; humidity: 35+/− 10%; photoperiod: 12 h light/12 h dark; HEPA-filtered air; animals enclosures provided sterile and adequate space with bedding material, food and water, environmental and social enrichment) at the Dana-Farber Cancer Institute Animal Resource Facility. For expansion of the Brca1-deficient TNBC model, tumor pieces generated from K14-Cre-Brca1^f/f;Trp53^f/f female mice were orthotopically transplanted into the mammary fat pad of 8-week-old first-generation female FVB/129P2 mice that were bred from FVB females (Jackson Laboratories) and 129P2 males (Envigo). For expansion of the Brca2-deficient PDAC model, cultured Brca2 CRISPR-KO KPC or Brca2 Sting CRISPR-DKO cells were harvested and resuspended in DMEM and mixed 1:1 with Matrigel (Corning). A total volume of 0.2 mL containing 2 × 10⁶ cells were injected subcutaneously into the flank of female 8-week-old C57BL/6J mice (Jackson Laboratories). For efficacy studies, treatments were started once the tumors were palpable and reached a volume of 50 to 100 mm³ and continued until tumors either reached 2000 mm³ in volume or ulcerated more than 10 mm in diameter, at which point mice were euthanized. For flow cytometry studies, mice bearing tumors of ~300 mm³ in volume were treated with PBS or NVB for 5 days prior to harvesting. These same tumors were also harvested for IHC and for whole-tumor mRNA extraction. PBS-reconstituted NVB was diluted in PBS (Corning) immediately before 0.2 mL intraperitoneal injection and administered at 75 mg/kg twice daily. Anti-CD8 and IgG2b isotype control antibodies (Bio X Cell; #BE0117 and BE0090) were dissolved in PBS (Corning) and administered intraperitoneally at 0.2 mg/dose in a volume of 0.2 mL, respectively, twice per week. Anti-PD-1 and IgG2a isotype control antibodies (Bio X Cell; #BP0273 and BP0089) were dissolved in PBS (Corning) and administered intraperitoneally at 0.2 mg/dose in a volume of 0.2 mL, respectively, twice per week. Tumors were measured every 3 to 4 days using electronic calipers, and tumor volumes were calculated as follows: V = (W(2) × L)/2.

Compounds

NVB (Selleckchem, NSC 2382) was reconstituted in DMSO at the indicated concentrations for in vitro studies and in PBS at 75 mg/kg for in vivo studies. ART558 (MedChemExpress, HY-141520) was reconstituted in DMSO and used at a concentration of 1 μM in vitro. ADU-S100 (MedChemExpress, MIW815) was reconstituted in DMSO and used at a concentration of 10 μM in vitro.

Flow cytometry

Following 5 days of treatment with vehicle (PBS) or NVB at 75 mg/kg, mice were sacrificed, and cardiac perfusion was performed. Tumors were excised, finely minced before being blended with the gentleMACS Dissociator (Miltenyi Biotec) and digested with the MACS Miltenyi Tumor Dissociation Kit (Miltenyi Biotec #130-096-730) according to the manufacturer’s instructions. Dissociated tumor cells were washed with RPMI (Gibco) and lysed with RBC Lysis Solution (Qiagen). Cells were resuspended in fluorescence-activated cell sorting (FACS) buffer composed of PBS, 0.5% BSA, and 2 mM EDTA. Cells were then incubated with the Zombie Aqua Fixable Viability Kit in combination with anti-mouse CD16/CD32 Fcγ receptor II/III blocking antibody (Affymetrix #14-0161-85) for 20 min at RT, prior to incubation with primary antibodies as indicated in Supplementary Table 1 for 1 h at 4 °C. Fixation and permeabilization was performed using the FoxP3/Transcription Factor Staining Buffer Set (Affymetrix #00-5523-00), according to the manufacturer’s guidelines, and incubated with antibodies for intracellular antigens as indicated in Supplementary Table 1 overnight at 4 °C. The following day, cells were washed, resuspended in PBS, and analyzed using a BD LSR Fortessa flow cytometer. Compensation was performed manually using single color and isotype controls as previously described¹². All-stain, unstained and isotype controls were used to define signal thresholds. Analysis was performed using FlowJo V10 and GraphPad Prism V9. Gating strategies are provided in Supplementary Fig. 1 and Supplementary Fig. 5.

Immunohistochemistry (IHC)

IHC was performed on extracted tumors fixed overnight using 10% formalin solution using a Leica Bond automated staining platform. Fixed tumors were paraffin embedded by the Specialized Histopathology Core at the Brigham and Women’s Hospital (BWH). Thin section slides were produced and washed with Histo-Clear II (National Diagnostics HS-202) twice, 100% ethanol twice, and rehydrated with washes of 90%, 80%, 70%, and 50% ethanol. Antigens were unmasked by heating sections to 100 °C with ER2 buffer for 20 min. Once cooled, sections were washed sequentially with Peroxide Block for 5 min and three times with Bond Wash buffer. Sections were then stained in blocking buffer containing primary antibody (Supplementary Table 1) for 1 h at RT. Sections were then washed three times with 1X PBS and incubated with linker antibody at 2.5 μg/mL for 8 min followed by two washes with Bond Wash buffer and incubated with polymer for 8 min. Sections were then washed five times with Bond Wash buffer, incubated with Mixed DAB Refine for 10 min, washed three times with deionized water, and incubated with Hematoxylin for 10 min, followed by thrice washing with Bond Wash buffer. Stained slides were scanned on an Olympus BX41 microscope equipped with a digital camera at 40X magnification into the Aperio image analysis platform for algorithmic image analysis.

Immunofluorescence

Cells were seeded on coverslips and treated as indicated. Cells were washed once with PBS and then fixed using 4% paraformaldehyde for 10 min at RT. Fixed cells were washed twice with PBS before permeabilization with 0.5% Triton X-100 in PBS (PBST) for 5 min at 4 °C. All subsequent wash steps were with PBST. Following permeabilization, cells were washed twice, and then incubated with the appropriate primary antibody (Supplementary Table 1) for 1 h at 37 °C. Following primary incubation, cells were washed three times, then incubated with the appropriate secondary antibody (Supplementary Table 1) for 1 h at 37 °C. Following secondary incubation, coverslips were washed four times and then mounted on glass slides using mounting media containing DAPI (Vectashield). Cells were imaged using a Zeiss AxioObserver microscope and quantified using Image J (NIH).

Immunoblotting

Cells were lysed in NETN buffer (10 mM TrisCl, pH 7.4, 1 mM EDTA, 0.05% Nonidet P-40, and protease inhibitors) containing 150 mM NaCl for 15 min on ice. Protein was quantified using Protein Assay Dye Reagent (Bio-Rad) and equal amounts were resolved on Nu-Page Bis-Tris (Invitrogen) polyacrylamide gels using MES buffer and transferred to nitrocellulose membranes using Tris-Glycine wet transfer. Membranes were blocked with 5% milk in TBST for 1 h at RT, and then probed with primary antibodies (Supplementary Table 1) for 1 h at RT. Appropriate enhanced chemiluminescence secondary antibodies (Supplementary Table 1), were then applied for 1 h at RT. Immunodetection was performed using Western Lightning (Perkin Elmer) and imaged on an AI600 Chemiluminescent Imager (Amersham).

cGAMP, CCL5 ELISA

Cell lysates from vehicle (DMSO) and NVB-treated cells were prepared in mammalian protein extraction reagent (Thermofisher). Protein concentration of the lysates was determined, and 25 mg of lysate was used to assess either cGAMP or CCL5 levels using an enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s protocol (Cayman Chemical, #501700, and R&D Systems, DNR00B, respectively).

Quantitative PCR (qPCR)

RNA was isolated using the Qiagen RNeasy kit (#74104) per the manufacturer’s protocol. RNA yield was quantified by Nanodrop and reverse transcribed using the SuperScript IV First-Strand Synthesis System (Invitrogen) per the manufacturer’s protocol. qPCR was performed using PrimeTime qPCR Probe Assays (IDTDNA) in QuantStudio 7 Real-Time PCR System (Thermofisher) and the delta-delta Ct method (2 –∆∆Ct) was used to calculate in Microsoft Excel the relative fold gene expression of samples using ACTB as a control. Primer sequences are tabulated in Supplementary Table 2.

siRNA transfection

For siRNA transfection, cells were seeded at 1 × 10⁵ cells/mL into 6-well plates one day prior to planned transfection. Specific siRNA duplexes targeting POLQ (Qiagen SI00090062) or STING (Santa Cruz sc-92042) were transfected using Lipofectamine RNAiMAX Reagent (Life Technologies) according to the manufacturer’s protocol.

Statistical analyses

Statistical analyses were performed using GraphPad Prism V9 software. All data are represented as mean ± SEM (in vivo) or ±SD (in vitro) calculated unless indicated otherwise. Significance was tested using Student’s t-test for comparison of two sets of measurements, or one-way ANOVA with Tukey post hoc test if all sets analyzed or Sidak post hoc if pairs of sets analyzed, for comparison of three or more sets, unless indicated otherwise.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The data supporting the findings of this study are included in this article and its associated files. Source data are provided with this paper.

Change history

11 December 2023
This article has been retracted. Please see the Retraction Notice for more detail: https://doi.org/10.1038/s41467-023-43803-0

References

Patel, K. J. et al. Involvement of Brca2 in DNA repair. Mol. Cell 1, 347–357 (1998).
Article CAS PubMed Google Scholar
Venkitaraman, A. R. Cancer susceptibility and the functions of BRCA1 and BRCA2. Cell 108, 171–182 (2002).
Article CAS PubMed Google Scholar
Helleday, T., Petermann, E., Lundin, C., Hodgson, B. & Sharma, R. A. DNA repair pathways as targets for cancer therapy. Nat. Rev. Cancer 8, 193–204 (2008).
Article CAS PubMed Google Scholar
Lord, C. J. & Ashworth, A. PARP inhibitors: Synthetic lethality in the clinic. Science 355, 1152–1158 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Zhou, J. et al. A first-in-class polymerase theta inhibitor selectively targets homologous-recombination-deficient tumors. Nat. Cancer 2, 598–610 (2021).
Article CAS PubMed PubMed Central Google Scholar
Zatreanu, D. et al. Polθ inhibitors elicit BRCA-gene synthetic lethality and target PARP inhibitor resistance. Nat. Commun. 12, 3636 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Ceccaldi, R. et al. Homologous-recombination-deficient tumours are dependent on Polθ-mediated repair. Nature 518, 258–262 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Ceccaldi, R., Rondinelli, B. & D’Andrea, A. D. Repair pathway choices and consequences at the double-strand break. Trends Cell Biol. 26, 52–64 (2016).
Article CAS PubMed Google Scholar
Bryant, H. E. et al. Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434, 913–917 (2005).
Article ADS CAS PubMed Google Scholar
Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917–921 (2005).
Article ADS CAS PubMed Google Scholar
Konstantinopoulos, P. A., Ceccaldi, R., Shapiro, G. I. & D’Andrea, A. D. Homologous recombination deficiency: exploiting the fundamental vulnerability of ovarian cancer. Cancer Discov. 5, 1137–1154 (2015).
Article CAS PubMed PubMed Central Google Scholar
Pantelidou, C. et al. PARP inhibitor efficacy depends on CD8+ T-cell recruitment via intratumoral STING pathway activation in BRCA-deficient models of triple-negative breast cancer. Cancer Discov. 9, 722–737 (2019).
Article PubMed PubMed Central Google Scholar
Ding, L. et al. PARP inhibition elicits STING-dependent antitumor immunity in Brca1-deficient ovarian cancer. Cell Rep. 25, 2972–2980.e5 (2018).
Article CAS PubMed PubMed Central Google Scholar
Jiao, S. et al. PARP inhibitor upregulates PD-L1 expression and enhances cancer-associated immunosuppression. Clin. Cancer Res. 23, 3711–3720 (2017).
Article CAS PubMed PubMed Central Google Scholar
Wang, Z. et al. Niraparib activates interferon signaling and potentiates anti-PD-1 antibody efficacy in tumor models. Sci. Rep. 9, 1853 (2019).
Article ADS PubMed PubMed Central Google Scholar
Shima, N. et al. Phenotype-based identification of mouse chromosome instability mutants. Genetics 163, 1031–1040 (2003).
Article CAS PubMed PubMed Central Google Scholar
Gekara, N. O. DNA damage-induced immune response: Micronuclei provide key platform. J. Cell Biol. 216, 2999–3001 (2017).
Article CAS PubMed PubMed Central Google Scholar
Li, J. et al. Depletion of DNA polymerase theta inhibits tumor growth and promotes genome instability through the cGAS-STING-ISG pathway in esophageal squamous cell carcinoma. Cancers (Basel). 13 3204 (2021).
Chatzinikolaou, G., Karakasilioti, I. & Garinis, G. A. DNA damage and innate immunity: links and trade-offs. Trends Immunol. 35, 429–435 (2014).
Article CAS PubMed Google Scholar
Mateos-Gomez, P. A. et al. Mammalian polymerase θ promotes alternative NHEJ and suppresses recombination. Nature 518, 254–257 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Johnson, N. et al. Stabilization of mutant BRCA1 protein confers PARP inhibitor and platinum resistance. Proc. Natl. Acad. Sci. USA 110, 17041–17046 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
McCabe, N. et al. BRCA2-deficient CAPAN-1 cells are extremely sensitive to the inhibition of Poly (ADP-Ribose) polymerase: an issue of potency. Cancer Biol. Ther. 4, 934–936 (2005).
Article CAS PubMed Google Scholar
Li, J. et al. Tumor cell-intrinsic factors underlie heterogeneity of immune cell infiltration and response to immunotherapy. Immunity 49, 178–193.e7 (2018).
Article CAS PubMed PubMed Central Google Scholar
Sen, T. et al. Targeting DNA damage response promotes antitumor immunity through STING-mediated T-cell activation in small cell lung cancer. Cancer Discov. 9, 646–661 (2019).
Article CAS PubMed PubMed Central Google Scholar
Garcia-Diaz, A. et al. Interferon receptor signaling pathways regulating PD-L1 and PD-L2 expression. Cell Rep. 19, 1189–1201 (2017).
Article CAS PubMed PubMed Central Google Scholar
Patel, S. A. & Minn, A. J. Combination cancer therapy with immune checkpoint blockade: mechanisms and strategies. Immunity 48, 417–433 (2018).
Article CAS PubMed PubMed Central Google Scholar
Li, T. & Chen, Z. J. The cGAS-cGAMP-STING pathway connects DNA damage to inflammation, senescence, and cancer. J. Exp. Med. 215, 1287–1299 (2018).
Article CAS PubMed PubMed Central Google Scholar
Corrales, L. et al. Antagonism of the STING pathway via activation of the AIM2 inflammasome by intracellular DNA. J. Immunol 196, 3191–3198 (2016).
Article CAS PubMed Google Scholar
Ishikawa, H., Ma, Z. & Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 461, 788–792 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Sun, L., Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786–791 (2013).
Article ADS CAS PubMed Google Scholar
Sukerkar, P. A. et al. Synthesis and biological evaluation of water-soluble progesterone-conjugated probes for magnetic resonance imaging of hormone related cancers. Bioconjug. Chem. 22, 2304–2316 (2011).
Article CAS PubMed PubMed Central Google Scholar
Barber, G. N. STING: infection, inflammation and cancer. Nat. Rev. Immunol. 15, 760–770 (2015).
Article CAS PubMed PubMed Central Google Scholar
Sozzani, S. et al. Migration of dendritic cells in response to formyl peptides, C5a, and a distinct set of chemokines. J. Immunol 155, 3292–3295 (1995).
Article CAS PubMed Google Scholar
Llorens-Agost, M. et al. POLθ-mediated end joining is restricted by RAD52 and BRCA2 until the onset of mitosis. Nat. Cell Biol. 23, 1095–1104 (2021).
Article CAS PubMed PubMed Central Google Scholar
Harding, S. M. et al. Mitotic progression following DNA damage enables pattern recognition within micronuclei. Nature 548, 466–470 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Kumar, R. J. et al. Dual inhibition of DNA-PK and DNA polymerase theta overcomes radiation resistance induced by p53 deficiency. NAR Cancer 2, zcaa038 (2020).
Article PubMed PubMed Central Google Scholar
Patterson-Fortin, J. et al. Targeting DNA repair with combined inhibition of NHEJ and MMEJ induces synthetic lethality in TP53-mutant cancers. Cancer Res. https://doi.org/10.1158/0008-5472.CAN-22-1124 (2022).
Pantelidou, C. et al. STING agonism enhances anti-tumor immune responses and therapeutic efficacy of PARP inhibition in BRCA-associated breast cancer. NPJ Breast Cancer 8, 102 (2022).
Article CAS PubMed PubMed Central Google Scholar
Mehta, A. K. et al. Targeting immunosuppressive macrophages overcomes PARP inhibitor resistance in BRCA1-associated triple-negative breast cancer. Nat. Cancer 2, 66–82 (2021).
Article CAS PubMed Google Scholar
Wang, Q. et al. STING agonism reprograms tumor-associated macrophages and overcomes resistance to PARP inhibition in BRCA1-deficient models of breast cancer. Nat. Commun. 13, 3022 (2022).
Article ADS PubMed PubMed Central Google Scholar
Domchek, S. M. et al. Olaparib and durvalumab in patients with germline BRCA-mutated metastatic breast cancer (MEDIOLA): an open-label, multicentre, phase 1/2, basket study. Lancet. Oncol. 21, 1155–1164 (2020).
Article CAS PubMed Google Scholar
Mehta, A. K., Kadel, S., Townsend, M. G., Oliwa, M. & Guerriero, J. L. Macrophage biology and mechanisms of immune suppression in breast cancer. Front. Immunol. 12, 643771 (2021).
Article CAS PubMed PubMed Central Google Scholar
Zitvogel, L., Galluzzi, L., Kepp, O., Smyth, M. J. & Kroemer, G. Type I interferons in anticancer immunity. Nat. Rev. Immunol. 15, 405–414 (2015).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This research was supported by R01 CA272982 (G.I.S.), the Dana-Farber/Harvard Cancer Center (DF/HCC) Specialized Program of Research Excellence (SPORE) in Gastrointestinal (GI) Cancer, P50 CA127003 (B.M.W., A.J.A., A.D.D., G.I.S.), a GI SPORE Developmental Research Project (J.P.-F., A.D.D.), a Lustgarten Foundation/Stand Up To Cancer Pancreatic Cancer Challenge grant (J.M.C., A.D.D.), the Breast Cancer Research Foundation (A.D.D.), the Ludwig Center at Harvard (A.D.D., G.I.S.), the Smith Family Foundation (A.D.D.), the DF/HCC SPORE in Breast Cancer, P50 CA186504 (J.L.G., G.M.W., G.I.S.), and a Wong Family Award in Translational Oncology (J.P.-F, A.D.D). Additionally, J.P.-F. is supported by a Doris Duke Charitable Foundation Physician Scientist Fellowship (2021087). We thank Dana-Farber Cancer Institute for use of the Flow Cytometry Core, which provided flow cytometry services, and Dana-Farber/Harvard Cancer Center (DF/HCC) for the use of the Specialized Histopathology Core, which provided histology and immunohistochemistry services. DF/HCC is supported in part by NCI Cancer Center Support Grant NIH P30 CA 006516.

Author information

Constantia Pantelidou
Present address: Bayer Pharmaceuticals, Cambridge, MA, USA
Carter Grochala
Present address: Arpeggio, Boulder, CO, USA
Anita K. Mehta
Present address: Sanofi, Cambridge, MA, USA

Authors and Affiliations

Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, 02215, USA
Jeffrey Patterson-Fortin, Heta Jadhav, Constantia Pantelidou, Brian M. Wolpin, Andrew J. Aguirre, James M. Cleary & Geoffrey I. Shapiro
Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA, 02115, USA
Jeffrey Patterson-Fortin, Brian M. Wolpin, Andrew J. Aguirre, James M. Cleary & Geoffrey I. Shapiro
Department of Radiation Oncology, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA, 02215, USA
Tin Phan, Carter Grochala & Alan D. D’Andrea
Department of Surgical Oncology and Harvard Medical School, Brigham and Women’s Hospital, Boston, MA, 02115, USA
Anita K. Mehta & Jennifer L. Guerriero
Department of Medicine, Division of Hematology-Oncology, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA, 02215, USA
Gerburg M. Wulf
Hale Family Center for Pancreatic Cancer Research, Dana-Farber Cancer Institute, Boston, MA, 02215, USA
Brian M. Wolpin, Andrew J. Aguirre & James M. Cleary
Department of Medicine, Division of Gastroenterology, Abramson Family Cancer Research Institute, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA, 19104, USA
Ben Z. Stanger
Center for DNA Damage and Repair, Dana-Farber Cancer Institute, Boston, MA, 02215, USA
Alan D. D’Andrea & Geoffrey I. Shapiro

Authors

Jeffrey Patterson-Fortin
View author publications
You can also search for this author in PubMed Google Scholar
Heta Jadhav
View author publications
You can also search for this author in PubMed Google Scholar
Constantia Pantelidou
View author publications
You can also search for this author in PubMed Google Scholar
Tin Phan
View author publications
You can also search for this author in PubMed Google Scholar
Carter Grochala
View author publications
You can also search for this author in PubMed Google Scholar
Anita K. Mehta
View author publications
You can also search for this author in PubMed Google Scholar
Jennifer L. Guerriero
View author publications
You can also search for this author in PubMed Google Scholar
Gerburg M. Wulf
View author publications
You can also search for this author in PubMed Google Scholar
Brian M. Wolpin
View author publications
You can also search for this author in PubMed Google Scholar
Ben Z. Stanger
View author publications
You can also search for this author in PubMed Google Scholar
Andrew J. Aguirre
View author publications
You can also search for this author in PubMed Google Scholar
James M. Cleary
View author publications
You can also search for this author in PubMed Google Scholar
Alan D. D’Andrea
View author publications
You can also search for this author in PubMed Google Scholar
Geoffrey I. Shapiro
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

J.P.-F., H.J., A.D.D., and G.I.S. designed experiments. J.P.-F., H.J., T.P., and C.G., performed experiments and contributed to data acquisition. J.P.-F., H.J., C.P., A.K.M, J.L.G, A.D.D., and G.I.S. analyzed and interpreted data. G.M.W. and B.Z.S. generated mouse models used in this work. B.M.W., A.J.A., and J.M.C. contributed important intellectual content. J.P.-F. and G.I.S. drafted the paper and the remainder of the authors participated in revising it critically. All authors read and agreed on the final version of the submitted manuscript and are accountable for all aspects of the work.

Corresponding author

Correspondence to Geoffrey I. Shapiro.

Ethics declarations

Competing interests

J.L.G. is a consultant for Glaxo-Smith Kline (GSK), Codagenix, Verseau Therapeutics, Kymera, Kowa, Duke Street Bio., and Array BioPharma and receives sponsored research support from GSK, Array BioPharma, Merck and Eli Lilly. G.M.W. reports research funding from Merck & Co, institutional funding from Glaxo Smith Kline and Genentech, and US patent 20090258352, “A1 Pin1 as a marker for abnormal l cell growth,” licensed to Cell Signaling and R&D Systems. B.M.W. receives Research support from Celgene, Eli Lilly, Novartis, and Revolution Medicine; Consulting for Celgene, GRAIL, and Mirati. A.J.A. has consulted for Oncorus, Inc., Arrakis Therapeutics, Syros Pharmaceuticals, Boehringer Ingelheim, T-knife Therapeutics, AstraZeneca, Mirati Therapeutics, Revolution Medicines, Anji Pharmaceuticals, and Merck & Co., Inc. A.J.A. consults for and holds equity in Riva Therapeutics. A.J.A. has research funding from Mirati Therapeutics, Syros Pharmaceuticals, Bristol Myers Squibb, Revolution Medicines, Novartis, Novo Ventures and Deerfield, Inc. J.M.C. receives research funding to his institution from Merus, Roche, and Bristol Myers Squibb. He receives research support from Merck, AstraZeneca, Esperas Pharma, Bayer, Tesaro, Arcus Biosciences, and Apexigen; he received honoraria for being on advisory boards of Syros Pharmaceuticals, Incyte, and Blueprint Medicines. A.D.D. reports consulting for AstraZeneca, Bayer AG, Blacksmith/Lightstone Ventures, Bristol Myers Squibb, Cyteir Therapeutics, EMD Serono, Impact Therapeutics, PrimeFour Therapeutics, Pfizer, Tango Therapeutics, and Zentalis Pharmaceuticals/Zeno Management; is an Advisory Board member for Cyteir, and Impact Therapeutics; stockholder in Cedilla Therapeutics, Cyteir, Impact Therapeutics, and PrimeFour Therapeutics; and reports receiving commercial research grants from Bristol Myers Squibb, EMD Serono, Moderna, and Tango Therapeutics. G.I.S. has received research funding from Eli Lilly, Merck KGaA/EMD-Serono, Merck & Co., and Pfizer. He has served on advisory boards for Pfizer, Eli Lilly, Merck KGaA/EMD-Serono, Bicycle Therapeutics, Fusion Pharmaceuticals, Cybrexa Therapeutics, Bayer, Boehringer Ingelheim, ImmunoMet, Artios, Atrin, Concarlo Holdings, Syros, Zentalis, CytomX Therapeutics, Blueprint Medicines, Kymera Therapeutics, Janssen and Xinthera. In addition, he holds a patent entitled, “Dosage regimen for sapacitabine and seliciclib,” also issued to Cyclacel Pharmaceuticals, and a pending patent, entitled, “Compositions and Methods for Predicting Response and Resistance to CDK4/6 Inhibition,” together with Liam Cornell. The remaining authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Tomasz Skorski, Quentin Liu and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer review reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This article has been retracted. Please see the retraction notice for more detail:https://doi.org/10.1038/s41467-023-43803-0

Supplementary information

Supplementary Information

Reporting Summary

Peer Review File

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

About this article

Cite this article

Patterson-Fortin, J., Jadhav, H., Pantelidou, C. et al. RETRACTED ARTICLE: Polymerase θ inhibition activates the cGAS-STING pathway and cooperates with immune checkpoint blockade in models of BRCA-deficient cancer. Nat Commun 14, 1390 (2023). https://doi.org/10.1038/s41467-023-37096-6

Download citation

Received: 27 September 2022
Accepted: 02 March 2023
Published: 13 March 2023
DOI: https://doi.org/10.1038/s41467-023-37096-6

This article is cited by

When DNA-damage responses meet innate and adaptive immunity
- Jie Tong
- Jiangwei Song
- Chunfu Zheng
Cellular and Molecular Life Sciences (2024)
Gene polymorphisms of molecules of the cGAS-STING signalling pathway are associated with AML in Chinese patients
- Yuechan Ma
- Dongmei Wang
- Jingjing Ye
Holistic Integrative Oncology (2024)
Genetic separation of Brca1 functions reveal mutation-dependent Polθ vulnerabilities
- John J. Krais
- David J. Glass
- Neil Johnson
Nature Communications (2023)
CDC7 inhibition induces replication stress-mediated aneuploid cells with an inflammatory phenotype sensitizing tumors to immune checkpoint blockade
- Tomoko Yamamori Morita
- Jie Yu
- Akihiro Ohashi
Nature Communications (2023)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.