Abstract
There is increasing interest in the roles of covalently modified nucleotides in RNA. There has been, however, an inability to account for modifications in secondary structure prediction because of a lack of software and thermodynamic parameters. We report the solution for these issues for N6-methyladenosine (m6A), allowing secondary structure prediction for an alphabet of A, C, G, U, and m6A. The RNAstructure software now works with user-defined nucleotide alphabets of any size. We also report a set of nearest neighbor parameters for helices and loops containing m6A, using experiments. Interestingly, N6-methylation decreases folding stability for adenosines in the middle of a helix, has little effect on folding stability for adenosines at the ends of helices, and increases folding stability for unpaired adenosines stacked on a helix. We demonstrate predictions for an N6-methylation-activated protein recognition site from MALAT1 and human transcriptome-wide effects of N6-methylation on the probability of adenosine being buried in a helix.
Similar content being viewed by others
Introduction
It has long been appreciated that covalent modification of RNA is used by nature to expand the chemical repertoire of the four common nucleotides. tRNAs, in particular, are known to have prevalent modifications, and the roles of some of these have been elucidated1. For mRNAs and long non-coding RNAs (lncRNAs), it had been harder to identify sites of modification until recently when methods were developed using next generation sequencing technologies to identify modifications2,3. Modifications including deamination to inosine4, pseudouridylation5,6,7, 5-methylation of cytosine8, and N6-methylation of adenosine9,10,11,12,13,14 can now be localized transcriptome-wide.
N6-methyladenosine (m6A) is considered the most prevalent modification in mRNA, and m6A is also widespread in lncRNAs15,16. It is known to have writers that apply the modifications to specific positions (methyltransferases including METTL3 and METTL14), readers that identify sequences with N6-methylation (RNA-binding proteins including YTHDF2 and the YTH family), and erasers that can remove the modification (demethylases including FTO and ALKBH5), restoring the base to adenine17,18. Furthermore, there are hundreds of sites for which the m6A modification consensus site is conserved between the mouse and human transcriptomes12. The impacts of N6-methylation are being elucidated19,20. For example, N6-methylation is known to cause structural switches21 and to expose protein binding sites that are otherwise not available for binding22. Additionally, m6A can regulate splicing23.
RNA secondary structure prediction is in widespread use to help determine structure-function relationships24,25, but has not been generally available for understanding the roles of covalent modifications26. For unmodified sequences, secondary structure prediction has been used to identify microRNA binding sites27, design siRNAs28,29, identify protein binding sites30, and discover functional RNA structures31,32. These types of calculations have not been able to account for modifications without extensive user intervention because a set of nearest neighbor parameters are needed for estimating the folding stability of structures that include modifications26,33. A number of studies demonstrated an impact on folding stability by modifications34,35,36,37,38,39, but no complete set of parameters have been available for RNA folding, as there are for RNA folding with the four prevalent bases33. At the same time, no software has been available for handling a larger alphabet of sequences containing modifications. This led to a chicken-and-egg problem; without software, there was no impetus to assemble parameters and without parameters there was no reason to write the software.
In this work, we developed a full set of nearest neighbor parameters for a folding alphabet of m6A, A, C, G, and U nucleotides. These parameters account for helix and loop formation, and they are based on optical melting experiments for 32 helices with m6A-U base pairs and 13 oligonucleotides with m6A in loop motifs. We also modified the RNAstructure software package to accept user-defined folding alphabets and to read and utilize thermodynamic parameters for these extended alphabets40. Together, these advances allow the prediction of RNA secondary structures for sequences with m6A. We demonstrate, for calculations with human mRNA sequences known to contain m6A, that N6-methylation alters the folding landscape so that m6A is less likely to be buried in a helix, i.e., stacked between two base pairs. We also provide a model for the change in protein binding affinity caused by N6-methylation of the lncRNA metastasis-associated lung adenocarcinoma transcript (MALAT1).
Results
Overview of methods
Secondary structure prediction for RNA sequences including m6A requires both a set of nearest neighbor folding parameters and software capable of using the set of parameters. An overview of the methods is illustrated in Fig. 1. RNA secondary structure prediction requires both parameters for evaluating folding stability and a search algorithm to identify the optimal structure given the parameters24,25,41. In our RNAstructure software, we use nearest neighbor parameters to estimate folding free energy change33 and a set of dynamic programming algorithms that predict optimal structures24,25.
We built a database of optical melting experiments of oligonucleotides including m6A and then used linear regression to fit nearest neighbor parameters. We also extended the functionality of RNAstructure40 to recognize modified nucleotides in sequences and to use parameters for sequence alphabets beyond the four common nucleotides. The m6A modification parameters take advantage of this additional feature.
Helix nearest neighbor parameters for m6A
The full set of Turner nearest neighbor rules for estimating RNA folding stability are based on optical melting experiments of 802 oligonucleotides and use 294 parameters33,42. We have shown, however, that the precision of a subset of parameters is more important than others for the precise prediction of secondary structure43. Following that work, we focused our experiments on estimating parameters for helices, dangling ends, and terminal mismatches.
Our first goal was to fit the 15 stacking nearest neighbor parameters for m6A-U pairs adjacent to Watson–Crick pairs, G-U pairs, or m6A-U pairs. For this study, 29 fully helical duplexes containing m6A-U pairs were synthesized and optically melted. This provides a total database of 32 fully helical duplexes with m6A-U base pairs. Supplementary Table S1 provides the duplexes and the stabilities determined by optical melting. These specific oligonucleotide sequences were chosen, in part, because analogous model RNA helices with A in the m6A position had been previously studied by optical melting (with the exception of GGUUAACC2). This allows us to directly compare the folding stability with and without N6-methylation. We calculated the change in folding stability (ΔΔG°37) per methylation as compared to the unmethylated duplex. Supplementary Fig. S1 shows that the ΔΔG°37 is highly dependent on the adjacent sequence, ranging from +2.1 to −0.1 kcal/mol per methylation where positive free energies are destabilizing for methylation. Therefore, to estimate folding stabilities for duplexes with m6A-U pairs, a full nearest neighbor model is needed to account for the sequence dependence.
Linear regression was used to fit the nearest neighbor parameters for folding free energy change. Figure 2A shows the increments in comparison to the same stack with A-U pairs and Supplementary Table S2 provides the values. The free energy changes range from −1.79 ± 0.25 kcal/mol to +1.45 ± 0.57 kcal/mol. As expected based on prior optical melting experiments for duplexes with m6A-U pairs34,36, nearest neighbor stacks for methylated A-U pairs are less stable than stacks for unmethylated A-U pairs. On average, the stacks with m6A-U pairs are 0.4 kcal/mol less stable per methylation. There are exceptions, however; an m6A-U pair followed by a U-A pair is as stable as an A-U pair followed by a U-A pair (−1.10 kcal/mol). The most unstable stack has two m6A-U pairs. Like A-U pairs, when the m6-U pair is adjacent a G-C it is more stable than when adjacent to A-U. Also like A-U pairs, m6A-U pairs adjacent to G-U are less stable than those adjacent to A-U pairs.
An unexpected feature of terminal m6A-U pairs is that they require no terminal penalty, although terminal A-U pairs receive a +0.45 ± 0.04 kcal/mol penalty per A-U pair at the end of a helix44. Two findings support this. First, when a terminal parameter is included in the linear regression fit, the value is +0.13 ± 0.17 kcal/mol, which is not significantly different from 0 kcal/mol. Second, our dataset includes two helices with the same nearest neighbor stacks, but with different helix ends (Fig. 2B). Previously, it was noted that this pair of helices, when unmethylated, had markedly different stability (0.70 ± 0.47 kcal/mol), with the helix with A-U ends less stable44. For the methylated helices, the difference is small (0.18 ± 0.45 kcal/mol). This demonstrates that a terminal m6A-U base pair has overall similar stability to a terminal A-U base pair because a terminal A-U pair has a more favorable stack but requires the terminal A-U penalty.
Loop nearest neighbor parameters for m6A
For secondary structure prediction, parameters need to also be extrapolated for loop formation. The stability of a 3′ dangling m6A had been previously measured34. Additional optical melting experiments were performed in this work for two m6A 3′ dangling ends, an m6A 5′ dangling end, and seven terminal mismatches involving at least one m6A. One hairpin loop was measured with an m6A in the loop and not adjacent to the helix end. One 2 × 2 internal loop was measured with symmetric tandem G-m6A pairs. The loop sequences were chosen such that analogous sequences with A instead of m6A had been previously studied, so that the effect of methylation on stability can be quantified. Supplementary Table S3 provides the measured stabilities for these model structures and Supplementary Table S4 shows the stability of the loop motif in comparison to the motif with A.
As shown in Fig. 3, an m6A as a dangling end or as a component in a terminal mismatch stabilizes secondary structure formation to a greater extent than an analogous A. On average, the m6A dangling end is −0.43 ± 0.15 kcal/mol more stable than the analogous A dangling end for the 3′ and 5′ dangling ends studied here. Terminal mismatches for m6A-m6A, G-m6A, m6A-G, and m6A-C on Watson–Crick or G-U terminal pairs are on average −0.28 ± 0.26 kcal/mol more stabilizing than the analogous A-A, G-A, A-G, or A-C terminal mismatches. This stabilizing effect is sequence dependent; the ΔΔG°37 ranges from −0.74 kcal/mol (G-m6A mismatch on a U-G pair) to +0.02 kcal/mol (G-m6A mismatch on an A-U pair). An m6A-m6A mismatch on an m6A-U pair is more stable than the m6A-m6A mismatch on an A-U pair by −0.42 ± 0.40 kcal/mol.
The hairpin loop structure with m6A is marginally less stable than the analogous hairpin loop with A (ΔΔG°37 = 0.23 ± 0.24 kcal/mol; Supplementary Table S4). The 2 × 2 internal loop with tandem G-m6A pairs is also marginally less stable than the analogous loop with tandem G-A pairs (ΔΔG°37 = 0.33 ± 0.53 kcal/mol; Supplementary Table S4). Both stability changes are within the uncertainty estimates, suggesting that they are not significant differences.
Additional experiments to test the parameters
To test our parameters, we performed additional melts of duplexes (Supplementary Table S5A). The first is a duplex with all base pairs, incorporating a consensus N6-methylation site, GGACU, where we determined the helix stability with and without methylation. The second is an additional 3′ dangling m6A to test our assumption that dangling m6A are stabilized by −0.3 kcal/mol compared to dangling A. Then we studied six duplexes containing bulge loops, with and without methylation, four of which are loops that were previously studied45 and one of which models the m6A site in the hepatitis C viral genome46. In these bulge loops, m6A is the bulged nucleotide, in the base pair closing the single bulge, or in a base pair adjacent to the pair closing the bulge loop. Supplementary Table S5A provides the stabilities determined by optical melting and Supplementary Table S6A shows how well the stabilities are estimated with our nearest neighbor parameters.
We conclude from these tests that the nearest neighbor parameters are accurate enough to be used for RNA secondary structure prediction42,43. With the exception of one duplex with m6A bulged, the estimates for the duplex stabilities are within the uncertainties propagated for the experiment and the nearest neighbor parameters (ΔΔG°37 column of Supplementary Table S6A). The unmethylated consensus duplex (GGACUAGUCC2) is estimated by nearest neighbor parameters to be more stable (by −0.48 ± 0.73 kcal/mol) than it is by experiment. The methylated consensus duplex is estimated by nearest neighbors to be less stable than it is (by 0.85 ± 0.97 kcal/mol). These deviations are 2.9 and 5.5% of the experimentally determined values. The estimated stability of the duplex with the dangling m6A closely matches the experimental value (ΔΔG°37 of 0.01 ± 0.84 kcal/mol).
The bulge loops closed by m6A-U pairs are closely modeled by the nearest neighbor parameters with ΔΔG°37 of 0.05 ± 0.84, 0.07 ± 0.82, and 0.39 ± 0.87 kcal/mol. For the two duplexes with bulged m6A, the duplexes are systematically less stable than the analogous bulged A duplex. The nearest neighbor rules do not consider the sequence identity of single bulged nucleotides, and therefore modeling this is outside the current functional form33. In one case, the stability of the bulged A is more accurately modeled by the sequence-independent stability and in one case, the stability of the bulged m6A is more accurately modeled. This points to a limitation in the nearest neighbor parameters, which has previously been documented for single nucleotide bulge loops47,48. In the worst case, the nearest neighbor rules are incorrect by 1.12 kcal/mol, which is only 9.4% of the total folding free energy change of the duplex. For the duplex with an m6A-U base pair adjacent to a G-C pair that closes a bulge loop, the agreement is also excellent, with ΔΔG°37 of 0.01 ± 0.94 kcal/mol.
Our optical melting experiments to derive the nearest neighbor parameters were performed in 1 M Na+ to be consistent with the experiments used to derive the Turner nearest neighbor parameters33. To test whether m6A is stabilized by Mg2+, we also performed experiments in 150 mM K+ and 5 mM Mg2+, chosen to mimic physiological salt conditions for monovalent and divalent cations49. Supplementary Table S5B shows the optical melting data for the Mg2+-containing buffer for the consensus duplex and for the eight bulge loop sequences.
We find similar folding stabilities between 1 M Na+ and the Mg2+-containing buffer (Supplementary Table S6B). The largest difference in stability was observed for the consensus methylation site duplex at −1.79 ± 0.84 kcal/mol more stability in 1 M Na+, a difference of 12.3% between the two buffers. The bulge loop-containing duplexes were found to have no systematic bias in stability between methylated and unmethylated sequences. Prior tests of optical melting experiments in similar Mg2+-containing buffers generally demonstrated similar folding stability as 1 M Na+50,51,52,53,54,55, with the Loop E motif in 0.1 M Na+ and 50 mM Mg2+ as a notable exception56. A study of hairpin stem loops with m6A showed a magnesium dependence on relative folding stability with and without methylation, using a relatively low monovalent salt of 25 mM NaCl and 15 mM sodium phosphate45. In the higher monovalent K+ we used, which is similar to intracellular conditions, this methylation-dependent change in stability is not observed.
RNAstructure software modifications
To predict RNA secondary structures for sequences with A, C, G, U, and m6A, we modified the command line programs in the RNAstructure software package to accept extended alphabets of nucleotides40. By default, the software interprets sequences as standard RNA, but a command line switch can specify an alternative alphabet. For example, the nearest neighbor parameters for a DNA alphabet composed of A, C, G, and T has long been available. Now, because of this work, the nearest neighbor parameters for an RNA m6A alphabet are available.
The key to an extended alphabet is the specification of the nucleotides and base pairs (Supplementary Fig. S2). A common architecture across the RNAstructure programs means that the command line programs are capable of using the extended alphabets, which can include any number of characters. This includes the prediction of minimum free energy structures, base pair probabilities, maximum expected accuracy structures, and folding stability for structures. Each nucleotide must be encoded by a single-character, and we chose “6” or “M” as the characters to encode m6A in sequences and in the m6A nearest neighbor parameter tables. The Methods section details our estimates for the m6A nearest neighbor parameters. The parameter tables are provided as Supplementary Materials.
Nearest neighbor parameter tables are read from disk as programs start. Each parameter table requires additional rows and columns to provide the nearest neighbor parameters values for those nucleotides, although the dimensionality of the tables stays the same. For example, a base pair stack table is four-dimensional because the sequence of four positions is required to estimate the stacking stability of two base pairs. When m6A is included with RNA, the size of each dimension is increased to five from four. The largest table is the 2 × 2 internal loop lookup table33, which is eight dimensional because it includes the sequence of the two closing base pairs.
Modeling the accessibility changes in MALAT1 as a result of methylation
It has been established that N6-methylation can alter protein binding accessibility. To test our m6A nearest neighbor parameters and software, we made a quantitative prediction for the accessibility of protein binding to a structure in the lncRNA MALAT1 that is the binding target of heterogeneous nuclear ribonucleoprotein C (HNRNPC). This has been characterized by Tao Pan and co-workers in an in vitro system with a single stem-loop structure57. Filter binding experiments demonstrated that the methylated RNA is more accessible to protein binding than the unmethylated RNA. Additionally, enzymatic cleavage by RNase S1, which has specificity for loop regions of RNA, demonstrated increased cleavage 5′ and 3′ to the methylated A, supporting increased accessibility.
We used RNAstructure to predict the lowest free energy structure of the 32 nucleotide RNA. We predicted the structure to be a hairpin stem-loop as previously modeled for the unmethylated sequence (Fig. 4A, closed structure)57. However, our structure prediction was unchanged for the methylated sequence. For HNRNPC to bind, the site composed of the five Us starting at position 10 must be unpaired58. We can therefore estimate the accessibility as the ΔG°37 for the breaking of the three base pairs adjacent to the hairpin loop (Fig. 4A, open structure)59. The ΔΔG°37 is the difference in the accessibility with and without the N6-methylation at position 22 is 0.6 ± 0.4 kcal/mol (where the uncertainty is propagated from the uncertainties of two nearest neighbor stacks that change from the introduction of the methylation). This is consistent with the ΔΔG°37 of 1.26 ± 0.22 kcal/mol determined by filter binding assay57.
Our model therefore is that the N6-methylation of the MALAT1 hairpin does not open the binding site, but instead facilitates the HNRNPC protein-mediated breaking of base pairs at the binding site. To test this, we probed the 32 nucleotide RNA (extended with a 3′ structural cassette) by chemical mapping with CMCT (1-cyclohexyl-3-(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate), DMS (dimethyl sulfate), and kethoxal (Supplementary Fig. S3). The chemical mapping data and the prior enzymatic mapping57 data are consistent with the proposed structure, and only minor differences are observed with and without the methylation. We also collected NMR spectra with and without methylation and assigned the imino resonances, following previous NMR studies on the same sequence60. The NOESY walk (Supplementary Fig. S4) confirms the hairpin conformation, and Supplementary Fig. S5 shows that a number of NMR peaks are observed at high RNA concentration because of duplex formation. Supplementary Fig. S6 also shows that the imino resonance chemical shifts are largely unchanged in a higher Na+ buffer (95 mM NaCl and 38 mM sodium phosphate) as a result of N6-methylation, although chemical shift changes close to the methylation site are observed because of the proximity of the methyl group (Supplementary Table S7). Additionally, we tested whether Mg2+ alters the conformation of the N6-methylated sequence differently than the unmethylated sequence. The Mg2+ titration in Supplementary Fig. S7 shows that the imino resonances are similarly affected for the two sequences. The U10 imino resonance shifts by ~0.2 ppm in both sequences, and this was resolved by NOESY spectra (Supplementary Fig. S8). Taken together, the modeling and experimental data show that the MALAT1 RNA conformation is not directly switched by N6-methylation. Instead, the methylation poises the RNA to be more accessible to HNRNPC binding.
Transcriptome-wide predictions with m6A
To further test our m6A nearest neighbor parameters and software, we predicted structures for 18,026 mRNAs that were identified as having N6A methylation by whole transcriptome sequencing61 and for which PARS structure mapping data are available62. We used the nearest neighbor parameters and RNAstructure package to estimate the probability that the methylation site is buried in a helix, i.e., in a base pair stacked between two other base pairs, for both the unmethylated and methylated sequence (Fig. 4B). We used 800 nucleotide fragments of local sequence to estimate the pairing probability because we previously found that pairing probability estimates for 800 nucleotide fragments closely match those for global secondary structure prediction28. This is a reasonable balance between accuracy and total calculation time.
We find that the unmethylated A at the methylation site is less likely to be buried in a helix than adjacent nucleotides (Fig. 4B). This is intuitive because adjacent nucleotides at the consensus site are often G or C, and A is more predominant in loops in RNAs with known structure. There is a substantial shift in the probability of m6A being buried in a helix relative to A (21% for A and 13% for m6A). This suggests there could be widespread structural switching being affected by N6-methylation. We can also compare our results to PARS data for the same sequences (Fig. 4C)36,62. A PARS score quantifies the enzymatic cleavage estimate of local pairing and the experiment is performed transcriptome wide. A lower PARS score indicates greater nuclease S1 cleavage relative to nuclease V1 and thus a greater extent of unpairing because nuclease S1 has specificity for loops and nuclease V1 has specificity for helices63. The PARS scores at the methylation site also demonstrate a propensity to be unpaired at the methylation site, but the minimum average PARS score is at the nucleotide 5′ to the m6A site. A possible explanation for the discrepancy is that PARS attributes S1 cleavages to the base 5′ to the cleavage site, assuming that the base 5′ to the cleavage is unpaired. Cleavage can also occur when the base 3′ to the cleavage site is unpaired and therefore the PARS scores 5′ to the methylation site might be overestimating the propensity of being unpaired, in that some of the propensity of being unpaired should be attributed to the methylation site. For example, the prior S1 mapping of 5S rRNA structure is consistent with cleavages both 5′ and 3′ to unpaired nucleotides (Supplementary Fig. S9)64. Prior analysis of PARS scores for methylation sites also concluded that the data indicate the m6A is positioned in structures at the transition between base paired regions and loop regions, consistent with our structure prediction estimates36.
Discussion
Here we provide the complete nearest neighbor model for a folding alphabet including modified nucleotides. Because m6A is considered the most abundant modification in mRNA and is known to affect folding stability, we chose m6A as the modification to study. The full nearest neighbor model for secondary structure prediction requires both helical stack parameters and also loop parameters. We know from a sensitivity analysis of secondary structure prediction that, for loops, accurate parameters are most important for dangling ends and terminal mismatches42,43, accordingly we focused our experimental effort on these motifs. We also observed marginal differences in stability for hairpin and internal loops containing m6A as compared to the same sequences without the N6-methylation. Subsequent studies could be focused on understanding and modeling folding stability differences for loops with m6A.
The other component of this study was advancing RNA-structure to work with sequences with nucleotides beyond A, C, G, and U. We provide command line tools that are ready to make quantitative predictions of structure and folding stability for sequences with m6A. The software is available for free download under the GNU GPL 2 at https://rna.urmc.rochester.edu/RNAstructure.html. Given the software, we plan expand our work in the future to include alphabets with inosine and pseudouridine. Both have helical nearest neighbor parameters available for stacks on Watson–Crick pairs37,38, and both could be extended to full nearest neighbor parameters sets with additional optical melting experiments. The updated software also makes it possible to take advantage of engineered65,66 or natural67 modifications in designs of sequences for nanostructures or catalysts and a wide range of applications in biomedicine and biotechnology68.
The two loops studied here with N6-methylations both had marginally less folding stability than the analogous unmethylated loops (Supplementary Table S4). Solution structures are available for each of the A-containing loops, and these structures provide clues as to why the stabilities would be only marginally changed by methylation. The hairpin loop, GGCGUAAUAGCC, has the first A in the loop (A6; the site of our m6-methylation) stacked at the apex of the loop on the adjacent A (A7)69. Because A6 is not hydrogen bonding in the structure, a methylation at N6 can be accommodated in the preferred syn orientation by the structure without change70. For the internal loop with tandem G-A pairs, the pairs are trans-sugar-Hoogsteen pairs, i.e., the N6 position of the A is hydrogen bonded with the G at the N3 position71. For each methylated A, one hydrogen of N6 is available to form this hydrogen bond, placing the methyl in the preferred syn orientation70. However, the second hydrogen of A N6 is close to O4’ of the G (ranging from 2.34 to 3.36 Å in the 15 deposited NMR models). A crystal structure with this motif shows that N6 methylation disrupts pairing, with the A N6 hydrogen bonding to the O2′ of the opposite G72. Interestingly, this loss of pairing cost only 0.33 kcal/mol of folding stability, suggesting that conformational rearrangements do not necessarily result in a large loss of folding stability.
Recent studies demonstrated the ability of computational methods to estimate folding free energy changes73,74,75,76,77,78. In this work, we performed optical melting experiments to determine the folding stabilities of small model systems with m6A and fit nearest neighbor parameters to these data. Future work, however, could rely on computation or a mixture of computation and experimentation. Hopfinger et al., for example, estimated helical stacking nearest neighbor parameters for the eight stacks with m6A-U pairs adjacent to Watson–Crick pairs73. Overall the agreement of their estimates against our experimental values is excellent, with a root mean squared deviation of 0.30 kcal/mol. The largest single deviation is for a U-m6A pair followed by a G-C pair, where their estimate overstabilized the stack by 0.6 kcal/mol (Supplementary Fig. S10). Loop folding stabilities continue to be more of a challenge to estimate using computational methods because the conformational flexibility requires extensive sampling76.
With this work, we demonstrate the position of m6A in a structure determines whether folding stability is increased, decreased, or unchanged relative to the same structure with A. It was previously known that N6-methylation of an A-U pair in the middle of a helix would decrease the helix folding stability34,36. Our stacking parameters now quantify this sequence-dependent change (Fig. 2A). It was also previously known that m6A stacking on the end of a helix would stabilize the helix more than an analogous A. In this work, we also discovered that an m6A-U base pair at the terminal position of a helix provides roughly the same folding stability as an analogous A-U base pair. This is because terminal A-U pairs destabilize helices with a penalty of +0.45 kcal/mol44 that is not needed for terminal m6A-U base pairs (Fig. 2B). Recently, it was also discovered that terminal G-U base pairs in helices do not need an end penalty79. These results, taken together, show why N6-methylation is a potent switch of secondary structure.
Our transcriptome-wide calculations also suggest that structure switches from N6-methylation might be widespread (Fig. 4B). It will be interesting to perform similar calculations with other widespread covalent modifications, such as inosine. There is potential to identify structural mechanisms by which covalent modifications exert changes in protein binding, transcript stability, or gene expression.
Methods
Synthesis of oligonucleotides with m6A
Oligoribonucleotides were synthesized on a BioAutomation MerMade12 DNA/RNA synthesizer using β-cyanoethyl phosphoramidite chemistry and commercially available RNA phosphoramidites (ChemGenes, GenePharma) and protected N6-methyladenosine phosphoramidite, which was synthetized according to a standard protocol. Synthesis of N6-methyladenosine was conducted via Dimroth rearrangement followed by protection of the 5′-hydroxyl with dimethoxytrityl and 2′-hydroxyl with tert-butyldimethylsilyl. Next, 5′- and 2′-protected N6-methyladenosine was treated with 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphorodiamidite80,81. Oligoribonucleotides were deprotected with aqueous ammonia/ethanol (3/1 v/v) for 16 h at 55 °C. Silyl protecting groups were cleaved by treatment triethylamine trihydrofluoride. Deprotected oligonucleotides were purified by silica gel thin layer chromatography in 1-propanol/aqueous ammonia/water (55/35/10 v/v/v)44,81.
Optical melting data
The thermodynamic measurements were performed for nine various concentrations of RNA duplex in the range of 0.1 mM to 1 µM in buffer containing 1 M sodium chloride, 20 mM sodium cacodylate, and 0.5 mM Na2EDTA, pH 7. A subset of additional optical melting experiments (Supplementary Table S5B) was performed in a buffer containing 150 mM KCl, 20 mM cacodylic acid, and 5 mM MgCl2, pH corrected to 7 using KOH. Oligonucleotide single strand concentrations were calculated from the absorbance above 80 °C and single strand extinction coefficients were approximated by a nearest neighbor model82. Absorbance vs. temperature melting curves were measured at 260 nm with a heating rate of 1 °C/min from 0 to 90 °C on JASCO V-650 spectrophotometer with a thermoprogrammer. The melting curves were analyzed and the thermodynamic parameters calculated from a two-state model with the program MeltWin 3.552. For most model RNAs, the ∆H° derived from TM−1 vs. ln(CT/a) plots, where a is 4 for non-self-complementary and a is 1 for self-complementary duplexes, is within 15% of that derived from averaging the fits to individual melting curves, as expected if the two-state model is reasonable. Supplementary Fig. S11 shows the UV absorbance as a function of temperature and the TM−1 vs. ln(CT/a) plots for 5′CGGUGCm6AUCG2 in a buffer with 1 M NaCl, 5′GGCAGm6ACUC/3′CCGCUGAG in a buffer with 1 M NaCl, and 5′GGCAGm6ACUC/3′CCGCUGAG in a buffer with 150 mM KCl and 5 mM MgCl2.
Linear regression
Linear least-squares fitting to determine RNA stacking stabilities was performed with a custom Python program using the statsmodels ordinary least-squares class83. For each duplex, to determine the stabilities to be fit, the fixed terms were subtracted, including the stability of base pair stacks with Watson–Crick and G-U pairs only, the duplex initiation term, the terminal A-U penalty term (when needed), and the symmetry term (when needed). The free energy changes from the TM−1 vs. ln(CT/a) fits of the optical melting data were used. The fit was excellent, with coefficient of determination, R2, of 0.984. Uncertainty estimates (Fig. 2A and Supplementary Table S2) are the standard errors of the regression. Supplementary Table S8 shows the stability to be fit and the estimate of the fit. Supplementary Table S9 shows the number of occurrences of each stacking parameter in the set of fit helices. The Python code for fitting nearest neighbor parameters is provided as Supplementary Software 1.
Loop motif stability calculations
Loop motif stabilities (Supplementary Table S4) are calculated by subtracting the helical component of stability. The free energy changes from the TM−1 vs. ln(CT/a) fits of the optical melting data were used.
For the dangling ends and terminal mismatches, twice the stability increment of the motif is determined by subtracting a reference helix stability from the stability of the duplex with the motif:
The factor of two is present because the self-complementary duplexes have two instances of the motif.
For the hairpin loop, the stability of the loop motif is determined by subtracting the stability of the helical stacks (estimated with nearest neighbor parameters) from the total stability:
The total helical stack stability is reported as the Reference ΔG°37 in Supplementary Table S4.
For the internal loop, the stability is the total stability of the duplex minus the helical stacks and helix initiation (estimated with nearest neighbor parameters) and minus the stability cost of symmetry (because the duplex is self-complementary):
The Reference ΔG°37 reported in Supplementary Table S4 is the sum of the helical stacks and symmetry free energy increments.
Error propagation
To estimate uncertainties in free energies (σ), we propagate uncertainty estimates for experiments and nearest neighbor parameters using the standard method for uncorrelated parameters:
where ΔG°i is the ith term (or experimental value) and σi is the uncertainty in the ith term43. For the sum of terms used here, this simplifies to:
where ni is the number of occurrences of the ith parameter or the ith experiment.
For uncertainty estimates for optical melting experiments, we use 4% of the magnitude of the ΔG°37. This was chosen as a conservative estimate of the precision of optical melting by Xia et al.44. It is twice the mean difference in free energies determined using the two fit methods for optical melting data (Average of Curve Fits and Analysis of TM Dependence) for a database of optical melting experiments.
Nearest neighbor parameter determination
Nearest neighbor parameters were developed to estimate the folding stability (ΔG°37) of sequences with A, C, G, U, and m6A. Nearest neighbor parameters are inherited from the 2004 Turner Rules33, for which a summary of their derivation can be found in Zuber et al.42 and examples for their use are available on the Nearest Neighbor Database website. Helical stacking tables are from Xia et al.44 for Watson–Crick stacks and from Chen et al.79 for stacks that contain G-U pairs, supplemented with the stacks determined for m6A-U pairs in this work. Following Chen et al., terminal G-U base pairs in a helix are not penalized.
Dangling end m6As are stabilized as compared to the analogous A dangling end by the mean additional stability found here (−0.4 kcal/mol). Dangling ends on m6A-U pairs are assumed to be the same stability as dangling ends on A-U base pairs. When the stability is measured by an experiment, the measured value is used (Supplementary Table S4).
Terminal mismatches involving m6A are estimated to be more stable than the analogous A terminal mismatch by the mean value found for the terminal mismatches in this study (−0.3 kcal/mol). M6A-m6A terminal mismatches receive only −0.3 kcal/mol additional stability. A terminal mismatch on an m6A-U pair is also stabilized by −0.3 kcal/mol compared to the analogous mismatch on an A-U pair. These effects are additive; an m6A-containing terminal mismatch on an m6A-U pair receives an additional −0.6 kcal/mol stability than the analogous terminal mismatch with all A parameters. When the stability is measured by an experiment, the measured value is used (Supplementary Table S4).
Hairpin, internal, and bulge loop initiation costs are length-dependent33. The same length-dependent costs are used here, which assumes that m6A does not alter the initiation costs.
In total, 1 × 1, 2 × 1, and 2 × 2 internal loop stabilities are stored in lookup tables. The stabilities for loops with unpaired m6A are taken from the analogous loops with A. And m6A-U-closed loops are taken from analogous A-U-closed loops with one change. A-U-closed loops have a 0.7 kcal/mol stability penalty per closure33; for m6A-U-closed loops, this cost has been removed compared to the analogous A-U-closed loop. Larger internal loops use a terminal stacking table to assign a stability increment for the sequence of the closing pair and first mismatch. Separate tables are used for loops of size 1 × n, 2 × 3, and (>2) × (>2)33. These terminal stack tables use the analogous A parameter for stacks with m6A. The one exception is that the +0.7 kcal/mol internal loop A-U pair closure penalty is removed for m6A-U closures.
Hairpin loop tables for triloop, tetraloops, and hexaloops are unchanged. These tables include stabilities for specific hairpin sequences known by experiment to not be well predicted using nearest neighbor rules33. Other hairpin loops are estimated with the sum of a terminal mismatch and a length-dependent initiation. The terminal mismatches for m6A use the analogous A parameter.
Multibranch loop initiation parameters are from an experimental fit using a simple linear model. Coaxial stacking is included in multibranch and exterior loops33. Coaxial stacking between two adjacent helices is assumed to be as stable as a helical stack. For coaxial stacks with an intervening mismatch, there are two stacks. The coaxial stacking increment for the stack where the backbone is not continuous was previously found to be independent of sequence, and the sequence-independent value is used here for stacks involving one or more m6As. The other stack is identical to the terminal mismatch stack table.
Extended alphabet implementation in RNAstructure
RNAstructure is a software package written in C++, with a C++ class library that is also wrapped using SWIG to be available to JAVA or Python programs40. It is open source and provided for free under the GNU GPL license version 2 at https://rna.urmc.rochester.edu. A number of the command line programs have been updated to be capable of using extended alphabets, including Fold (secondary structure prediction by free energy minimization), efn2 (estimation of folding free energy changes for secondary structures), and partition (partition function calculations for estimating pair, motif, or structure probabilities). A number of programs that rely on the partition function calculations are therefore also able to consider extended alphabets, including design (design of a sequence to fold to a specific secondary structure), EnsembleEnergy (calculation of the ensemble folding free energy change), MaxExpect (prediction of maximum expected accuracy structures), ProbKnot (prediction of structures that can include pseudoknots), ProbScan (estimation of motif probabilities), and stochastic (stochastic sampling from the Boltzmann ensemble).
The underlying secondary structure prediction algorithms remain unchanged, although substantial changes were made to expand the software from the four nucleotide nucleic acid alphabet to a fully user-customizable folding alphabet. To do this, the command line tools read the thermodynamic parameters at startup. The switch “--alphabet” is used to specify the set of parameters to be used. The default is “rna”, the current (2004) Turner rules for estimating RNA folding free energy changes33,44. Included with the latest RNAstructure release (version 6.3) is also “m6A”, the parameters discussed here, and “dna”, a set of nearest neighbor rules for DNA secondary structure prediction. The files are a plain text format that was updated (in version 6.0) for extended alphabets. The specification file (Supplementary Fig. S2) is read first, and it defines the alphabet and base pairs. Dynamic memory allocation is used to provide the memory needed to store the tables. The parameters themselves are then read from the files.
The 2004 Turner rules gave a terminal base pair penalty for any base pair (A-U or G-U) at the end of a helix that contained a U33,44. In this work, we found that terminal m6A-U pairs did not require this terminal base pair penalty. Additionally, the revised G-U stack parameters79, used with the m6A parameters we derived, do not require a terminal base pair penalty. Therefore, we changed the implementation of the energy function to account for this change. The default “rna” rules are unchanged and still penalize terminal G-U base pairs.
Chemical mapping of RNA and data analysis
DMS (to modify adenosine and cytidine), CMCT (to modify uridine and guanosine) and kethoxal (to modify guanosine) were used to chemically map the secondary structure of the 32 nucleotide RNA (with a 3′-structural cassette). The RNA (5′AACUUAAUGUUUUUGCAUUGGACUUUGAGUUACCUUCCGGGCUUCGGUCCGGAAC) was synthesized using the phosphoramidite method on a MerMade synthesizer, deprotected, and purified on a 12% denaturing gel. The RNA contained a structure cassette at the 3′ end (underlined), which was designed using RNAstructure to fold independently and allow readout of whole structure of studied RNA. The RNA contained C16-2′-OMe instead of a standard C nucleotide at position 16, introduced to prevent nonenzymatic spontaneous cleavage between C16 and A1784. For each reaction, 10 pmol of RNA was folded in buffer containing 300 mM NaCl, 10 mM Tris-HCl, 5 mM MgCl2 pH 8.0. Briefly, the appropriate amount of RNA was diluted in H2O and heated 3 min in 80 °C followed by slow cooling. Then, at 50 °C a concentrated buffer was added to the final buffer solution and the sample was continuously slowly cooled. After 10 min incubation at 4 °C, chemical mapping was conducted using two concentrations of each reagent. To a 9 μl sample, 1 μl of 300 mM or 160 mM DMS in ethanol was added to give a final concentration of 30 or 15 mM DMS. For modification with CMCT, 9 μl of CMCT solution was added to the 9 μl of RNA sample. CMCT was diluted in a folding buffer to give a final concentration of 250, and 100 mM in the reaction mixture. Kethoxal was diluted in ethanol/water (1:3 v/v) to give a final concentration of 160 and 80 mM. After modification with kethoxal, 3 µl of 35 mM potassium borate solution was added to stabilize the products of modification. Chemical modification reactions were incubated for 1.5 h at 4 °C. Reactions were stopped by precipitation with ethanol. The chemical modification reactions were repeated for a total of two replicates of each agent. The RNA in control reactions were treated the same, except no chemical reagents were added.
Modification sites were identified by primer extension. The DNA primer for reverse transcription (RT) was synthesized with 6-fluorescein (FAM) on the 5′ end (5′FAMGTTCCGGACCGAAGCCCG). The DNA primer was complementary to 3′ end of RNA (the cassette part). For each RT reaction, 10 pmol of primer was used. Primer extension was performed at 55 °C with SuperScript III reverse transcriptase using Invitrogen’s protocol. Reactions were stopped by addition of loading buffer containing urea and 10 mM EDTA, then chilling on ice. Prior to separation and readout of cDNA products, the samples were heated for 5 min at 95 °C and then separated on a 12% polyacrylamide denaturing gel (Supplementary Fig. S12).
The gel image from the Phosphorimager was analyzed using the SAFA program to quantify nucleotide reactivities85. cDNA products were identified by comparing to sequencing lanes and to control lanes, and the raw results from SAFA were normalized. To quantify chemical modification at each nucleotide, we first corrected for the background by subtracting the volume integral of the band in the control lane from the volume integral of experimental lane. For each of two experiments for each modification agent and each sequence, we characterized the modification extent by quartiles. When a nucleotide was in the highest quartile of RT stops in both experiments, we report the mapping as strong (Supplementary Fig. S3). When a nucleotide was in the second highest quartile in both experiments or the highest quartile in one and the second highest quartile in the other, we report the cleavage as moderate.
NMR
Methylated and unmodified RNA samples were exchanged into desired buffer for NMR spectroscopy by two 10-fold cycles of dilution followed by centrifugal concentration using Amicon Ultra-4 filter units with 3000 MW cutoff. Final volume was brought to 0.52 ml, including 4% D2O.
NMR spectra were collected with a Varian Inova 600 MHz spectrometer with a standard (RT) triple-resonance triple-axis gradient probe. One dimensional and two dimensional (2D) NMR spectra in 96% H2O/4% D2O were collected using a WATERGATE pulse86,87 with flipback for water suppression at indicated temperatures. NOESY and TOCSY spectra were acquired at 10 °C. NOESY spectra with excitation optimized for imino protons were acquired with mixing times of 50, 150, and 250 ms, and with excitation optimized for aromatic protons and greater indirect resolution with mixing times of 75 and 400 ms. TOCSY spectra (30 ms mixing time) were used to identify pyrimidine H5-H6 cross-peaks and dynamic sugar residues. Spectra from 2D NMR were processed and assigned with NMRpipe88 and NMRFAM-SPARKY89 as described90.
Transcriptome-wide calculations
We downloaded the set of m6A positions reported in the human transcriptome by Schwartz et al.61, which was available as their Supplementary Table S2. Using a Python program, for each entry for the human genome of “high-confidence category” and with a RefSeq entry, we fetched the sequence from RefSeq91 using the Bio.Entrez module from Biopython92. To identify the exact position of the m6A in the transcript, we used the provided hg19 coordinates to identify the A in one of the expected sequence motifs (GGACA, GGACT, GGACC, GAACT, AGACT, AGACA, or TGACT) using the twobitreader Python package and the hg19 sequence downloaded from the UCSC genome browser93. Once the motif was identified in the genome, the sequence was found in the RefSeq sequence, and an 800 nucleotide FASTA sequence was generated with the m6A position at the 401st position. For sequences in which the m6A was too close to the 5′ end or 3′ end to be in the 401st position, up to 800 nucleotides were extracted with the m6A position at either the 5′ end or 3′ end. Sequences were generated with both A and 6 at the m6A position. In total, 18,155 high-confidence m6A sites were found.
Next, the partition function was calculated for each 800 nucleotide sequence using the partition program from RNAstructure40. To determine the probability that the m6A position was buried in a helix, a custom C++ program was written using inheritance of the RNA class40. The probability of the ith nucleotide being buried in a helix is the sum for all j of the probability the i-j base pair is sandwiched between the base pairs (i − 1)-(j + 1) and (i + 1)-(j−1). Each of these can be determined using the partition function, Q, as a normalization factor and partial partition function for interior and exterior fragments:
where Pi is the probability that nucleotide i is buried in a helix, N is the length of the sequence, V′(i,j) is the partition function for the exterior fragment of nucleotides 1 to i to j and to N given that i is paired to j, Kstack(i,j,i + 1,j − 1) is the equilibrium constant for the base pair stack of base pairs i-j and (i + 1)-(j − 1), and V(i,j) is the partition function for the interior fragment from nucleotides i to j given that i is paired to j. Supplementary Fig. S13 diagrams V′ and V. These arrays of partition functions for sequence fragments are also explained in a description of the partition function calculation94.
PARS calculations
To calculate PARS scores for human transcripts, we downloaded the dataset deposited by Wan et al.62 to the NCBI GEO (Gene Expression Omnibus)95. We used the mapped reads available for S1-treated (accessions GSM1226157, GSM1226159, and GSM1226161) and V1-treated (accessions GSM1226158, GSM1226160, and GSM1226162) samples. We calculated the PARS score using62:
where PARSi is the PARS score for the ith nucleotide, V1i is the number of reads in the V1-treated samples attributed to the ith nucleotide, S1i is the number of reads in the S1-treated samples attributed to the ith nucleotide, S1total is the total number of S1-treated sample reads, and V1total is the total number of V1-treated sample reads. The ratio of S1total and V1total is a normalization factor. The addition of 5 in the numerator and denominator is a pseudocount to reduce the magnitude of scores for positions with few reads62. In total, entries were found for 18,026 transcripts of the 18,155 high-confidence m6A-containg transcripts found.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Data availability
The results of the optical melting experiments needed to reproduce the results in this study are provided in the Supplementary Materials (Supplementary Tables S1 and S3). The raw data are available from the corresponding authors upon request. The nearest neighbor parameters are available as Supplementary Materials as Supplementary Software 2 and as part of the RNAstructure software package.
Code availability
RNAstructure is provided under the GPL V2 license, and it is therefore free and open source. It can be downloaded at http://rna.urmc.rochester.edu/RNAstructure.html. The nearest neighbor fitting code is available as Supplementary Materials.
References
Phizicky, E. M. & Hopper, A. K. tRNA biology charges to the front. Genes Dev. 24, 1832–1860 (2010).
Li, X., Xiong, X. & Yi, C. Epitranscriptome sequencing technologies: decoding RNA modifications. Nat. Methods 14, 23–31 (2016).
Gilbert, W. V., Bell, T. A. & Schaening, C. Messenger RNA modifications: form, distribution, and function. Science 352, 1408–1412 (2016).
Sakurai, M. et al. A biochemical landscape of A-to-I RNA editing in the human brain transcriptome. Genome Res. 24, 522–534 (2014).
Carlile, T. M. et al. Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells. Nature 515, 143–146 (2014).
Schwartz, S. et al. Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell 159, 148–162 (2014).
Lovejoy, A. F., Riordan, D. P. & Brown, P. O. Transcriptome-wide mapping of pseudouridines: pseudouridine synthases modify specific mRNAs in S. cerevisiae. PLoS ONE 9, e110799 (2014).
Squires, J. E. et al. Widespread occurrence of 5-methylcytosine in human coding and non-coding RNA. Nucleic Acids Res. 40, 5023–5033 (2012).
Schwartz, S. et al. High-resolution mapping reveals a conserved, widespread, dynamic mRNA methylation program in yeast meiosis. Cell 155, 1409–1421 (2013).
Linder, B. et al. Single-nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome. Nat. Methods 12, 767–772 (2015).
Ke, S. et al. A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation. Genes Dev. 29, 2037–2053 (2015).
Dominissini, D. et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201–206 (2012).
Meyer, K. D. et al. Comprehensive analysis of mRNA methylation reveals enrichment in 3′ UTRs and near stop codons. Cell 149, 1635–1646 (2012).
Chen, K. et al. High-resolution N(6) -methyladenosine (m(6) A) map using photo-crosslinking-assisted m(6) A sequencing. Angew. Chem. Int. Ed. Engl. 54, 1587–1590 (2015).
Esteller, M. & Pandolfi, P. P. The epitranscriptome of noncoding RNAs in cancer. Cancer Disco. 7, 359–368 (2017).
Pan, T. N6-methyl-adenosine modification in messenger and long non-coding RNA. Trends Biochem. Sci. 38, 204–209 (2013).
Zaccara, S., Ries, R. J. & Jaffrey, S. R. Reading, writing and erasing mRNA methylation. Nat. Rev. Mol. Cell Biol. 20, 608–624 (2019).
Zhou, K. I., Liu, N. & Pan, T. Identification of N(6)-methyladenosine reader proteins. Methods 126, 105–111 (2017).
Zhao, B. S., Roundtree, I. A. & He, C. Post-transcriptional gene regulation by mRNA modifications. Nat. Rev. Mol. Cell Biol. 18, 31–42 (2017).
Roundtree, I. A., Evans, M. E., Pan, T. & He, C. Dynamic RNA modifications in gene expression regulation. Cell 169, 1187–1200 (2017).
Micura, R. et al. Methylation of the nucleobases in RNA oligonucleotides mediates duplex-hairpin conversion. Nucleic Acids Res. 29, 3997–4005 (2001).
Lewis, C. J., Pan, T. & Kalsotra, A. RNA modifications and structures cooperate to guide RNA-protein interactions. Nat. Rev. Mol. Cell Biol. 18, 202–210 (2017).
Zhou, K. I. et al. Regulation of co-transcriptional Pre-mRNA splicing by m(6)A through the low-complexity protein hnRNPG. Mol. Cell 76, 70–81 e79 (2019).
Hofacker, I. L. Energy-directed RNA structure prediction. Methods Mol. Biol. 1097, 71–84 (2014).
Seetin, M. G. & Mathews, D. H. RNA structure prediction: an overview of methods. Methods Mol. Biol. 905, 99–122 (2012).
Tanzer, A., Hofacker, I. L. & Lorenz, R. RNA modifications in structure prediction—status quo and future challenges. Methods 156, 32–39 (2019).
Long, D. et al. Potent effect of target structure on microRNA function. Nat. Struct. Mol. Biol. 14, 287–294 (2007).
Lu, Z. J. & Mathews, D. H. Efficient siRNA selection using hybridization thermodynamics. Nucleic Acids Res. 36, 640–647 (2007).
Tafer, H. et al. The impact of target site accessibility on the design of effective siRNAs. Nat. Biotechnol. 26, 578–583 (2008).
Li, X., Quon, G., Lipshitz, H. D. & Morris, Q. Predicting in vivo binding sites of RNA-binding proteins using mRNA secondary structure. RNA 16, 1096–1107 (2010).
Gruber, A. R., Findeiss, S., Washietl, S., Hofacker, I. L. & Stadler, P. F. RNAz 2.0: Improved noncoding RNA detection. Pac. Symp. Biocomput. 15, 69–79 (2010).
Fu, Y., Xu, Z., Lu, Z. J., Zhao, S. & Mathews, D. H. Discovery of novel ncRNA sequences in multiple genome alignments on the basis of conserved and stable secondary structures. PLoS ONE 10, e0130200 (2015).
Mathews, D. H. et al. Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc. Natl Acad. Sci. USA 101, 7287–7292 (2004).
Kierzek, E. & Kierzek, R. The thermodynamic stability of RNA duplexes and hairpins containing N6-alkyladenosines and 2-methylthio-N6-alkyladenosines. Nucleic Acids Res. 31, 4472–4480 (2003).
Kierzek, E., Mathews, D. H., Ciesielska, A., Turner, D. H. & Kierzek, R. Nearest neighbor parameters for Watson-Crick complementary heteroduplexes formed between 2’-O-methyl RNA and RNA oligonucleotides. Nucleic Acids Res. 34, 3609–3614 (2006).
Roost, C. et al. Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J. Am. Chem. Soc. 137, 2107–2115 (2015).
Wright, D. J., Rice, J. L., Yanker, D. M. & Znosko, B. M. Nearest neighbor parameters for inosine x uridine pairs in RNA duplexes. Biochemistry 46, 4625–4634 (2007).
Wright, D. J., Force, C. R. & Znosko, B. M. Stability of RNA duplexes containing inosine.cytosine pairs. Nucleic Acids Res. 46, 12099–12108 (2018).
Hudson, G. A., Bloomingdale, R. J. & Znosko, B. M. Thermodynamic contribution and nearest-neighbor parameters of pseudouridine-adenosine base pairs in oligoribonucleotides. RNA 19, 1474–1482 (2013).
Reuter, J. S. & Mathews, D. H. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinform. 11, 129 (2010).
Rivas, E. The four ingredients of single-sequence RNA secondary structure prediction. A unifying perspective. RNA Biol. 10, 1185–1196 (2013).
Zuber, J., Cabral, B. J., McFadyen, I., Mauger, D. M. & Mathews, D. H. Analysis of RNA nearest neighbor parameters reveals interdependencies and quantifies the uncertainty in RNA secondary structure prediction. RNA 24, 1568–1582 (2018).
Zuber, J., Sun, H., Zhang, X., McFadyen, I. & Mathews, D. H. A sensitivity analysis of RNA folding nearest neighbor parameters identifies a subset of free energy parameters with the greatest impact on RNA secondary structure prediction. Nucleic Acids Res. 45, 6168–6176 (2017).
Xia, T. et al. Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson-Crick pairs. Biochemistry 37, 14719–14735 (1998).
Liu, B. et al. A potentially abundant junctional RNA motif stabilized by m(6)A and Mg(2). Nat. Commun. 9, 2761 (2018).
Gokhale, N. S. et al. N6-methyladenosine in flaviviridae viral RNA genomes regulates infection. Cell Host Microbe 20, 654–665 (2016).
Blose, J. M. et al. Non-nearest-neighbor dependence of the stability for RNA bulge loops based on the complete set of group I single-nucleotide bulge loops. Biochemistry 46, 15123–15135 (2007).
Kent, J. L. et al. Non-nearest-neighbor dependence of stability for group III RNA single nucleotide bulge loops. RNA 20, 825–834 (2014).
Leamy, K. A., Assmann, S. M., Mathews, D. H. & Bevilacqua, P. C. Bridging the gap between in vitro and in vivo RNA folding. Q Rev. Biophys. 49, e10 (2016).
Diamond, J. M., Turner, D. H. & Mathews, D. H. Thermodynamics of three-way multibranch loops in RNA. Biochemistry 40, 6971–6981 (2001).
Jaeger, J. A., Zuker, M. & Turner, D. H. Melting and chemical modification of a cyclized self-splicing group I intron: similarity of structures in 1 M Na+, in 10 mM Mg2+, and in the presence of substrate. Biochemistry 29, 10147–10158 (1990).
McDowell, J. A. & Turner, D. H. Investigation of the structural basis for thermodynamic stabilities of tandem GU mismatches: Solution structure of (rGAGGUCUC)2 by two-dimensional NMR and simulated annealing. Biochemistry 35, 14077–14089 (1996).
Xia, T., McDowell, J. A. & Turner, D. H. Thermodynamics of nonsymmetric tandem mismatches adjacent to G.C base pairs in RNA. Biochemistry 36, 12486–12487 (1997).
Schroeder, S. J. & Turner, D. H. Factors affecting the thermodynamic stability of small asymmetric internal loops in RNA. Biochemistry 39, 9257–9274 (2000).
Jiang, T., Kennedy, S. D., Moss, W. N., Kierzek, E. & Turner, D. H. Secondary structure of a conserved domain in an intron of influenza A M1 mRNA. Biochemistry 53, 5236–5248 (2014).
Serra, M. J. et al. Effects of magnesium ions on the stabilization of RNA oligomers of defined structures. RNA 8, 307–323 (2002).
Liu, N. et al. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature 518, 560–564 (2015).
Cienikova, Z., Damberger, F. F., Hall, J., Allain, F. H. & Maris, C. Structural and mechanistic insights into poly(uridine) tract recognition by the hnRNP C RNA recognition motif. J. Am. Chem. Soc. 136, 14536–14544 (2014).
Mathews, D. H., Burkard, M. E., Freier, S. M., Wyatt, J. R. & Turner, D. H. Predicting oligonucleotide affinity to nucleic acid targets. RNA 5, 1458–1469 (1999).
Zhou, K. I. et al. N(6)-methyladenosine modification in a long noncoding RNA hairpin predisposes its conformation to protein binding. J. Mol. Biol. 428, 822–833 (2016).
Schwartz, S. et al. Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5’ sites. Cell Rep. 8, 284–296 (2014).
Wan, Y. et al. Landscape and variation of RNA secondary structure across the human transcriptome. Nature 505, 706–709 (2014).
Sloma, M. F. & Mathews, D. H. Improving RNA secondary structure prediction with structure mapping data. Methods Enzymol. 553, 91–114 (2015).
Speek, M. & Lind, A. Structural analyses of E. coli 5S RNA fragments, their associates and complexes with proteins L18 and L25. Nucleic Acids Res. 10, 947–965 (1982).
Hoshika, S. et al. Hachimoji DNA and RNA: A genetic system with eight building blocks. Science 363, 884–887 (2019).
Wang, X. et al. Biophysics of artificially expanded genetic information systems. Thermodynamics of DNA duplexes containing matches and mismatches involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P). ACS Synth. Biol. 6, 782–792 (2017).
Boccaletto, P. et al. MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic Acids Res. 46, D303–D307 (2018).
Jasinski, D., Haque, F., Binzel, D. W. & Guo, P. Advancement of the emerging field of RNA nanotechnology. ACS Nano 11, 1142–1164 (2017).
Fountain, M. A., Serra, M. J., Krugh, T. R. & Turner, D. H. Structural features of a six-nucleotide RNA hairpin loop found in ribosomal RNA. Biochemistry 35, 6539–6548 (1996).
Engel, J. D. & von Hippel, P. H. Effects of methylation on the stability of nucleic acid conformations: studies at the monomer level. Biochemistry 13, 4143–4158 (1974).
Tolbert, B. S., Kennedy, S. D., Schroeder, S. J., Krugh, T. R. & Turner, D. H. NMR structures of (rGCUGAGGCU)2 and (rGCGGAUGCU)2: probing the structural features that shape the thermodynamic stability of GA pairs. Biochemistry 46, 1511–1522 (2007).
Huang, L., Ashraf, S., Wang, J. & Lilley, D. M. Control of box C/D snoRNP assembly by N(6)-methylation of adenine. EMBO Rep. 18, 1631–1645 (2017).
Hopfinger, M. C., Kirkpatrick, C. C. & Znosko, B. M. Predictions and analyses of RNA nearest neighbor parameters for modified nucleotides. Nucleic Acids Res. 48, 8901–8913 (2020).
Chou, F. C., Kladwang, W., Kappel, K. & Das, R. Blind tests of RNA nearest-neighbor energy prediction. Proc. Natl Acad. Sci. USA 113, 8430–8435 (2016).
Sakuraba, S., Asai, K. & Kameda, T. Predicting RNA duplex dimerization free-energy changes upon mutations using molecular dynamics simulations. J. Phys. Chem. Lett. 6, 4348–4351 (2015).
Smith, L. G. et al. Chemically accurate relative folding stability of RNA hairpins from molecular simulations. J. Chem. Theory Comput. 14, 6598–6612 (2018).
Spasic, A., Serafini, J. & Mathews, D. H. The Amber ff99 force field predicts relative free energy changes for RNA duplex formation. J. Chem. Theory Comput. 8, 2497–2505 (2012).
Hurst, T. & Chen, S. J. Deciphering nucleotide modification-induced structure and stability changes. RNA Biol. 18, 1–11 (2021).
Chen, J. L. et al. Testing the nearest neighbor model for canonical RNA base pairs: revision of GU parameters. Biochemistry 51, 3508–3522 (2012).
Kierzek, R. et al. Polymer-supported synthesis and its application to test the nearest-neighbor model for duplex stability. Biochemistry 25, 7840–7846 (1986).
Kierzek, E. & Kierzek, R. The synthesis of oligoribonucleotides containing N6-alkyladenosines and 2-methylthio-N6-alkyladenosines via post-synthetic modification of precursor oligomers. Nucleic Acids Res. 31, 4461–4471 (2003).
Borer, P. N. in Handbook of Biochemistry and Molecular Biology: Nucleic Acids (ed Fasman, G. D.) 589 (CRC Press, 1975).
Seabold, S. & Perktold, J. in Proceedings of the 9th PYTHON in Science Conference (SCIPY 2010). 92–96.
Kierzek, R. Hydrolysis of oligoribonucleotides: influence of sequence and length. Nucleic Acids Res. 20, 5073–5077 (1992).
Das, R., Laederach, A., Pearlman, S. M., Herschlag, D. & Altman, R. B. SAFA: semi-automated footprinting analysis software for high-throughput quantification of nucleic acid footprinting experiments. RNA 11, 344–354 (2005).
Piotto, M., Saudek, V. & Sklenar, V. Gradient-tailored excitation for single-quantum NMR spectroscopy of aqueous solutions. J. Biomol. NMR 2, 661–665 (1992).
Grzesiek, S. & Bax, A. The importance of not saturating water in protein NMR. Application to sensitivity enhancement and NOE measurements. J. Am. Chem. Soc. 115, 12593–12594 (1993).
Delaglio, F. et al. NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR 6, 277–293 (1995).
Lee, W., Tonelli, M. & Markley, J. L. NMRFAM-SPARKY: enhanced software for biomolecular NMR spectroscopy. Bioinformatics 31, 1325–1327 (2015).
Kauffmann, A. D., Kennedy, S. D., Zhao, J. & Turner, D. H. Nuclear magnetic resonance structure of an 8 x 8 nucleotide RNA internal loop flanked on each side by three Watson-Crick pairs and comparison to three-dimensional predictions. Biochemistry 56, 3733–3744 (2017).
Pruitt, K. D., Tatusova, T. & Maglott, D. R. NCBI reference sequences (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 35, D61–D65 (2007).
Cock, P. J. et al. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 25, 1422–1423 (2009).
Kent, W. J. et al. The human genome browser at UCSC. Genome Res. 12, 996–1006 (2002).
Mathews, D. H. Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization. RNA 10, 1178–1190 (2004).
Barrett, T. et al. NCBI GEO: archive for functional genomics data sets–update. Nucleic Acids Res. 41, D991–D995 (2013).
Acknowledgements
This work was supported by National Institutes of Health grant R01GM076485 to D.H.M. and by National Science Center grants: UMO-2020/01/0/NZ6/00137 to E.K. and UMO-2019/33/B/ST4/01422 to R.K. Calculations were performed at the University of Rochester Center for Integrated Research Computing.
Author information
Authors and Affiliations
Contributions
E.K. designed experiments, synthesized strands, performed optical melting experiments, performed chemical mapping experiments, and revised the manuscript, X.Z. contributed code to RNAstructure, R.M.W. contributed code to RNAstructure, S.D.K. performed and analyzed the NMR experiments, M.S. performed optical melting experiments, R.K. synthesized phosphoramidites and strands and revised the manuscript, D.H.M. designed experiments, contributed code to RNAstructure, fit the nearest neighbor parameters, and drafted the manuscript.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Kierzek, E., Zhang, X., Watson, R.M. et al. Secondary structure prediction for RNA sequences including N6-methyladenosine. Nat Commun 13, 1271 (2022). https://doi.org/10.1038/s41467-022-28817-4
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-022-28817-4
This article is cited by
-
Dissecting the sequence and structural determinants guiding m6A deposition and evolution via inter- and intra-species hybrids
Genome Biology (2024)
-
Molecular targets and strategies in the development of nucleic acid cancer vaccines: from shared to personalized antigens
Journal of Biomedical Science (2024)
-
Tailor made: the art of therapeutic mRNA design
Nature Reviews Drug Discovery (2024)
-
Exploring the challenges of RNAi-based strategies for crop protection
Advanced Biotechnology (2024)
-
Comparative Study of Single-stranded Oligonucleotides Secondary Structure Prediction Tools
BMC Bioinformatics (2023)