Abstract
Mitochondria generate ATP and play regulatory roles in various cellular activities. Cancer cells often exhibit fragmented mitochondria. However, the underlying mechanism remains elusive. Here we report that a mitochondrial protein FUN14 domain containing 2 (FUNDC2) is transcriptionally upregulated in primary mouse liver tumors, and in approximately 40% of human hepatocellular carcinoma (HCC). Importantly, elevated FUNDC2 expression inversely correlates with patient survival, and its knockdown inhibits liver tumorigenesis in mice. Mechanistically, the amino-terminal region of FUNDC2 interacts with the GTPase domain of mitofusin 1 (MFN1), thus inhibits its activity in promoting fusion of outer mitochondrial membrane. As a result, loss of FUNDC2 leads to mitochondrial elongation, decreased mitochondrial respiration, and reprogrammed cellular metabolism. These results identified a mechanism of mitochondrial fragmentation in cancer through MFN1 inhibition by FUNDC2, and suggested FUNDC2 as a potential therapeutic target of HCC.
Similar content being viewed by others
Introduction
Mitochondria are double-membrane organelles playing essential cellular functions. Besides being major sites of chemical energy production, they are also important for many cellular processes, such as biosynthesis, cell death, and innate immunity1,2,3. It is thus unsurprising that mitochondrial dysfunctions are involved in many diseases such as metabolic disorders, neurodegenerative diseases, and cancer4,5. Mitochondria exist as a dynamic network that constantly change morphology to maintain organelle homeostasis, and to adapt organelle functions to the extracellular environment. Mitochondrial dynamics include the movement of mitochondria along the cytoskeleton, alteration of the internal mitochondrial architecture, and connectivity mediated by fusion and fission events. Mitochondrial fusion and fission, which are relevant to mitochondrial quality control, respiration, apoptosis, and Ca2+ homeostasis, are catalyzed by a range of proteins, especially dynamin-like GTPases. For example, mitofusin 1 and 2 (MFN1 and MFN2) trans associate to promote tethering and fusion of the outer mitochondrial membrane (OMM) in a GTPase-dependent manner6,7. Optic atrophy 1 (OPA1) is another GTPase that localizes at the inner membrane and plays an essential role in fusion of inner mitochondrial membrane (IMM)8. On the other hand, dynamin-related protein 1 (DRP1) is recruited into ring-like structures at the point of future fission through association with Fission 1 homolog protein (FIS1) and mitochondrial fission factor (MFF) to sever mitochondrial membranes through GTP hydrolysis9,10. Alternatively, FIS1 may promote mitochondrial fragmentation by inhibiting MFN1/2 and OPA111. Functional significance of mitochondrial dynamics has been highlighted by genetic studies in mice demonstrating embryonic lethality upon ablation of mitochondrial fusion and fission proteins12,13.
As the cellular power house, dysregulation of mitochondria in cancer was observed for a long time. Otto Warburg had concluded that cancer cells rely on glycolysis, and mitochondria are inactivated14. However, extensive research in the last decade demonstrated that most cancer cells not only maintain active mitochondria, but also derive a significant fraction of their ATP through oxidative phosphorylation15. In fact, an RNA interference screen had identified mitochondrial oxidative phosphorylation as the major pathway required for optimal proliferation of cancer cells in low glucose condition as that found in the tumor microenvironment16. Furthermore, mitochondria synthesize anabolic precursors to support rapid cell proliferation. However, cancer cells often exhibit fragmented mitochondria, as that found in lung cancer, breast cancer, and glioblastoma17,18,19,20. Enhanced fission or reduced fusion was linked to such a phenotype, and reversal of the phenotype by inhibition of DRP1 or overexpression of MFN2 promotes cell cycle arrest and apoptosis21. Mitochondrial fragmentation may promote tumorigenesis through cellular protection by isolating damaged mitochondrial portions, thus preventing catastrophe and cell death22. In addition, mitochondrial fragmentation was also associated with increased production of reactive oxygen species (ROS), which is a potent driver of cancer initiation, although it may have complicate roles in later stages of tumorigenesis23. Despite these findings, the mechanism of mitochondria fragmentation in cancer was not yet clear.
Physiological roles of mitochondrial dynamics in the liver were revealed by liver-specific conditional knockout mice. Livers of MFN1 conditional knockout mice displayed a highly fragmented mitochondrial network, accompanied by enhanced respiration capacity, and biased use of lipid as the main energy source24. The mice were thus protected against insulin resistance induced by high-fat diet. Primary liver cancer (PLC) is one of the most common human malignancies and third leading cause of cancer-related mortality worldwide25. Hepatocellular carcinoma (HCC), the most common form of PLC, has very limited systematic therapies, and new strategies are urgently in need. Previous studies have revealed shorter mitochondrial length in HCC tissues compared to adjacent nontumor tissues23. Tissue culture and tumor xenograft studies have suggested that mitochondrial fragmentation in HCC cells plays a key role in cell proliferation and migration23,26. However, the mechanism of dysregulated mitochondrial dynamics, and its functional roles in primary tumors are still lacking.
In this work, we systematically screened dysregulated mitochondrial proteins in HCC, and identified FUNDC2 as an elevated protein associated with poor prognosis. We demonstrated an important role of FUNDC2 in mitochondrial fragmentation by inhibiting MFN1 through physical interaction with the GTPase domain. Furthermore, reversal of mitochondrial fragmentation by FUNDC2 knockdown reduces tumor energy level, reprograms cancer metabolism, and suppresses primary liver tumors in an MFN1-dependent manner in vivo.
Results
Elevated FUNDC2 correlated with poor survival in HCC
To systematically study dysregulated expression of mitochondrial proteins in HCC, we analyzed 1136 mitochondrial proteins from MitoCarta 3.027, a database of mitochondrial proteome. Transcriptional levels were examined in The Cancer Genome Atlas (TCGA) cohort of human HCC, and 267 genes were significantly upregulated in tumors (fold change > 2, p < 0.0001) (Fig. 1a). In order to facilitate functional studies in vivo, we examined the expression of these genes in a mouse model of primary liver tumor generated by in situ genome editing of hepatocytes28,29,30. Hydrodynamic force was generated by pressurized injection of solution into the tail vein to breach endothelium and closely associated hepatocytic plasma membrane, such that transposon plasmids were delivered into hepatocytes. Liver tumors were induced within 2–3 months after injection by transposon-mediated integration and expression of oncogenes MYC and RAS (Fig. 1b, c). Immunohistochemistry (IHC) staining of the epitope tag confirmed expression of oncogenes in tumors (Fig. 1c), and histopathological analysis revealed features of steatohepatitic HCC as previously reported31 (Supplementary Fig. 1a). Transcriptome of tumors was profiled by RNA-seq, and filtering of dysregulated genes in MYC + RAS-induced mouse liver tumors identified 5 genes upregulated more than 5-fold (p < 0.05) (Fig. 1a). Among them, MTHFD1L and GLS have been reported to be tumor-promoting in HCC32,33. However, Kaplan–Meier analysis demonstrated that elevated expression of FUNDC2 and PRELID2 were most significantly associated with short survival of patients (Fig. 1d, Supplementary Fig. 1b–d).
Elevated mRNA levels of FUNDC2 and PRELID2 in HCC were validated in an independent cohort of HCC34 (Fig. 1e). Furthermore, pairwise comparison of tumor and para-tumor tissues revealed elevated FUNDC2 protein levels in 22 out of 54 HCC samples (Fig. 1f). However, a qualified antibody for detection of endogenous PRELID2 could not be validated. Taken together, screening of genes encoding mitochondrial proteins identified overexpression of FUNDC2 and PRELID2 in HCC, which negatively correlated with patient survival.
Knockdown of FUNDC2 suppresses liver tumorigenesis in mice
In order to determine the functional roles of upregulated FUNDC2 and PRELID2 in liver tumorigenesis, we first confirmed their expression levels in MYC + RAS mouse liver tumors by quantitative RT-PCR (Fig. 2a). Elevated protein level of FUNDC2 was also visualized by IHC on liver sections (Fig. 2b). We then designed a multiplexed genome editing strategy, in which FUNDC2- or PRELID2-specific shRNAs were expressed simultaneously with MYC (Fig. 2c, Supplementary Fig. 2a). Knockdown of FUNDC2 markedly suppressed tumorigenesis (Fig. 2d, e). Importantly, re-expression of FUNDC2 rescued tumorigenesis, indicating tumor suppression was due to specific ablation of FUNDC2 (Fig. 2d, e). However, knockdown of PRELID2 did not affect tumorigenesis (Fig. 2f, g). Knockdown and re-expression of FUNDC2 and PRELID2 in tumors were confirmed by quantitative RT-PCR (Supplementary Fig. 2b).
We further examined histopathological alterations induced by knockdown of FUNDC2. Markedly enhanced steatohepatitic features were revealed by hematoxylin and eosin (HE) staining in FUNDC2 knockdown tumors, which was confirmed by oil red staining of lipid droplets (Fig. 2h, i), suggesting dysregulated metabolism. Cell proliferation was evaluated by staining of Ki67. However, Ki67+ proliferating hepatocytes were comparable between FUNDC2 knockdown and control tumors (Fig. 2h, j). Nevertheless, the level of AFP, which is a biomarker of HCC aggressiveness, was markedly reduced by FUNDC2 knockdown (Fig. 2h, k). Taken together, knockdown of FUNDC2 altered tumor cell metabolism and suppressed liver tumorigenesis in mice.
FUNDC2 regulates mitochondrial structure and function
We next investigated how might FUNDC2 promote tumorigenesis. It was reported that FUNDC2 localize to the ΟΜΜ35. We confirmed the mitochondrial localization of FUNDC2 in mouse liver tumors by multiplexed IHC (Fig. 3a). To further study the mitochondrial function of FUNDC2, we generated FUNDC2 knockdown and re-expressing Huh-7 HCC cells (Supplementary Fig. 3a). Consistent with the pro-tumor roles of FUNDC2 in vivo, knockdown of FUNDC2 markedly reduced cellular colony formation on soft agar (Fig. 3b, Supplementary Fig. 3b). However, we found that mitochondrial mass, mitochondrial membrane potential, or cellular ROS levels were not affected by FUNDC2 knockdown (Supplementary Fig. 3c–f). Nevertheless, electron microscopy revealed that mitochondrial length was significantly longer in FUNDC2 knockdown cells, and was rescued by re-introduction of FUNDC2 (Fig. 3c, d). In MYC + RAS tumors, mitochondria were also fragmented, and abnormal swollen cristae could be observed (Fig. 3e, f). These defects were rescued by knockdown of FUNDC2, and were induced again by restoration of FUNDC2 expression (Fig. 3e, f). Thus, FUNDC2 plays an important role in mitochondrial fragmentation in tumors.
To determine the effect of FUNDC2 knockdown on mitochondrial function, we measured oxygen consumption rates (OCR) by seahorse analysis. The results indicate that both basal and maximal respiration were reduced by FUNDC2 knockdown, and were rescued by re-expression of FUNDC2 (Fig. 3g, Supplementary Fig. 3g). A similar effect of FUNDC2 knockdown on mitochondrial respiration was also observed in the HepG2 cell line (Supplementary Fig. 3h–j). By measuring extracellular acidification rates (ECAR), we found that glycolysis was also reduced by FUNDC2 knockdown (Fig. 3h, Supplementary Fig. 3k), excluding a switch from mitochondrial respiration to glycolysis by FUNDC2 knockdown. It should be noted that glucose uptake was not inhibited by FUNDC2 knockdown (Supplementary Fig. 3l). Consistently, knockdown of FUNDC2 reduced cellular ATP level, which could also be rescued by re-introduced FUNDC2 (Fig. 3i). We further generated primary culture of MYC + RAS liver tumor cells (Supplementary Fig. 4a). Cellular identity was confirmed by expression of oncogenes (Supplementary Fig. 4b, c). FUNDC2 knockdown and re-expression again inhibited and rescued mitochondrial respiration (Supplementary Fig. 4d, e), and resulted in respective changes of cellular energy level (Supplementary Fig. 4f).
By MS-based targeted metabolomics, we found that metabolites of the TCA cycle and glycolysis were decreased by FUNDC2 knockdown in tumors (Fig. 3j, Supplementary Data 1). Importantly, these metabolites could be used for macromolecular biosynthesis, thus were believed to play important roles in supporting cancer cell growth. In contrast, purine and pyrimidine metabolites were increased. Metabolism of amino acids was both increased and decreased by FUNDC2 knockdown. Since accumulation of lipid droplets was observed in FUNDC2 knockdown tumors, we also carried out MS-based lipidomics, and confirmed accumulation of lipids commonly found in lipid droplets, including triglycerides, diglycerides, cholesteryl esters, and sterols (Fig. 3k, Supplementary Data 2). However, phospholipids which play critical roles in membrane formation and lipid signals fueling cell proliferation and malignancy36, were greatly reduced by knockdown of FUNDC2. Taken together, elevated FUNDC2 plays important roles in energy production and metabolic reprogramming in tumor cells.
FUNDC2 interacts with MFN1
To determine the mechanism by which FUNDC2 regulates mitochondrial dynamics and function, we profiled FUNDC2-interacting proteins in Huh-7 cells by tandem affinity purification. Mass spectrometry (MS) revealed that about 17% of proteins co-purified with FUNDC2 were mitochondrial proteins, including MFN1 and MFN2, which are dynamin-related GTPases mediating fusion of OMM (Fig. 4a). Due to the observation that FUNDC2 regulates mitochondrial dynamics, we focused on MFN1/2. Immunoprecipitation confirmed the interaction between FUNDC2 and MFN1/2 on both ectopic and endogenous expression levels (Fig. 4b, c).
We further mapped protein sequences mediating the interaction between FUNDC2 and MFN1. FUNDC2 has its amino (N)- and carboxyl (C)-terminals exposed to the cytosol with two tandem transmembrane (TM) regions in between35. Truncation mutants were made according to this arrangement (Fig. 4d). Co-immunoprecipitation experiments indicated that peptide 1–127 with deletion of the C-terminal cytosolic region retained interaction with MFN1 (Fig. 4e). However, neither the N-terminal, C-terminal, nor TM regions alone could interact with MFN1. We postulated that the TM regions may be important for OMM localization of FUNDC2, thus facilitating interaction of the N-terminal with MFN1. Indeed, addition of the TM regions resulted in mitochondrial localization of the N-terminal fragment, which was by itself diffusive in cytosol (Supplementary Fig. 5a). MFN1 also has two tandem TM regions with both ends exposing to the cytosol37. The larger N-terminal fragment contains a GTPase domain (Fig. 4d). Co-immunoprecipitation experiments indicated that a mutant (1–336) largely comprising the GTPase domain, and another mutant (1–584) extending more to the C-terminal could interact with FUNDC2 (Fig. 4f). It should be noted that these two mutants were cytosolic likely due to lacking of the TM regions (Supplementary Fig. 5b). Two other mutants lacking the GTPase domain could not interact with FUNDC2, although they were mitochondria-localized (Fig. 4f, Supplementary Fig. 5b). Importantly, the GTPase domain of MFN1 (1–336) could also interact with FUNDC2 1–127, indicating a direct interaction of the two regions (Fig. 4g). We next asked whether the GTPase activity of MFN1 is playing a role in interaction with FUNDC2. K88T, K222Q, and W239A mutations were reported to impair MFN1 GTPase activity6,38,39. Interestingly, interactions of these mutants, especially W239A, with FUNDC2 were largely reduced (Fig. 4h). Taken together, FUNDC2 is a partner of MFN1 interacting with its GTPase domain.
FUNDC2 inhibits GTPase activity of MFN1
Hydrolysis of GTP is critical for MFN1 trans association and tethering of OMM for fusion6. Interestingly, by an in vitro GTPase activity assay, the activity of MFN1, but not MFN2, was inhibited by co-expression of FUNDC2 (Fig. 5a). Furthermore, GTP loading of endogenous MFN1 was monitored by pulldown assay using GTP-agarose beads, which indicated that expression of FUNDC2 attenuated GTP-binding of MFN1, but not MFN2 (Fig. 5b, Supplementary Fig. 6a). Consistently, knockdown of FUNDC2 increased GTP-binding of endogenous MFN1 but not MFN2 in Huh-7 and HepG2 cells, which could be normalized by re-expression of FUNDC2 (Fig. 5c, Supplementary Fig. 6b). These data suggest that although MFN1 and MFN2 are homologous proteins both interacting with FUNDC2, they could be differentially regulated by FUNDC2.
We further asked whether FUNDC2 regulates GTP-loading of MFN1 in mouse liver tumors. GTP pulldown assay was performed using tumor lysates. While there were some variations in MFN1/2 expression levels in MYC + RAS tumors, GTP-binding of MFN1 was clearly enhanced by knockdown of FUNDC2, and repressed by restoration of FUNDC2 (Fig. 5d). In order to determine whether FUNDC2 suppresses MFN1 GTP-binding in human HCC, we first profiled the expression of FUNDC2 in 20 HCC samples by quantitative RT-PCR (Supplementary Fig. 6c). The top and bottom five samples were subjected to GTP pulldown assay. While slightly higher expression of MFN1 could be observed in FUNDC2-high tumors, the GTP-binding of MFN1 was clearly lower than FUNDC2-low tumors (Fig. 5e). Furthermore, co-immunoprecipitation experiments indicated that trans association of MFN1 could be suppressed by co-expression of FUNDC2 (Fig. 5f). Taken together, FUNDC2 inhibits the GTPase activity and trans association of MFN1.
FUNDC2 regulates mitochondrial dynamics by inhibiting MFN1
In order to determine the functional roles of MFN1 in regulation of mitochondria by FUNDC2, we generated MFN1 or MFN2 knockout Huh-7 cells by CRISPR/Cas9, which was confirmed by western blotting for MFN1 or MFN2 expression (Supplementary Fig. 7a). Cells were further infected for re-expression of MFN1 and knockdown of FUNDC2 (Supplementary Fig. 7a). Colony formation assay indicated that knockout of MFN1 but not MFN2 eliminated the effect of FUNDC2 knockdown on reducing colony formation (Fig. 6a, Supplementary Fig. 7b). Furthermore, re-expression of wild type, but not the W239A mutant of MFN1 restored suppression of colony formation by FUNDC2 knockdown. Consistently, Mitotracker staining revealed a requirement of wild-type MFN1, but not MFN2 for the presence of elongated mitochondria by FUNDC2 knockdown (Fig. 6b). MFN2 has a key role in tethering mitochondria to endoplasmic reticulum (ER), and impaired tethering could result in ER stress40. We thus quantified mitochondria associated ER-membranes (MAM) in tumors, and found that the percentage of MAM to mitochondria perimeter was not affected by FUNDC2 knockdown (Supplementary Fig. 7c). In addition, knockdown of FUNDC2 in Huh-7 cells or tumors did not induce ER stress as indicated by phosphorylation level of PERK, protein level of Bip, and protein level of ATF4 (Supplementary Fig. 7d, e).
The function of MFN1 downstream of FUNDC2 was further confirmed by a FUNDC2/MFN1 double knockdown Huh-7 cell line (Supplementary Fig. 8a). By electron microscopy, mitochondrial elongation caused by FUNDC2 knockdown was largely rescued by further knockdown of MFN1 (Fig. 6c, d). Importantly, knockdown of MFN1 blocked reduction of cellular ATP level by FUNDC2 knockdown (Fig. 6e). We thus asked whether regulation of cellular metabolism by FUNDC2 also depends on MFN1. Seahorse analysis indicated that in MFN1 knockout cells, shFUNDC2 could no longer reduce mitochondrial respiration, and MFN1 wild type but not the W239A mutant could rescue the effect (Fig. 6f, Supplementary Fig. 8b). Similar observations were also made in the HepG2 cell line by double knockdown of FUNDC2/MFN1 (Supplementary Fig. 8c, d). However, in MFN2 knockout cells, FUNDC2 regulated mitochondrial respiration normally (Supplementary Fig. 8e). By measuring ECAR, the regulation of glycolysis by FUNDC2 was also found depending on MFN1 (Fig. 6g, Supplementary Fig. 8f). Since it was reported that liver-specific knockout of MFN1 promotes the use of lipids as energy source24, we also measured mitochondrial respiration when palmitate was used as energy source. Surprisingly, FUNDC2 knockdown also reduced palmitate oxidation, which was rescued by MFN1 knockout (Fig. 6h, Supplementary Fig. 8g). This result is in consistent with the accumulation of lipid droplets in FUNDC2 knockdown tumor cells. Taken together, inhibition of MFN1 is playing a critical role downstream of FUNDC2 in regulating mitochondrial fragmentation and respiration in tumor cells.
FUNDC2 regulates metabolism by inhibiting MFN1
To determine whether metabolic reprogramming downstream of FUNDC2 is also due to MFN1, we carried out MS-based targeted metabolomics comparing control and MFN1 knockout cells. Consistent with findings by Seahorse analysis, metabolites of the TCA cycle and glycolysis were increased by knockout of MFN1 (Fig. 7a, b, Supplementary Data 3). In contrast, pathways increased by shFUNDC2, including purine metabolism were decreased by further knockout of MFN1 (Fig. 7a, c). In order to determine how knockdown of FUNDC2 perturbs glucose flux, cells were grown in 13C6-glucose tracer, and incorporation of the label was analyzed by MS. Within 24 hours of tracing, FUNDC2 knockdown cells had lower levels of M + 3 glyceraldehyde-3-phosphate, M + 3 phosphoenolpyruvate, M + 3 pyruvate and M + 3 lactate, indicating reduced glycolytic flow to lactate (Fig. 7d, e). Examining the isotopomer distribution of TCA cycle intermediates, we found a significant reduction in M + 2 citrate, M + 2 α-ketoglutarate, M + 2 fumarate, and M + 2 malate derived from 13C6-glucose (Fig. 7f). This was in addition to an overall reduction of citrate, a-ketoglutarate, fumarate, and malate isotopomers in FUNDC2 knockdown cells (Fig. 7f). The pentose phosphate pathway (PPP), which branches from glycolysis (Fig. 7d), is required for the synthesis of ribonucleotides, and is a major source of NADPH for the synthesis of fatty acids and the scavenging of ROS41. Interestingly, a significant increase in M + 6 6-phosphogluconate and M + 5 ribose-5-phosphate derived from 13C6-glucose was observed in FUNDC2 knockdown cells (Fig. 7g), indicating diversion of glucose to PPP. However, M + 7 sedoheptulose-7-phosphate in the revisable non-oxidative phase of PPP was reduced, suggesting that PPP was diverted to synthesize pentose phosphate from fructose-6-phosphate rather than synthesize fructose-6-phosphate from pentose phosphate (Fig. 7g). Importantly, all the above phenotypes induced by FUNDC2 knockdown were rescued by knockout of MFN1 (Fig. 7e–g).
In addition to accumulation of lipids in FUNDC2 knockdown cells, targeted metabolomics revealed reduced acetylcarnitine, an indicator of mitochondrial β-oxidation. To examine changes in FAO, we fed cells with 13C16-palmitate that is channeled into the mitochondria for FAO by a carrier palmitoylcarnitine (Fig. 7d). The TCA cycle intermediates showed an overall reduction in M + 2 isotopomers, which was rescued by MFN1 knockout (Fig. 7h). These results confirmed that FUNDC2 promotes FAO by inhibiting MFN1. Taken together, MFN1 is a critical downstream effector of FUNDC2 in reprogramming glucose and lipid metabolism in tumor cells.
FUNDC2 promotes liver tumorigenesis via inhibition of MFN1
If inhibition of MFN1 is a key mechanism of tumor promotion by FUNDC2, overexpression of MFN1 should suppress tumorigenesis similar to FUNDC2 knockdown. Indeed, co-expression of MFN1 with MYC + RAS strongly suppressed tumorigenesis (Supplementary Fig. 9a–c). More importantly, by multiplexed genome editing, knockdown of MFN1 abolished the tumor-suppressive function of shFUNDC2 (Fig. 8a–c). Further co-expression of MFN1 wild type, but not the W239A mutant rescued the tumor-suppressive function of shFUNDC2. Successful knockdown and rescue expression of FUNDC2 and MFN1 was demonstrated by quantitative RT-PCR (Supplementary Fig. 9d, e). Histopathological analysis indicated that lipid accumulation in tumors induced by FUNDC2 knockdown was also MFN1-dependent (Fig. 8d, e). In addition, expression of AFP on protein and mRNA levels was also suppressed by FUNDC2 knockdown in an MFN1-dependent manner (Fig. 8d, f). Thus, inhibition of MFN1 by FUNDC2 plays a critical role in liver tumorigenesis.
Consistent with reduced cellular ATP level upon FUNDC2 knockdown in tissue culture, we found that energy level was maintained or even higher in liver tumors, but was significantly reduced by FUNDC2 knockdown, as indicated by phosphorylated Acetyl-CoA carboxylase (ACC), a marker of energy deficiency (Fig. 8g). Furthermore, measuring of ATP level in human HCC also indicated higher energy level in FUNDC2-high tumors (Fig. 8h). Taken together, elevated expression of FUNDC2 in liver tumors not only plays an important role in mitochondrial fragmentation, but also promotes energy production to meet the demand of tumors.
Discussion
Reprogramming of cellular metabolism is a hallmark of cancer15. However, the importance of mitochondrial dysfunction in cancer was overlooked until the finding that depletion of mitochondrial DNA reduced tumorigenic potential of cancer cells42,43. Reprogrammed mitochondrial functions support tumorigenesis in many ways. For instance, oncogenic signaling promotes the use of intermediates from the TCA cycle to generate anabolic precursors for synthesis of fatty acids and nonessential amino acids44,45,46. Excessive electron transport flux was also found in cancer cells that not only produces ATP, but also results in formation of ROS, which plays multiple roles during tumorigenesis47,48. These abnormalities of mitochondria are intimately related to dysregulated mitochondrial dynamics, such that fragmented mitochondria were often found in cancer cells. Downregulation of MFN2 or elevation of DRP1 expression was found to contribute to this phenotype in lung, breast, and other cancers49,50. Furthermore, post translational modifications of regulators of mitochondrial dynamics were found to play a role. For instance, MFN1 is phosphorylated at an atypical ERK site in its heptad repeat 1 domain51. This site was proved essential to mediate MFN1-dependent mitochondrial elongation and apoptosis downstream of the MEK/ERK cascade. However, systematic functional evaluation of dysregulated mitochondrial proteins in cancer was still absent. In this study, by screening for transcriptionally dysregulated genes encoding mitochondrial proteins in human HCC, we identified FUNDC2 and PRELID2, which were correlated with patient survival. Functional characterization of these genes was facilitated by hydrodynamic injection-based multiplexed in situ genome editing of mouse hepatocytes, which achieved silencing of target genes precisely in tumor cells induced by defined oncogenes30. In such a way, the robust tumor-promoting function of elevated FUNDC2 was revealed. By binding and inhibiting MFN1, FUNDC2 promotes mitochondrial fragmentation in vitro and in vivo (Fig. 8i).
Little was known about the biological functions of FUNDC2. It was demonstrated that mitochondrial FUNDC2 interacts with phosphatidylinositol-3,4,5-trisphosphate (PIP3), thereby promotes phosphorylation of AKT35,52. Such a function specifically supports survival of platelets. In addition, it was found that liver-specific knockout of FUNDC2 promotes cellular accumulation of triglycerides and non-alcohol fatty liver disease (NAFLD), as well as glucose intolerance induced by high-fat diet in mice53. While it was suggested that FUNDC2 regulates lipid metabolism by direct binding to the promoter region of SREBP1c54, it is in odds with the subcellular localization of FUNDC2 to mitochondria. Nevertheless, such a phenotype is consistent with our finding of reduced FAO and accumulation of lipid droplets upon ablation of FUNDC2. It should be noted that liver-specific knockout of MFN1 results in not only a highly fragmented mitochondrial network, but also enhanced mitochondrial respiration24. In this report, it was demonstrated that MFN1 deficiency increased complex I abundance, which may explain increased respiration. Thus, although mitochondrial fragmentation was more thought to reduce respiration, that caused by inhibition of MFN1 seems different. Whether this difference is due to other functions of MFN1 is worth further investigation. It is also tempting to speculate that FUNDC2 may play a physiological role in the metabolism of normal liver tissue via inhibition of MFN1, and altered mitochondrial dynamics due to attenuated FUNDC2 expression may contribute to the pathogenesis of NAFLD. In addition, FUNDC2 was first cloned as an interacting partner of HCV core protein55, which raises the possibility of dysregulated mitochondrial dynamics by HCV infection through FUNDC2. Thus, inhibition of MFN1 and mitochondrial fusion could be a major mechanism of FUNDC2 in broader biological contexts. Despite homology between MFN1 and MFN2, the later was not inhibited by FUNDC2, although physical interaction could be detected. The difference could be due to variation in critical protein sequences or differential subcellular localizations, but the exact reason awaits further investigation. In contrast to MFN1, knockout of MFN2 in liver causes a nonalcoholic steatohepatitis (NASH)-like phenotype and liver cancer, suggesting noncomplementary roles of MFN1 and MFN256.
It was reported that MFN1 knockout mouse embryonic fibroblast cells were resistant to apoptotic stimuli57. This was due to inefficient accumulation of Bax onto OMM with incorrect curvature caused by hyperfragmentation. Whether FUNDC2 regulates apoptosis of cancer cells could be further investigated in the future. Knockdown of FUNDC2 did not decrease the ratio of proliferating cells in tumor. However, a metabolic imbalance featuring reduced catabolic processes including glycolysis, TCA cycle, and FAO, as well as increased PPP was caused by FUNDC2 deletion in an MFN1-dependent manner. Furthermore, although triglycerides and other storage lipids were accumulated, phospholipids which play critical roles in membrane formation and lipid signaling were reduced. Thus, by inhibiting MFN1, FUNDC2 could promote tumor growth by metabolic reprogramming following dysregulated mitochondrial dynamics. The observation that knockdown of FUNDC2 also reduces expression of AFP, an indicator of HCC malignancy, and a marker of cancer stem cells, suggests that the cancer stem cell compartment may be more susceptible to inhibition of FUNDC2. It has been reported that in contrast to proliferating tumor cells, cancer stem cells exhibit higher dependence on oxidative phosphorylation58,59. In breast cancer, by distinguishing pre-existing and newly synthesized mitochondrial proteins using labeling technologies, it was found that upon asymmetric cell division, stem-like cells contained a greater number of ‘new’ mitochondria. Furthermore, interfering with DRP1 activity abrogated asymmetric distribution of mitochondria and reduced stem-cell properties in vitro60. Thus, it is possible that FUNDC2-induced mitochondrial fragmentation maintains cancer stem cells in HCC, which awaits further investigation.
In conclusion, we demonstrated MFN1 inhibition by FUNDC2 as a mechanism of mitochondrial fragmentation, which contributes to tumorigenesis of HCC. Our results suggest FUNDC2 as a potential therapeutic target of HCC.
Methods
Human specimens
Human HCC specimens were collected in the First Affiliated Hospital of Zhejiang University between 2012 and 2019, who were all diagnosed with primary HCC by pathology and underwent curative surgical resection, aged 25–85, 86.8% men and 13.2% women. This study was performed in accordance with the International Ethical Guidelines for Biomedical Research Involving Human Subjects and the principles expressed in the Declaration of Helsinki, and was approved by the ethic committee of the First Affiliated Hospital of Zhejiang University. Written informed consent was acquired from the patients and the patients’ parties.
Animal model
Animal care was provided according to regulatory standards at Zhejiang University Laboratory Animal Center. All animal study protocols were approved by the Zhejiang University Animal Care and Use Committee (ZJU20210073). Four-week-old male ICR mice were purchased from Shanghai SLAC Laboratory Animal Company. Standard laboratory chow diet for mice was purchased from XieTong Biology (Cat# 1010082), and were fed ad libitum. The SPF grade animal room was maintained humidity (45–60%) with a 12 h (7:00 a.m.–7:00 p.m.) light/dark cycle. Hydrodynamic tail-vein injection was described previously30. In detail, mice received 50 μg of total transposon plasmids together with 10 μg PB transposase plasmids in a volume equal to 10% of mice body weight. Plasmids for hydrodynamic tail vein injection were prepared using the Qiagen EndoFreeMaxi Kit, and were diluted in sterile Ringer’s buffer before injection. Animals were euthanized 80 days after injection or when symptoms of tumorigenesis were evident, such as abdominal enlargement, lethargy or other change in behavior, such as eating, ambulation, excretion, defecate, or increased respiratory effort. Mice were euthanized by cervical dislocation or carbon dioxide. Livers were pictured and weighted, and tissues were then fixed or frozen for further processing, no data were excluded.
Plasmid construction
FUNDC2, MFN1, and MFN2 were cloned into pcDNA-c-HA vector, and further sub-cloned into pLVX-c-HA, pLVX-c-Myc, and pLVX-c-Flag vectors. FUNDC2 was also sub-cloned into pLVX-c-GFP. FUNDC2 and MFN1 truncation mutants were cloned into pLVX-c-GFP and pcDNA-c-HA, respectively.
shRNAs against hFUNDC2 cDNA (shhFUNDC2#1: CCGGGCGTCCAGTCAAGGAAACTTTCTCGAGAAAGTTTCCTTGACTGGACGCTTTTTTG, shhFUNDC2#2: CCGGGATGGTGCACAGGTTTCATATCTCGAGATATGAAACCTGTGCACCATCTTTTTTG), mFUNDC2 cDNA (shmFUNDC2#1: CCGGATGGTGCACTGGTTTCGTATTCTCGAGAATACGAAACCAGTGCACCATTTTTTC, shmFUNDC2#2: CCGGGATCTTGCAGAATTAACTAAACTCGAGTTTAGTTAATTCTGCAAGATCTTTTTC), hMFN1 cDNA (shhMFN1#1: CCGGGCTCCCATTATGATTCCAATACTCGAGTATTGGAATCATAATGGGAGCTTTTTC, shhMFN1#2: CCGGGCTCAAAGTTGTAAATGCTTTCTCGAGAAAGCATTTACAACTTTGAGCTTTTTC), mMFN1 cDNA (shmMFN1#1: CCGGTACGGAGCTCTGTACCTTTATCTCGAGATAAAGGTACAGAGCTCCGTATTTTTC, shmMFN1#2: CCGGGCGAAAGAGAGAGCGTTTAAGCTCGAGCTTAAACGCTCTCTCTTTCGCTTTTTC), mPRELID2 cDNA (shmPRELID2#1: CCGGAGAATGTGGTTCCAGAGATTTCTCGAGAAATCTCTGGAACCACATTCTTTTTTG, shmPRELID2#2: CCGGTCATTCAAACAGGCCGAATTTCTCGAGAAATTCGGCCTGTTTGAATGATTTTTG) and non-targeting (CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTC) were expressed in pLKO.1 vector by cloning annealed oligonucleotides between EcoRI and AgeI sites.
sgRNAs against hMFN1 (CACCGATCTCGGAGACACATGAAGG), hMFN2 (CACCGCCCCGTTACCACAGAAGAAC), and non-targeting (CACCGGCGGGCAGAACGACCCTGAC) were designed by the Zhang laboratory CRISPR Design Tool (https://zlab.bio/guide-design-resources). The LentiV2 vector was used to construct sgRNA-expressing lentiviral plasmids by cloning annealed oligonucleotides into BsmBI site.
Tissue culture, transfection, and viral infection
HepG2 (HB-8065) and HEK293T (CRL-11268) cells were from ATCC. HeLa (ATCC, CCL-2) cells were from Dr. Fangwei Wang, and Huh-7 (JCRB cell bank, JCRB0403) cells were from Dr. Junfang Ji. Huh-7, HepG2, HEK293T, and HeLa cells were cultured in Dulbecco’s modified Eagle medium (Gibco, C11995500BT) containing 10% FBS and 50 μg/mL penicillin/streptomycin (Gibco, 2289322). Primary mouse liver cancer cells were cultured in DMEM/F12 (Gibco, C11330500BT) containing 10% FBS supplemented with EGF (20 ng/mL, Sigma-Aldrich, SRP3196), Insulin (5 μg/mL, YEASEN, 40112ES25) and Dexamethasone (2 μM, Sigma-Aldrich, D4902). All cells were cultured in a 37 °C humidified incubator with 5% CO2. HeLa was listed as a commonly misidentified cell line by the International Cell Line Authentication Committee. We use this cell line due to its high transfection efficiency. All cell lines were authenticated by August 2021 at Genetic Testing Biotechnology Corporation (Suzhou, China) using Short Tandem Repeat (STR) analysis as described in 2012 in ANSI Standard (ASN-0002) by the ATCC Standards Development Organization. Mycoplasma test for tissue culture was done in a monthly basis using MycoPlasma Detection Kit (Vazyme, D101-01). Cells used in experiments were within 10 passages from thawing.
Transfection was performed using Lipofectamine (Thermo Fisher, L3000015) according to the manufacturer’s instructions. Lentiviral or retroviral infection was used to generate stable cells. Briefly, HEK293T cells were co-transfected with viral vector and packaging plasmids, 48 h post-transfection, virus-containing medium was collected, filtered through a 0.45-μm filter and used to infect target cells in the presence of 10 μg/mL polybrene. Puromycin (Thermo Fisher, A1113803) or Blasticidin (Thermo Fisher, R21001) was used for selection.
Colony formation assay
For colony formation assay, cells were seeded into six-well plates at a density of 5000 cells in each well and incubated for 2 weeks, medium may be replenished every 2 days. Cells were fixed in 4% formalin for 15 min and stained with 1% crystal violet for 30 min. the number of colonies was quantified by Image J software (version 1.52r). Each experiment was repeated for three times.
Glucose uptake assay
2-DG uptake was assessed using the Glucose Uptake Assay Kit (Abcam, ab136955). Briefly, Huh-7 cells were counted and plated in 96-well plate. 36 h later, cells were washed and incubated in 2% bovine serum albumin (BSA, Sigma-Aldrich, A1933) for 1 h. Then cells were stimulated by insulin, followed by 2-deoxyglucose (Sigma-Aldrich, D8375) addition for 30 min. Cells were lysed, heated at 85 °C for 40 min, and put on ice for 5 min. Then, supernatant of cell lysate was incubated with oxidation buffer and next neutralizing buffer. The plate was measured at 412 nm in a microplate reader.
FACS analysis of mitochondria mass, membrane potential, and ROS
For membrane potential measurement, 5 × 106 cells were incubated with 50 nM Tetramethylrhodamine methyl ester perchlorate (TMRM, Invitrogen, M20036) and 100 nM Mitotracker green (Invitrogen, M7514) for 30 min at 37 °C. For mitochondria mass assay, cells were only stained with 100 nM Mitotracker green. For CMH2DCFDA staining, 5 × 106 cells were resuspended and incubated with pre-warmed PBS containing 2 μM CMH2DCFDA (Invitrogen, C6827) for 30 min. After the incubation, cells were washed twice with PBS and analyzed by flow cytometry (Beckman Cytexpert, version 1.2). Data was processed by FlowJo (version 10).
Western blotting and immunoprecipitation
Western blotting was performed following standard protocol. Briefly, tissues were homogenized by tissue lysis buffer (20 mM Tris pH 7.5, 1 mM EDTA, 1 mM EGTA, 2% SDS, 150 mM NaCl, 0.1 mM DTT, 1 mM PMSF, 1 mM Na3VO4, 50 mM NaF, and protease inhibitor cocktail) and separated by SDS-PAGE and transferred onto PVDF membranes (Millipore, IPVH00010). Membranes were blocked with 5% of milk and incubated at 4 °C overnight with primary antibodies against FUNDC2 (Rabbit anti-FUNDC2, US Biological, Cat# 035793, dilution 1:5000 v/v), MFN1 (Rabbit anti-MFN1 JF0954, HUABio, Cat#ET1702-01, dilution 1:5000 v/v), MFN2 (Rabbit anti-MFN2, Proteintech, Cat# 12186-1-AP, dilution 1:5000 v/v), HNF4a (mouse anti-HNF4a H1415, Cosmo Bio, Cat# PPX-PP-H1415-00, dilution 1:5000 v/v), pACC (Rabbit anti-pACC S79, CST, Cat# 3661, dilution 1:5000 v/v), HA tag (Rabbit anti-HA C29F4, CST, Cat# 3724, dilution 1:10,000 v/v), HSP90 (Rabbit anti-HSP90, Proteintech, Cat# 13171-1-AP, dilution 1:8000 v/v), Myc tag (Mouse anti-Myc-Tag 9B11, CST, Cat# 2276, dilution 1:5000 v/v), GFP (Rabbit anti-GFP, Abcam, Cat# 6556, dilution 1:5000 v/v), β-actin (Mouse anti-ACTB 7D2C10, Proteintech, Cat# 20536-1-AP, dilution 1:10,000 v/v), ATF-4 (Rabbit anti-ATF-4 D4B8, CST, Cat# 11815, dilution 1:1000 v/v), BiP (Rabbit anti-BiP C50B12, CST, Cat# 3177, dilution 1:1000 v/v), PERK (Rabbit anti-PERK D11A8, CST, Cat# 5683, dilution 1:1000 v/v) and Phospho-PERK (Thr980) (Rabbit anti-Phospho-PERK Thr980 16F8, CST, Cat# 3179, dilution 1:1000 v/v). Membranes were then washed and incubated with HRP-conjugated secondary antibodies (Invitrogen A16096, 62-6520) for 1.5 h at room temperature. Proteins were detected using an ECL detection reagent. Scans for uncropped blots were provided in a source data file Uncropped Blots and in Supplementary Fig. 10.
For immunoprecipitation, cells were lysed by ice-cold mild lysis buffer (100 mM NaCl, 10 mM EDTA, 1% NP40, 10 mM Tris pH 7.5, 50 mM NaF, 1 mM Na3VO4, 0.1 mM DTT) supplemented with EDTA-free complete protease inhibitor (Sigma-Aldrich, S8830). Cell lysates were centrifugated at 12,000 × g for 15 min at 4 °C. Supernatants were collected and incubated with desired antibodies with rotation at 4 °C for 2 h, protein G-Sepharose (GE healthcare, 17-0618-01) was added and incubated for another 1.5 h. Samples were then centrifuged, washed with mild lysis buffer for four times. Samples were boiled with 1×SDS loading buffer. Primary antibodies against MFN1 (Rabbit anti-MFN1 JF0954, HUABio, Cat#ET1702-01, dilution 1:50 v/v), MFN2 (Rabbit anti-MFN2, Proteintech, Cat# 12186-1-AP, dilution 1:50 v/v), HA tag (Rabbit anti-HA C29F4, CST, Cat# 3724, dilution 1:200 v/v) and Flag tag (Mouse anti-Flag M2, Sigma-Aldrich, Cat# A8592, dilution 1:100 v/v) were involved in this section.
Real-time qPCR
Total cellular RNA was extracted with Trizol (TaKaRa, Cat# 9109). Subsequently, complementary DNAs (cDNAs) were synthesized using First-Strand Synthesis System (TaKaRa, Cat# RR036A) according to the manufacturer’s instructions. cDNA was analyzed by qPCR with SYBR Green (YEASEN, Cat# 11143ES50) and gene-specific primers (mPRELID2, forward 5′-GTCGCTTGCTTCCTC-3′, reverse 5′-GATTTTCTACGCTTTCC-3′; mFUNDC2, forward 5′-GCTAACAGTCAAGGAAA-3′, reverse 5′-TCTGGAATACGAAACC-3′; mMFN1, forward 5′-ATCACTGCAATCTTCGGCCA-3′, reverse 5′-AGCAGTTGGTTGTGTGACCA-3′; mSDHA, forward 5′-GAAGATTTATCAGCGTG-3′, reverse 5′-GTGTAAGAGTGAGTGGC-3′; mKi67, forward 5′-GCTCACCTGGTCACCATCAA-3′, reverse 5′-TGACACTACAGGCAGCTGGA-3′; mAFP, forward 5′-GTTTCCAGAACCTGCCGAGA-3′, reverse 5′-CTGAGCAGCCAAGGACAGAA-3′; hHPRT, forward 5′-AGCCCTGGCGTCGTGATTA-3′, reverse 5′-ACAATGTGATGGCCTCCCA-3′; hFUNDC2, forward 5′-ACTGGCAACGAGTGGAGAAG-3′, reverse 5′-CATGCCAAGCAGAAAGCCTC-3′. Relative expression of mRNA was normalized by Succinate dehydrogenase, subunit A (Sdha) or hypoxanthine phosphoribosyltransferase 1 (HPRT1) mRNA. The real-time PCR results were analyzed and expressed as relative expression of CT (threshold cycle) using the 2−▵▵Ct method.
GTP-binding and GTPase activity assays
GTP-binding assay was performed as previously reported61. Briefly, 100,000 cells were lysed by lysis buffer (100 mM NaCl, 10 mM EDTA, 1% NP40, 10 mM Tris pH 7.5, 10 mM MgCl2, 50 mM NaF, 1 mM Na3VO4, 0.1 mM DTT). Lysates were centrifuged for 10 min at 12,000 × g, and supernatant aliquots were used to determine total protein levels. Lysates were then incubated with GTP-agarose suspension (Sigma-Aldrich, G9768) for 1 h at 30 °C with agitation. Agarose beads were collected by centrifugation, washed 3 times in lysis buffer, and resuspended in 40 μl SDS-PAGE sample buffer. GTP-bound proteins were analyzed by immunoblotting.
For measurement of MFN1 and MFN2 GTPase activity, MFN1-HA and MFN2-HA were immunoprecipitated from cell lysates, and GTPase activity was measured with a GTPase Activity kit (Sigma-Aldrich, MAK113) according to the manufacturer’s instructions.
Immunofluorescent staining and imaging
Cells were seeded and transfected on glass coverslips, 24 h post-transfection, cells were fixed with 4% paraformaldehyde in PBS for 15 min, permeabilized with 0.1% Triton X-100 for 5 min. cells were blocked and incubated with primary antibodies against HA tag (Rabbit anti-HA C29F4, CST, Cat# 3724, dilution 1:500 v/v) and OLLAS tag (Rat anti-OLLAS L2, Novus Biologicals, Cat# NBP1-06713, dilution 1:100 v/v) for 2 h at room temperature. After washes, cells were stained with indicated fluorophore-conjugated secondary antibodies (Thermo Fisher, A-11008, A-11006) for another 1 h at room temperature. After wash, coverslips were mounted by ProLong Gold antifade mounting media with DAPI (Thermo Fisher, P36941). Images were taken by an LSM 880 confocal microscope (ZEISS).
Transmission electron microscopy
Briefly, tumors were cut into pieces of about 1 mm3, and cells were grown on coverslips. Samples were fixed with 2.5% glutaraldehyde (Sigma-Aldrich, G5882) for 2 h at room temperature. After wash, samples were post-fixed with 1% osmium tetroxide (Sigma-Aldrich, O5500) for another 1.5 h, and dehydrated with an ethanol series. Samples were infiltrated, embedded in Epon Resin, and polymerized at 60 °C for 12 h. Ultrathin sections of 60 nm were prepared, stained with uranyl acetate and lead citrate. Samples were observed under a Hitachi HT7700 transmission electron microscope. Mitochondrial length was analyzed by an Image-Pro Plus 6.0 software. For quantification of MAM, we normalized the MAM region to total mitochondrial perimeter following a published method62.
Seahorse assay
Cellular oxygen consumption rates (OCR) were measured in real time using the Seahorse XF 96 Extracellular Flux Analyzer (Seahorse Bioscience). Briefly, 10,000 cells were seeded into 96-well Seahorse microplates in 100 μL growth medium (Agilent, 103015-100) and incubated at 37 °C in 5% CO2 overnight and the calibrator plate was equilibrated overnight in a non-CO2 incubator. Before the test, cells were washed twice with assay running media (unbuffered DMEM, 25 mM glucose, 1 mM glutamine, 1 mM sodium pyruvate) and incubated for 1 h in a non-CO2 incubator. Once the probe calibration was completed, the probe plate was replaced by cell plate. Cellular OCRs were measured by injection of the following compounds: 1 μM oligomycin (MedChemExpress, HY-N6782), 0.5 μM FCCP (MedChemExpress, HY-100410), and 1 μM antimycin A (MedChemExpress, HY-107406) plus rotenone (MedChemExpress, HY-B1756). At the conclusion of the assay, cells were lysed and protein levels were measurement by BCA kit. OCR was normalized by the amount of total protein.
For glycolysis stress test, cells were incubated with glucose-free medium supplemented with 1 mM pyruvate at 37 °C in incubator without CO2 for 1 h prior to the assay. Glucose, oligomycin and 2-DG were injected into plates in order. Extracellular acidification rate (ECAR) was normalized by the amount of total protein.
Palmitate-BSA was prepared using 2 mM palmitate solution heated at 70 °C, and 0.1 M NaOH was added until the solution was clear. To keep the ratio of palmitate to BSA 5:1, palmitate solution was added to 0.34 mM BSA solution (0.9% NaCl, 65 °C) drop by drop until the solution was clear. Finally, the 1 mM palmitate-BSA solution was filtered and stored at −80 °C. For fatty acid oxidation assay, cells were incubated overnight with seahorse substrate-limited medium with 0.5 mM glucose, 1× GlutaMAX (Gibco, 35050061), 0.5 mM carnitine (MedChemExpress, HY-B0399) and 1% FBS. Before the assay, cells were replenished with FAO assay medium (Agilent, 103693-100) and incubated for 30 min. After that, cells were pre-treated with etomoxir (40 μM, MedChemExpress, HY-50202), palmitate (200 μM) or BSA for another 20 min. Oligomycin, FCCP, antimycin A plus rotenone were injected into the plate in order. OCR was analyzed and normalized by the amount of total protein.
Measurement of cellular ATP level
ATP was measured using an ATP Assay Kit (Beyotime Biotechnology, S0026) according to the manufacturer’s instructions. Briefly, cells were homogenized in ice-cold lysis buffer. After centrifugation, supernatants were added into substrate solution and the luminescence was recorded by a microplate reader (POLARstar Omega). A standard curve of ATP concentration was prepared from measurement of standard solutions. Protein concentration was determined by the BCA method for normalization of ATP concentration.
Tandem affinity purification
To identify FUNDC2-interacting proteins, Huh-7 cells stably expressing FUNDC2-Flag-SBP were generated. Cells were lysed with lysis buffer (10 mM Tris pH 7.5, 2 mM EDTA, 150 mM NaCl, 0.3% CHAPS, 2.5 mM NaF, 1 mM Na3VO4, 0.1 mM DTT and 0.5 mM PMSF) supplemented with EDTA-free complete protease inhibitor. Lysates were centrifuged at 12,000 × g for 15 min at 4 °C, and supernatants were collected and incubated with anti-Flag M2 resin (Sigma-Aldrich, F2426) for 2 h at 4 °C. Resins were collected by centrifugation and washed three times with lysis buffer. Bound proteins were eluted with 200 ng/μL 3×Flag peptide (Sigma-Aldrich, F4799). Eluates were further incubated with streptavidin-conjugated resin (Agilent, 240105) for another 2 h at 4 °C. Then resins were washed and eluted with elution buffer (Tris pH 7.5, 150 mM NaCl, 0.05% Rapigest, 10 mM 2-mercaptoethanol, 4 mM biotin). Samples were then analyzed by MS/MS.
IHC staining
Mouse livers were fixed in neutral buffered formalin for 24 h at room temperature and then embedded and processed according to standard protocols. Liver sections were deparaffinized through graded ethanol solutions. After an antigen retrieval procedure of 30 min, sections were stained with specific antibodies using the avidin-biotin complex system (Vector Laboratories, SP-2001, PK-6100). 3,3’-diaminobenzidine (DAB, Vector Laboratories, SP-4105) was used as the substrate. Cell nuclei were counterstained with hematoxylin. Primary antibodies against AFP (Rabbit anti-AFP, Abcam, Cat# ab46799, dilution 1:500 v/v) and Ki67 (mouse anti-Ki67 B56, BD, Cat# 556003, dilution 1:500 v/v) were involved in this section.
Histopathological analysis
For histopathological analysis, HE staining was performed on paraffin-embedded tissues. Lipid droplets were visualized by Oil Red (Servicebio, G1015) staining of Tissue-Tek O.C.T compound-embedded frozen liver sections. Histopathological images were captured under a light microscope. Images were quantified using Image J software (version 1.52r).
Fluorescent multiplexed immunohistochemistry
Fluorescent multiplexed immunohistochemistry was performed with Opal 7-color Manual IHC Kit (AKOYA Biosciences, NEL811001KT) according to the manufacturer’s protocol. In brief, sections were deparaffinized, microwave treated in epitope retrieval buffer for 45 s at 100% power and an additional 15 min at 20% power, blocked in Opal Antibody Diluent/Block at room temperature for 10 min, incubated with the specific primary antibody overnight at 4 °C, 10 min with the secondary horseradish peroxidase-conjugated antibody Polymer HRP Ms + Rb at room temperature, and 10 min with Opal fluorophore working solution. Sections were rinsed between staining steps with 1×Tris buffered Saline with Tween 20 and stripped between each round of staining via microwave treatment in antigen retrieval buffer. After the final microwave treatment, slides were stained with DAPI for 10 min followed by mounting. Images were acquired with confocal microscope LSM 880 (Zeiss).
Metabolite extraction and quantitation
Intracellular metabolites were extracted using a method described previously63,64 with modifications. Cells were quenched using 60% methanol pre-cooled at −80 °C after a brief wash with pre-warmed PBS, then lysed with 5 freeze-and-thaw cycles. Soluble metabolites were separated by two rounds of centrifugation and dried with a CentriVap Concentrator system (Labconco). For extracting tissue metabolites, ~5 mg of tissue was homogenized and lysed by bead-beading at 4 °C in MS-grade methanol, followed by 2 rounds of centrifugation at 15,000 × g for 15 min at 4 °C. The supernatant was dried in a CentriVap Concentrator system (Labconco), and the pellet was collected to measure protein concentration and subsequent normalization for injection. Dried metabolite extracts were resuspended in 60% acetonitrile and injected for quantification a triple quadrupole mass spectrometer (the QTRAP 6500+ System, ABSCIEX) coupled with an ultrahigh performance liquid chromatography. Metabolites were separated chromatographically on a SeQuant Zic-pHILIC column (5 μm polymer 150 × 2.1 mm, Millipore Sigma) and monitored with corresponding MRM transitions established using chemical standards. A 34-min liquid chromatography program running at a flow rate of 0.15 mL/min was used. In detail, Buffer A: 20 mM ammonium carbonate and 0.1% (v/v) ammonium hydroxide, and Buffer B: acetonitrile. T = 0 min, 80% B; T = 20 min, 20% B; T = 20.5 min, 20% B; T = 34 min, 80% B. Metabolites detected by MRM transitions in both positive and negative modes were carefully re-inspected for accuracy. The area under each peak was quantitated using a SCIEX OS software (version 1.7).
13C6 glucose and 13C16 palmitate tracing
[U-13C] glucose (Sigma-Aldrich, 389374) and [U-13C] palmitate (Sigma-Aldrich, 605573) were used to trace TCA cycle metabolites. Cells were seeded into 60 mm dish, after 24 h, the medium was replaced with conditional DMEM containing [U-13C] glucose or [U-13C] palmitate with 10% dialyzed FBS. Cells were traced with [U-13C] glucose (25 mM) for 24 h or with [U-13C] palmitate (200 μM) for 36 h. 13C incorporation into TCA cycle metabolites leads to various forms of mass shift. We established a method to examine these 13C-labeled metabolites in the negative ion mode according to a previous study65 with minor modifications. The MRM transitions for detecting 13C-labeled TCA cycle metabolites were verified using metabolites extracted from cells grown with [U-12C] and [U-13C] glucose. The tracing duration and labeling efficiency are also optimized.
Lipid extraction and quantitation
Tissue lipids were extracted with a previous method66 with some modifications. A mixture of 17:0 PC, 17:0 PE internal standards was added to each 10 mg tissue sample and then lysed by bead-beading at 4 °C in MS-grade methanol. Cell pellets and lysates were then transferred to glass tubes, and chloroform was added. After a vigorous vortex, samples were centrifuged, and the supernatant was transferred to a new glass tube. Pellets were saved for measuring protein concentration using a BCA assay. Chloroform and citric acid were added, vortexed, and phase-separated by centrifugation. The bottom lipid phase was harvested and dried using a CentriVap Concentrator system (Labconco). Lipid extracts were reconstituted in a sampling buffer consisting of isopropanol: acetonitrile: water (2:1:1, v/v/v) and injected for a non-targeted lipidomics analysis using a SCIEX QTOF 6600+ System with a scan range of m/z 100–1500 in both positive and negative ion modes. For better resolution, lipid samples were separated chromatographically using the LC system coupled to the QTOF system. We ran the samples under a 17-min program on an ACQUITY UPLC BEH C18 column (Waters, 130 A, 1.7 μm, 2.1 mm × 50 mm) at a flow rate of 0.15 mL/min. Solvent A consisted of methanol/acetonitrile/water (1:1:1, v/v/v) and solvent B was isopropanol, both solvents containing 5 mM ammonium acetate. The gradient started with 20% B for 1 min, steadily increased to 60% B by 3 min, reached 98% B by 13.1 min, and then decreased to 20% B by 16 min. Raw data files were processed using the MS-DIAL software (version 4.6) to identify and quantify lipid species67.
Statistics and reproducibility
GraphPad Prism was used for graphical representation and statistical analysis of data. Data are presented as mean ± SD. No statistical methods were used to estimate sample size. A standard two-tailed unpaired Student’s t test was used for statistical analysis of the two groups. All experiments were repeated three times unless specified. All shown results were consistent among replicates. Kaplan–Meier survival analysis was used to estimate overall survival.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Data availability
All data are available in the main text or supplementary materials. Human data derived from the TCGA and GSE124535 datasets are available from https://portal.gdc.cancer.gov/legacy-archive/search/f and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE124535. Source data are provided with this paper.
References
Banoth, B. & Cassel, S. L. Mitochondria in innate immune signaling. Transl. Res. 202, 52–68 (2018).
Jeong, S. Y. & Seol, D. W. The role of mitochondria in apoptosis. BMB Rep. 41, 11–22 (2008).
Friedman, J. R. & Nunnari, J. Mitochondrial form and function. Nature 505, 335–343 (2014).
Nunnari, J. & Suomalainen, A. Mitochondria: in sickness and in health. Cell 148, 1145–1159 (2012).
Zong, W. X., Rabinowitz, J. D. & White, E. Mitochondria and cancer. Mol. cell 61, 667–676 (2016).
Cao, Y. L. et al. MFN1 structures reveal nucleotide-triggered dimerization critical for mitochondrial fusion. Nature 542, 372–376 (2017).
Gao, S. & Hu, J. Mitochondrial fusion: the machineries in and out. Trends Cell Biol. 31, 62–74 (2021).
Del Dotto, V., Fogazza, M., Carelli, V., Rugolo, M. & Zanna, C. Eight human OPA1 isoforms, long and short: What are they for? Biochimica et. biophysica acta Bioenerg. 1859, 263–269 (2018).
Fonseca, T. B., Sánchez-Guerrero, Á., Milosevic, I. & Raimundo, N. Mitochondrial fission requires DRP1 but not dynamins. Nature 570, E34–e42 (2019).
Yoon, Y., Krueger, E. W., Oswald, B. J. & McNiven, M. A. The mitochondrial protein hFis1 regulates mitochondrial fission in mammalian cells through an interaction with the dynamin-like protein DLP1. Mol. Cell Biol. 23, 5409–5420 (2003).
Yu, R., Jin, S. B., Lendahl, U., Nister, M. & Zhao, J. Human Fis1 regulates mitochondrial dynamics through inhibition of the fusion machinery. EMBO J. 38, https://doi.org/10.15252/embj.201899748 (2019).
Chen, H. et al. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J. Cell Biol. 160, 189–200 (2003).
Ishihara, N. et al. Mitochondrial fission factor Drp1 is essential for embryonic development and synapse formation in mice. Nat. Cell Biol. 11, 958–966 (2009).
Weinhouse, S. On respiratory impairment in cancer cells. Science 124, 267–269 (1956).
Pavlova, N. N. & Thompson, C. B. The emerging hallmarks of cancer metabolism. Cell Metab. 23, 27–47 (2016).
Birsoy, K. et al. Metabolic determinants of cancer cell sensitivity to glucose limitation and biguanides. Nature 508, 108–112 (2014).
Rehman, J. et al. Inhibition of mitochondrial fission prevents cell cycle progression in lung cancer. FASEB J. 26, 2175–2186 (2012).
Zou, P. et al. Coordinated upregulation of mitochondrial biogenesis and autophagy in breast cancer cells: the role of dynamin related protein-1 and implication for breast cancer treatment. Oxid. Med. Cell. Longev. 2016, 4085727 (2016).
Xie, Q. et al. Mitochondrial control by DRP1 in brain tumor initiating cells. Nat. Neurosci. 18, 501–510 (2015).
Nagdas, S. et al. Drp1 promotes KRas-driven metabolic changes to drive pancreatic tumor growth. Cell Rep. 28, 1845–1859.e1845 (2019).
Horbay, R. & Bilyy, R. Mitochondrial dynamics during cell cycling. Apoptosis: Int. J. Program. cell death 21, 1327–1335 (2016).
Archer, S. L. Mitochondrial dynamics–mitochondrial fission and fusion in human diseases. N. Engl. J. Med. 369, 2236–2251 (2013).
Huang, Q. et al. Increased mitochondrial fission promotes autophagy and hepatocellular carcinoma cell survival through the ROS-modulated coordinated regulation of the NFKB and TP53 pathways. Autophagy 12, 999–1014 (2016).
Kulkarni, S. S. et al. Mfn1 deficiency in the liver protects against diet-induced insulin resistance and enhances the hypoglycemic effect of metformin. Diabetes 65, 3552–3560 (2016).
Villanueva, A. Hepatocellular carcinoma. 380, 1450–1462, https://doi.org/10.1056/NEJMra1713263 (2019).
Bao, D. et al. Mitochondrial fission-induced mtDNA stress promotes tumor-associated macrophage infiltration and HCC progression. Oncogene 38, 5007–5020 (2019).
Rath, S. et al. MitoCarta3.0: an updated mitochondrial proteome now with sub-organelle localization and pathway annotations. Nucleic Acids Res. 49, D1541–d1547 (2021).
Wuestefeld, T. et al. A Direct in vivo RNAi screen identifies MKK4 as a key regulator of liver regeneration. Cell 153, 389–401 (2013).
Ding, S. et al. Efficient transposition of the piggyBac (PB) transposon in mammalian cells and mice. Cell 122, 473–483 (2005).
Guo, X. et al. Single tumor-initiating cells evade immune clearance by recruiting type II macrophages. Genes Dev. 31, 247–259 (2017).
Tipanee, J. et al. Validation of miR-20a as a tumor suppressor gene in liver carcinoma using hepatocyte-specific hyperactive piggyBac transposons. Mol. Ther.-Nucl. Acids 19, 1309–1329 (2020).
Lee, D. et al. Folate cycle enzyme MTHFD1L confers metabolic advantages in hepatocellular carcinoma. J. Clin. Investig. 127, 1856–1872 (2017).
Xi, J. et al. GLS1 promotes proliferation in hepatocellular carcinoma cells via AKT/GSK3β/CyclinD1 pathway. Exp. Cell Res. 381, 1–9 (2019).
Jiang, Y. et al. Proteomics identifies new therapeutic targets of early-stage hepatocellular carcinoma. Nature 567, 257–261 (2019).
Ma, Q. et al. Mitochondrial PIP3-binding protein FUNDC2 supports platelet survival via AKT signaling pathway. Cell Death Differ. 26, 321–331 (2019).
Benjamin, D. I., Cravatt, B. F. & Nomura, D. K. Global profiling strategies for mapping dysregulated metabolic pathways in cancer. Cell Metab. 16, 565–577 (2012).
Koshiba, T. et al. Structural basis of mitochondrial tethering by mitofusin complexes. Science 305, 858–862 (2004).
Lee, J. Y. et al. MFN1 deacetylation activates adaptive mitochondrial fusion and protects metabolically challenged mitochondria. J. Cell Sci. 127, 4954–4963 (2014).
Ryu, S. W. et al. Mitofusin 1 inhibits an apoptosis-associated amino-terminal conformational change in Bax, but not its mitochondrial translocation, in a GTPase-dependent manner. Cancer Lett. 323, 62–68 (2012).
Sebastian, D. et al. Mitofusin 2 (Mfn2) links mitochondrial and endoplasmic reticulum function with insulin signaling and is essential for normal glucose homeostasis. Proc. Natl Acad. Sci. USA 109, 5523–5528 (2012).
Patra, K. C. & Hay, N. The pentose phosphate pathway and cancer. Trends Biochem. Sci. 39, 347–354 (2014).
Cavalli, L. R., Varella-Garcia, M. & Liang, B. C. Diminished tumorigenic phenotype after depletion of mitochondrial DNA. Cell Growth Differ. 8, 1189–1198 (1997).
Zinkewich-Péotti, K., Parent, M. & Morais, R. On the tumorigenicity of mitochondrial DNA-depleted avian cells. Cancer Lett. 59, 119–124 (1991).
Viale, A. et al. Oncogene ablation-resistant pancreatic cancer cells depend on mitochondrial function. Nature 514, 628–632 (2014).
Gopal, Y. N. et al. Inhibition of mTORC1/2 overcomes resistance to MAPK pathway inhibitors mediated by PGC1α and oxidative phosphorylation in melanoma. Cancer Res. 74, 7037–7047 (2014).
Vyas, S., Zaganjor, E. & Haigis, M. C. Mitochondria and cancer. Cell 166, 555–566 (2016).
Sabharwal, S. S. & Schumacker, P. T. Mitochondrial ROS in cancer: initiators, amplifiers or an Achilles’ heel? Nat. Rev. Cancer 14, 709–721 (2014).
Kirtonia, A., Sethi, G. & Garg, M. The multifaceted role of reactive oxygen species in tumorigenesis. Cell. Mol. Life Sci. 77, 4459–4483 (2020).
Pang, G., Xie, Q. & Yao, J. Mitofusin 2 inhibits bladder cancer cell proliferation and invasion via the Wnt/β-catenin pathway. Oncol. Lett. 18, 2434–2442 (2019).
Senft, D. & Ronai, Z. A. Regulators of mitochondrial dynamics in cancer. Curr. Opin. Cell Biol. 39, 43–52 (2016).
Pyakurel, A., Savoia, C., Hess, D. & Scorrano, L. Extracellular regulated kinase phosphorylates mitofusin 1 to control mitochondrial morphology and apoptosis. Mol. Cell 58, 244–254 (2015).
Ma, Q., Zhang, W., Zhu, C., Liu, J. & Chen, Q. FUNDC2 regulates platelet activation through AKT/GSK-3beta/cGMP axis. Cardiovasc. Res. 115, 1672–1679 (2019).
Lu, H. et al. HCBP6 deficiency exacerbates glucose and lipid metabolism disorders in non-alcoholic fatty liver mice. Biomed. Pharmacother. 129, 110347 (2020).
Yang, X. et al. HCBP6 upregulates human SREBP1c expression by binding to C/EBPβ-binding site in the SREBP1c promoter. BMB Rep. 51, 33–38 (2018).
Wang, L., Cheng, J., Li, K. & Hong, Y. Identification and evaluation promoter sequence and the transcription activation of Hcbp6 interaction with core protein of hepatitis C virus. Zhonghua gan zang bing. za zhi = Zhonghua ganzangbing zazhi = Chin. J. Hepatol. 14, 81–85 (2006).
Hernández-Alvarez, M. I. et al. Deficient endoplasmic reticulum-mitochondrial phosphatidylserine transfer causes liver disease. Cell 177, 881–895.e817 (2019).
Brooks, C. et al. Bak regulates mitochondrial morphology and pathology during apoptosis by interacting with mitofusins. Proc. Natl Acad. Sci. USA 104, 11649–11654 (2007).
Sancho, P., Barneda, D. & Heeschen, C. Hallmarks of cancer stem cell metabolism. Br. J. Cancer 114, 1305–1312 (2016).
Park, H. A., Brown, S. R. & Kim, Y. Cellular mechanisms of circulating tumor cells during breast cancer metastasis. Int. J. Mol. Sci. 21, https://doi.org/10.3390/ijms21145040 (2020).
Katajisto, P. et al. Stem cells. Asymmetric apportioning of aged mitochondria between daughter cells is required for stemness. Science 348, 340–343 (2015).
Sugiura, A. et al. MITOL regulates endoplasmic reticulum-mitochondria contacts via Mitofusin2. Mol. Cell 51, 20–34 (2013).
Arruda, A. P. et al. Chronic enrichment of hepatic endoplasmic reticulum-mitochondria contact leads to mitochondrial dysfunction in obesity. Nat. Med. 20, 1427–1435 (2014).
Tu, B. P. et al. Cyclic changes in metabolic state during the life of a yeast cell. Proc. Natl Acad. Sci. USA 104, 16886–16891 (2007).
Ye, C. Q., Sutter, B. M., Wang, Y., Kuang, Z. & Tu, B. P. A metabolic function for phospholipid and histone methylation. Mol. Cell 66, 180 (2017).
Yuan, M. et al. Ex vivo and in vivo stable isotope labelling of central carbon metabolism and related pathways with analysis by LC-MS/MS. Nat. Protoc. 14, 313–330 (2019).
Ye, C. Q., Bandara, W. M. M. S. & Greenberg, M. L. Regulation of inositol metabolism is fine-tuned by inositol pyrophosphates in Saccharomyces cerevisiae. J. Biol. Chem. 288, 24898–24908 (2013).
Tsugawa, H. et al. A lipidome atlas in MS-DIAL 4. Nat. Biotechnol. 38, 1159–1163 (2020).
Acknowledgements
We thank Drs. Tian Xu and Xiaohui Wu for the piggyBac system; Weina Shang for assistance with EM and confocal imaging; Fangwei Wang for HeLa cells; and Junfang Ji for Huh-7 cells; Yongchao Zhao for assistance on Seahorse analysis; Chenliang Wang for making the model art; and the core facility of the Life Sciences Institute for technical assistance. This work was supported by grants to B.Z. from the National Natural Science Foundation of China Key Project (81730069), the National Key R&D Program of China (2017YFA0504502), the National Natural Science Foundation of China General Project (31970726), Natural Science Foundation of Zhejiang key project (LZ21C070002), and the Fundamental Research Funds for the Central Universities.
Author information
Authors and Affiliations
Contributions
B.Z. and S.L. conceived the project, B.Z., S.L., and S.H. designed the study. S.L., S.H., H.Z., J.W., Y.Zhao, L.S., and L.L. performed experiments and analyzed data. Y.Zhu and C.Y. performed MS analysis of metabolites and analyzed data. J.Z. and Q.Z. analyzed data. D.Z., X.-H.F., and T.L. provided critical reagents and conceptual advice. B.Z. and S.L. wrote the manuscript with comments from all authors.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks Marc Schneeberger Pane and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Li, S., Han, S., Zhang, Q. et al. FUNDC2 promotes liver tumorigenesis by inhibiting MFN1-mediated mitochondrial fusion. Nat Commun 13, 3486 (2022). https://doi.org/10.1038/s41467-022-31187-6
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-022-31187-6
This article is cited by
-
Phosphorylation of INF2 by AMPK promotes mitochondrial fission and oncogenic function in endometrial cancer
Cell Death & Disease (2024)
-
Association of mitochondrial homeostasis and dynamic balance with malignant biological behaviors of gastrointestinal cancer
Journal of Translational Medicine (2023)
-
Methionine restriction constrains lipoylation and activates mitochondria for nitrogenic synthesis of amino acids
Nature Communications (2023)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.