Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Autophagy of the m6A mRNA demethylase FTO is impaired by low-level arsenic exposure to promote tumorigenesis

Abstract

Here we show that FTO as an N6-methyladenosine (m6A) RNA demethylase is degraded by selective autophagy, which is impaired by low-level arsenic exposure to promote tumorigenesis. We found that in arsenic-associated human skin lesions, FTO is upregulated, while m6A RNA methylation is downregulated. In keratinocytes, chronic relevant low-level arsenic exposure upregulated FTO, downregulated m6A RNA methylation, and induced malignant transformation and tumorigenesis. FTO deletion inhibited arsenic-induced tumorigenesis. Moreover, in mice, epidermis-specific FTO deletion prevented skin tumorigenesis induced by arsenic and UVB irradiation. Targeting FTO genetically or pharmacologically inhibits the tumorigenicity of arsenic-transformed tumor cells. We identified NEDD4L as the m6A-modified gene target of FTO. Finally, arsenic stabilizes FTO protein through inhibiting p62-mediated selective autophagy. FTO upregulation can in turn inhibit autophagy, leading to a positive feedback loop to maintain FTO accumulation. Our study reveals FTO-mediated dysregulation of mRNA m6A methylation as an epitranscriptomic mechanism to promote arsenic tumorigenicity.

Introduction

Analogous to epigenetic chemical modifications of DNA and histones, RNA modifications regulate RNA fate and gene expression. The most abundant RNA modification is N6-methyladenosine (m6A)1,2,3,4. m6A methylation regulates several aspects of RNA metabolism such as mRNA decay, nuclear processing, translation, transcription, and RNA-protein interactions1,2,3,4,5. m6A modification plays an important role in development, stem cell homeostasis, and diseases such as cancer3,6,7, as well stress response to UV radiation8 or heat shock9. At the molecular level, RNA m6A methylation is installed by writers (methyltransferases), removed by erasers (demethylases), and recognized by readers, a piece of well-coordinated machinery to regulate m6A’s dynamics1,2,3,4. Among these m6A effectors, FTO (fat mass and obesity-associated protein) was the first RNA m6A demethylase discovered10 and has been shown to play oncogenic roles in leukemia11, glioblastoma12, and melanoma13. However, the role of RNA methylation in arsenic-induced skin tumorigenesis remains unclear.

Exposure to inorganic arsenic in contaminated drinking water poses an environmental public health threat for hundreds of millions of people in the US and in the world14,15,16. Arsenic is a natural component of the earth’s crust and is widely distributed throughout the environment. In nature, sources of arsenic exposure include food, air, and water, with the main one being arsenic-contaminated drinking water17. Arsenic is a human carcinogen. Chronic exposure to arsenic can cause skin cancer and several internal cancers such as lung, bladder, and kidney cancer17. A major target organ of arsenic is the skin. Arsenic-induced skin lesions are an early manifestation of arsenic exposure and toxicity18 and are a risk factor for subsequent cancers19. Arsenic seems to act in concert with sunlight exposure, smoking, and occupational exposures in increasing the risk of skin lesions20. At the molecular level, arsenic has been shown to cause oxidative stress, DNA damage, chromosomal aberration, and epigenetic modifications, including DNA methylation and histone modification17,21,22. However, the mechanism by which arsenic causes tumorigenesis is still poorly understood.

In this study, we discovered that chronic low-level arsenic exposure upregulates FTO and downregulates m6A RNA methylation in keratinocytes, and induces malignant transformation and tumorigenesis through FTO and m6A mRNA methylation. Our study reveals that arsenic inhibits autophagy and autophagic degradation of FTO through suppressing p62 transcription, leading to FTO stabilization. Furthermore, FTO forms a positive feedback loop with autophagy inhibition to maintain FTO accumulation in arsenic tumorigenesis. Taken together, these results demonstrate that m6A RNA methylation acts as an epitranscriptomic mechanism for arsenic damage response and tumorigenesis.

Results

FTO is upregulated, while m6A is downregulated, by arsenic in human keratinocytes and in epidermal keratinocytes in human skin

To determine whether m6A RNA methylation and its regulators play a role in arsenic-induced tumorigenicity, we first treated HaCaT cells, a human keratinocyte cell line, continuously with a relevant low level (100 nM) of inorganic arsenite for 28 weeks to generate HaCaT cells with chronic arsenic damage (As cells)23,24 (Supplementary Fig. 1a). Arsenic substantially upregulated FTO and downregulated m6A, while it had moderate or no effect on other m6A regulators, including the m6A methyltransferase proteins METTL14 and METTL3 and the m6A demethylase ALKBH5 (Supplementary Fig. 1b). We found that treatment with a low level of arsenic for up to 72 h upregulated FTO protein and downregulated m6A in HaCaT cells (Fig. 1a and Supplementary Fig. 1c). The effect of arsenic on FTO seemed to be dose-dependent, since only low-level arsenic upregulated FTO, whereas high-level arsenic downregulated FTO (Supplementary Fig. 1d). Similarly, FTO upregulation was also detected in NHEK cells (normal human epidermal keratinocytes) (Fig. 1b).

Fig. 1: FTO is upregulated, while m6A is downregulated by arsenic in human skin and keratinocytes.
figure1

a Immunoblot analysis of FTO and m6A dot blot assay in HaCaT cells treated with arsenic (As) at different doses for 72 h. Methylene blue (MB) staining was used as a loading control. b Immunoblot analysis of FTO in NHEK cells. c Tumor images (upper) and volume (lower) following subcutaneous injection of control and arsenic-treated cells (As) (5 × 106) in nude mice (n = 4). d Immunoblot analysis of FTO and m6A dot blot assay in control, As, and the four As-T cells. Methylene blue (MB) staining was used as a loading control. e Cell proliferation assay in control, As, and As-T cells (n = 3). f Cell viability assay in cells as in e but placed in suspension for 72 h using flow cytometric analysis following Annexin V/propidium iodide staining (n = 3). g Nuclei/DNA are stained with DAPI in blue in normal human skin treated with or without DNase I (20 U). Scale bar, 100 μm. h Immunofluorescence staining of FTO (green), m6A (red), and keratin (blue) in normal human skin (n = 6) and arsenical keratoses (n = 6). Scale bar, 100 μm. i, j Percentage of samples (in stacked column format) for each score of FTO from h. Mann–Whitney U test. k, l Quantification of FTO and m6A levels using Image J (1.53e) from h. m Negative correlation of m6A levels with FTO levels by Spearman’s test from h. All data were performed on n ≥ 3 biologically independent samples. Error bars are shown as mean ± S.D. (e, f, k, l) or mean ± S.E. c p-values by two-tailed unpaired t-tests (c, e, f, k, l). Mann–Whitney U test (i, j). Correlation coefficient r and p-value are indicated from Spearman’s Correlation Rank test (m). a.u.: arbitrary units (km).

As-treated cells developed tumors in all four mice, while control cells did not (Fig. 1c and Supplementary Fig. 1e). We isolated the tumorigenic cells (As-T, Arsenic-Tumorigenic cells) from one tumor in mice (#1) as well as other tumors formed by the As-treated cells (As cells) in mice (Fig. 1c and Supplementary Fig. 1a). In addition to As cells, FTO was also upregulated in the four As-T cells, while the m6A level was downregulated in As and four As-T cells as compared with control cells (Fig. 1d). In addition, as compared with control cells, As and As-T cells showed increased proliferation (Fig. 1e) and survival (Fig. 1f, and Supplementary Fig. 1f). However, in contrast to arsenic, cadmium, another carcinogenic heavy metal present in the air, water, soil, sediment25, had no effect on FTO in HaCaT cells (Supplementary Fig. 1g), suggesting FTO as a target unique for arsenic exposure. Future investigation is needed to determine whether cadmium and other heavy metals affect FTO or other m6A regulators in keratinocytes and other cell types.

To determine the role of FTO and m6A in arsenic-induced tumorigenesis, we next assessed whether the levels of m6A and FTO are altered in arsenic-induced premalignant human skin lesions, arsenical keratoses, as compared with normal human skin. In humans, it is known that chronic arsenic exposure causes arsenical keratoses, which can persist indefinitely and may develop into invasive skin cancers such as squamous cell carcinoma26. Normal human skin samples were obtained from the archives in the tissue bank of the Section of Dermatology (Department of Medicine, University of Chicago). The arsenical keratoses were obtained from the clinical follow-up for arsenic-exposed cohorts that evaluate the health effects of exposure, including skin cancer, in Bangladesh. To remove the signal from DNA, we treated all samples with DNase I8 (Fig. 1g). As compared with normal human skin, we found that FTO is upregulated and the m6A level is downregulated in arsenical keratoses (Fig. 1h–l). In addition, we found that the m6A level is negatively correlated with the FTO level (Fig. 1m). These findings suggest that FTO acts as a protumorigenic factor in arsenic-induced skin lesions.

FTO is required for arsenic-induced tumorigenicity

To determine the functional significance of FTO upregulation in arsenic-induced tumorigenicity, we assessed the consequence of FTO knockout (KO) in As-T cells using CRISPR (Fig. 2a). FTO deletion decreased cell growth (Fig. 2b), anchorage-independent growth (Fig. 2c), clonogenic growth (Supplementary Fig. 2a), 3D cell growth (Supplementary Fig. 2b), and survival when cells were placed in suspension (Supplementary Fig. 2c). Notably, FTO deletion partially reversed the effect of arsenic on cell survival (Supplementary Fig. 2c). It is possible that FTO and other pathways affected by arsenic also promote cell survival. Nevertheless, FTO deletion drastically inhibited tumor growth of As-T cells in mice (Fig. 2d and Supplementary Fig. 2d). Furthermore, knockdown of FTO using siRNA also decreased cell proliferation in As cells (Supplementary Fig. 2e). While overexpression of FTO slightly increased cell proliferation in HaCaT cells (Supplementary Fig. 2f), it did not induce tumor formation in NSG mice (Supplementary Fig. 2g), indicating that FTO overexpression alone is not sufficient to induce tumorigenesis. It is likely that FTO upregulation is critical for arsenic tumorigenesis, while it seems that both FTO upregulation and other molecular alterations induced by arsenic are required for malignant transformation and tumorigenesis.

Fig. 2: FTO is required for arsenic-induced malignant transformation and tumorigenicity.
figure2

a Immunoblot analysis confirming FTO knockout (KO) in As-T cells using two independent sgRNAs using CRISPR. b Cell proliferation assay in As-T with or without FTO deletion (n = 3). c Soft Agar assay of cells as in a (n = 3). d Tumor volume of As-T cells with or without FTO deletion in NSG mice (n = 4). e, f Kaplan–Meier curve of tumorigenesis in UVB-irradiated male (e) and female (f) mice with wild-type FTO (WT; FTO flox/lox) or skin-specific FTO conditional knockout (FTO cKO; K14Cre; Ftoflox/flox) with or without arsenic exposure. UVB + Vehicle + WT (Male, n = 9; Female, n = 14); UVB + Vehicle+FTO cKO (Male, n = 10; Female, n = 16); UVB + Arsenic+WT (Male, n = 11; Female, n = 10); UVB + Arsenic+FTO cKO (Male, n = 15; Female n = 18). g, h Quantification of an epidermal thickness (h) from histological analysis (HE staining) (g) in Female mice. Sham group: WT + Vehicle (n = 6); WT + As (n = 6); FTO cKO + Vehicle (n = 5); FTO cKO+As (n = 6); groups treated with UVB (n = 6). i Immunoblot analysis of FTO and GAPDH in As-T cells stably infected with doxycycline-inducible shRNA 1 and 2 targeting FTO (Tet-on shFTO-1 and shFTO-2). j Tumor growth in nude mice treated with or without doxycycline following inoculating cells as in i. Tet-on shFTO-1(n = 4), and shFTO-2 (n = 3). k, l Tumor growth (k) and weight (l) in nude mice bearing As-T cells upon treatment with vehicle, CS1 (5 mg/kg), or CS2 (5 mg/kg). All data were performed on n ≥ 3 biologically independent samples. Error bars are shown as mean ± S.D. (b, c, h, k, l) or mean ± S.E. (d, j). p-values by two-tailed unpaired t-tests (b, c, d, h, j, k, l). Log-rank (Mantel-Cox) tests are indicated (e, f).

Next, we used the arsenic-UVB skin co-carcinogenesis mouse model to determine the role of FTO in arsenic-induced skin tumorigenesis. We first created mice with epidermis-specific FTO deletion (K14Cre;Fto flox/flox). Then we treated the mice with arsenic, UVB irradiation, or both, as reported previously27. We found that arsenic accelerates skin tumorigenesis, consistent with the previous report27. Epidermis-specific FTO deletion inhibited skin tumorigenesis induced by UVB irradiation alone or the combination of UVB irradiation and arsenic, with a greater effect on the latter (Fig. 2e, f). In addition, skin-specific FTO deletion reduced epidermal hyperplasia induced by UVB irradiation alone or the combination of UVB irradiation and arsenic (Fig. 2g, h). Histological analysis showed that the tumors developed in these groups are either papillomas or squamous cell carcinomas (SCC) (representative images shown in Supplementary Fig. 2h).

To determine the therapeutic potential by targeting FTO in As-T cells, we first tested the effect of inducible FTO knockdown using a doxycycline-inducible shRNA knockdown system. Inducible FTO knockdown (Fig. 2i) decreased cell growth (Supplementary Fig. 2i), tumor growth (Fig. 2j), and tumor weight (Supplementary Fig. 2j). To determine the translational potential of targeting FTO, we tested the effect of the FTO inhibitors CS1 and CS2 identified recently28. CS1 and CS2 increased the m6A level (Supplementary Fig. 2k), while it decreased cell growth (Supplementary Fig. 2l), tumor growth (Fig. 2k), and tumor weight (Fig. 2l), supporting the anti-tumor effects of these FTO inhibitors in As-T cells. Overall, these findings demonstrate that FTO is required for arsenic-induced malignant transformation and tumorigenesis and that targeting FTO genetically or pharmacologically inhibits the tumorigenicity of arsenic-treated cells.

m6A seq and RNA seq analyses identify NEDD4L as the critical target for arsenic-induced FTO upregulation

To determine the potential m6A targets of arsenic exposure, we used m6A-seq coupled with RNA-seq to determine the potential m6A demethylation gene targets across the whole transcriptome for arsenic. As compared with control cells, As-T cells showed decreased m6A enrichment in 5’UTR and 3’UTR (Fig. 3a) and altered total peak distribution (Supplementary Fig. 3a). As-T cells also showed a decreased number of m6A genes compared with control cells (Supplementary Fig. 3b). Sequence analysis of m6A peaks showed the previously identified m6A target sites (GGACU)29,30 (Fig. 3b).

Fig. 3: Identification of the potential target of arsenic-induced FTO upregulation via transcriptome-wide m6A-seq and RNA-seq analyses.
figure3

a Distribution of m6A peaks across the length of mRNA in control and As-T cells. b Top consensus m6A motif identified by HOMER with m6A peaks in control and As-T cells. c Venn diagram showing the overlap between genes with altered expression or m6A enrichment in four datasets: m6A seq (unique m6A peak in control/As-T), RNA seq (As-T/control), RNA seq [Mouse cuSCC/chronically irradiated skin (CHR)], and RNA seq [human cuSCC/normal skin (NS)]. NEDD4L is found in all groups. d Immunoblot analysis of FTO and GAPDH in control, As, and four As-T cells. e qPCR analysis of NEDD4L mRNA levels in d (n = 3). f Distribution of m6A peaks in “Exon 1 (NC_000018.10:58221610-58221760)” of the NEDD4L transcript in control and As-T cells. g m6A IP qPCR analysis of m6A enrichment across the NEDD4L transcript in control and As-T cells (n = 3). h m6A IP qPCR analysis of m6A enrichment in the differentially methylated region of the NEDD4L transcript (NC_000018.10:58221610-58221760) in control and As-T cells (n = 3). i qPCR analysis of NEDD4L mRNA stability following treatment with actinomycin. D (ActD, 2 μM) in control and As-T cells (n = 3). j m6A IP qPCR analysis of m6A enrichment across the NEDD4L transcript in As-T cells with or without FTO deletion (n = 3). k m6A IP qPCR analysis of m6A enrichment in the differentially methylated region of the NEDD4L transcript (NC_000018.10:58221610-58221760) in wild-type (WT) and FTO KO cells (n = 3). l qPCR analysis of NEDD4L mRNA level in cells with or without FTO deletion (n = 3). m qPCR analysis of NEDD4L mRNA stability following treatment with ActD in As-T cells with or without FTO deletion (n = 3). n Immunoblot analysis of NEDD4L and FTO in FTO-KO cells transfected with wild-type (WT) or demethylase-inactive mutant FTO (Mutant 1, H231A/D233A; Mutant 2, R316Q/R322Q). o qPCR analysis of NEDD4L mRNA levels in cells as in n (n = 3). All data were performed on n = 3 biologically independent samples. Error bars are shown as mean ± S.D. e, gm, o p-values by two-tailed unpaired t-tests are indicated (e, gm, o).

Next, we used the following criteria and analyses and identified NEDD4L (neural precursor cell-expressed developmentally downregulated 4 like) as a potential m6A target of arsenic, m6A modification, and FTO: (1) decreased m6A enrichment, (2) altered mRNA level, (3) potential role in cancer, and (4) altered expression in both human and mouse SCC. We compared the genes with altered expression and m6A enrichment in our m6A seq and RNA seq datasets from control and As-T cells, with genes with altered expression from human and mouse skin cancers (squamous cell carcinoma, SCC) (GSE84292 and GSE84293) generated from the previous studies31. There were 40 genes altered among the four groups, including 10 downregulated genes (GSN, LPIN1, ME1, NCOA7, NEDD4L, PDLIM4, TRPV4, CLDN1, CRIP2, GAS6) and 3 upregulated genes (GINS4, RAD54L, SLC16A1) that shared changes in As-T, mouse and human cuSCCs (Fig. 3c, and Supplementary Fig. 3c). Among all these genes, we elected to initially focus on NEDD4L, as it is found to be downregulated in several cancers32,33,34,35, suggesting a tumor-suppressive role for NEDD4L.

As and four As-T cells showed decreased mRNA and protein levels of NEDD4L as compared with control cells (Fig. 3d, e). m6A-seq analysis showed that As-T cells exhibited decreased m6A levels in the exon 1 (NC_000018.10:58221610-58221760) region of the NEDD4L isoform (id = NM_001144966.3) (Fig. 3f). Consistently, m6A IP qPCR analysis showed that in As-T cells the m6A level for the NEDD4L full-length transcript was reduced as compared with control cells (Fig. 3g), consistent with elevated FTO in these cells (Fig. 1d). To determine the m6A site at the NEDD4L transcript regulated by FTO, we performed the m6A IP qPCR analysis of m6A enrichment in the differentially methylated region of the NEDD4L transcript in control and As-T cells. As-T showed decreased m6A enrichment in the exon 1 (NC_000018.10:58221610-58221760) region of NEDD4L as compared with control cells (Fig. 3h). Furthermore, NEDD4L mRNA stability was decreased in As-T compared with control cells (Fig. 3i), suggesting that arsenic regulates NEDD4L RNA metabolism and decay. FTO deletion increased the m6A level and abundance of the NEDD4L transcript (Fig. 3j). m6A IP qPCR analysis of m6A enrichment showed that FTO deletion increased the m6A level in the exon 1 region of NEDD4L in As-T cells (Fig. 3k). Future investigation is needed to determine the importance of other potential m6A sites in the NEDD4L genes in arsenic tumorigenesis. Moreover, we found that FTO deletion increased the NEDD4L mRNA and protein levels and mRNA stability (Fig. 3l, m, and Supplementary Fig. 3d), suggesting that increased m6A enrichment on the NEDD4L transcript elevates its stability instead of leading to transcript decay36,37.

To determine whether FTO regulates NEDD4L mRNA m6A modification and expression through its demethylase activity, we tested the effect of the FTO demethylase-inactive mutants. In cells with FTO deletion, wild-type (WT) FTO decreased NEDD4L mRNA and protein levels, while FTO demethylase-inactive mutants had no effect (Fig. 3n, o). We also showed that the FTO inhibitors CS1 and CS2 increased the protein and mRNA levels of NEDD4L (Supplementary Fig. 3e, f), while it had no effect on the protein or mRNA levels of FTO, consistent with the previous studies28. These data strongly indicate that FTO upregulation by arsenic decreases the NEDD4L mRNA stability through its RNA demethylase activity.

Identification of NEDD4L as the functional target of FTO

Next, we investigated whether NEDD4L is responsible for FTO’s function in arsenic tumorigenicity. First, we assessed whether NEDD4L is negatively associated with FTO in arsenical keratoses, as compared with normal human skin. We found that FTO is upregulated, while NEDD4L is downregulated in arsenical keratoses as compared with normal skin (Fig. 4a, b). NEDD4L levels were negatively correlated with FTO levels (Fig. 4c).

Fig. 4: NEDD4L is a critical downstream target of FTO.
figure4

a Immunofluorescence staining of FTO (green), NEDD4L (red), and keratin (blue) in normal humans skin (n = 5) and arsenical keratoses (n = 3). Scale bar, 20 μm. b Quantification of NEDD4L using Image J in a normal human skin (n = 5) and arsenical keratoses (n = 3). c Negative correlation of NEDD4L levels with FTO levels by Spearman’s test in a. d Quantification of FTO using Image J within skin area with sham, UVB non-tumor skin or tumor in wild-type (WT) female mouse with or without arsenic exposure (n = 6) related in Supplementary Fig. 4a. e Quantification of NEDD4L in non-tumor skin or tumors from female WT mice with or without arsenic or UVB irradiation (n = 6). Representative images are shown in Supplementary Fig. 4a. f Negative correlation of NEDD4L levels with FTO levels by Spearman’s test in skin and tumor samples from WT mice treated with UVB irradiation in combination with vehicle or arsenic. g, h Quantification of the levels of FTO (g) (n = 6) and NEDD4L (h) (n = 6) in non-tumor skin or tumors from WT and FTO cKO female mice treated with arsenic and UVB irradiation (n = 6) from Supplementary Fig. 4b. i Immunoblot analysis to confirm NEDD4L knockdown in As-T cells with or without FTO deletion. j Cell proliferation assay in cells as in i (n = 3). k Soft agar assay of cells as in i (n = 3). l Apoptosis assay in cells as in i (n = 3). m, n Tumor volume (m) and weight (n) following subcutaneous injection of cells as in i into NSG mice (n = 4). All data were performed on n ≥ 3 biologically independent samples. Error bars are shown as mean ± S.D. (b, d, e, g, h, j, k, l, n) or mean ± S.E. (m). p-values by two-tailed unpaired t-tests (b, d, e, g, h, j, k, l, m, n). Correlation coefficient r and p-value from Spearman’s Correlation Rank test (c, f). a.u.: arbitrary units (bh).

Second, we analyzed the alteration of NEDD4L in arsenic-UVB-treated skin and tumors in mice and the effect of FTO deletion. We found FTO is upregulated by UVB alone, arsenic alone, or the combination of both (Fig. 4d and Supplementary Fig. 4a). Moreover, while NEDD4L was upregulated by UVB irradiation, it was downregulated by arsenic (Fig. 4e). Other mechanisms may mediate UVB-induced NEDD4L upregulation, which remains to be investigated in detail. Nevertheless, NEDD4L levels were negatively correlated with FTO levels (Fig. 4f). Furthermore, FTO deletion increased NEDD4L levels in skin and tumors from mice treated with both UVB irradiation and arsenic (Fig. 4g, h, and Supplementary Fig. 4b).

Third, we knocked down NEDD4L and observed that it partially reversed the effect of FTO deletion on cell proliferation, anchorage-independent growth, and cell survival when placed in suspension (Fig. 4i-l). Consistently, NEDD4L knockdown also partially reversed the effect of FTO deletion on tumor growth in vivo (Fig. 4m, n). These data indicate that NEDD4L is an important target of FTO, and other FTO targets may also play an important role in FTO’s function.

Next, we investigated the potential target of NEDD4L. NEDD4L is shown to act as a ubiquitin ligase controlling several pathways, including the WNT signaling by targeting Dvl238. As WNT signaling is one critical pathway in skin cancer39, we elected to test the role of the Wnt/β-catenin pathway in NEDD4L’s function. Using TOP Flash luciferase assay, we found that WNT signaling is increased in As-T cells as compared with control cells (Supplementary Fig. 4d). We observed that Dvl2, as well as β-catenin, a downstream target of WNT/Dvl240, is upregulated in As-T cells as compared with control cells (Supplementary Fig. 4e). FTO deletion decreased the levels of Dvl2 and β-catenin and WNT activity, which was prevented by NEDD4L knockdown (Supplementary Fig. 4e-f). Future investigation is needed to elucidate the role of other pathways, including the TGF-β41 and PI3K/AKT42 pathways, in the function of NEDD4L in skin cancer. These results demonstrate that NEDD4L is a critical downstream target of FTO responsible for its function in arsenic-induced malignant transformation.

FTO regulates NEDD4L mRNA stability through m6A and IGF2BPs

To determine whether FTO regulates NEDD4L through m6A, we assessed the effect of manipulating the m6A RNA methyltransferase factors METTL14 and METTL343. METTL14 knockdown at least partially reversed the effect of FTO deletion on NEDD4L mRNA stability, mRNA level, and protein level (Fig. 5a, b, and Supplementary Fig. 5a). Furthermore, METTL14 knockdown partially reversed the effect of FTO deletion on tumor growth (Fig. 5c and Supplementary Fig. 5b). Similarly, METTL3 knockdown also partially reversed the effect of FTO deletion on cell growth (Fig. 5d and Supplementary Fig. 5c), and anchorage-independent growth (Fig. 5e). Overexpression of wild-type METTL3, but not the catalytically dead mutant METTL3 (D395A), increased the protein and mRNA levels of NEDD4L in As-T cells with FTO deletion and METTL3 knockdown (Fig. 5f, g).

Fig. 5: FTO regulates NEDD4L and arsenic tumorigenicity through m6A.
figure5

a qPCR analysis of NEDD4L mRNA stability in As-T cells with or without FTO deletion and/or METTL14 knockdown (n = 3). b Immunoblot analysis of NEDD4L, METTL14, and FTO in cells as in a. c Tumor volume as in a following subcutaneous injection of cells as in a into NSG mice (n = 4). d Immunoblot analysis of NEDD4L and METTL3 in As-T cells with or without FTO knockout and/or METTL3 knockdown. e Soft agar assay of cells as in d (n = 3). f Immunoblot analysis of NEDD4L and METTL3 in cells with FTO deletion and METTL3 knockdown transfected with wild-type (WT) METTL3 or demethylase-inactive mutant METTL3 D395A. g qPCR analysis of NEDD4L mRNA level in cells as in f (n = 3). h Immunoblot analysis of NEDD4L, IGF2BP1, IGF2BP2, IGF2BP3, and FTO in As-T cells with or without FTO deletion in combination with transfection with siRNA targeting negative control (siNC) or all three IGF2BP1-3 (siALL). i qPCR analysis of NEDD4L mRNA level in cells as in h (n = 3). j qPCR analysis of NEDD4L mRNA stability in cells as in h (n = 3). k CLIP-qPCR showing the binding of IGF2BPs to the NEDD4L transcript in control and As-T cells (n = 3). All data were performed on n ≥ 3 biologically independent samples. Error bars are shown as mean ± S.D. (a, e, g, ik) or mean ± S.E. c p-values of all data by two-tailed unpaired t-test are indicated.

In addition to m6A10, FTO has been shown to demethylate the m6Am RNA methylation44. To determine whether m6Am also has a role in FTO’s function, we assessed the effect of knocking down the m6Am methyltransferase PCIF145,46,47,48. We found that PCIF1 knockdown has no effect on the regulation of NEDD4L by FTO (Supplementary Fig. 5d–f), consistent with a previous report49. Next, we investigated potential m6A readers responsible for the regulation of NEDD4L by FTO. Since FTO deletion increased the mRNA stability of NEDD4L, we reckoned that plausible m6A readers could be IGF2BP1-3, a group of m6A readers that stabilize m6A-modified transcripts37. Knockdown of IGF2BP1, IGF2BP2, or IGF2BP3 decreased the NEDD4L mRNA level (Supplementary Fig. 5g–j). Knockdown of all three IGF2BPs (IGF2BP1-3) diminished the effect of FTO deletion on NEDD4L protein and mRNA levels, and mRNA stability (Fig. 5h–j).CLIP-qPCR analysis showed that IGF2BPs bind with the NEDD4L transcript, which was decreased in As-T cells as compared with control cells (Fig. 5k). These findings demonstrate that FTO regulates NEDD4L RNA stability through m6A mRNA methylation and IGF2BPs.

As increases the FTO stability through impairing autophagy

To determine the mechanism by which arsenic upregulates FTO, we first assessed whether arsenic affects FTO mRNA levels. As compared with control cells, FTO mRNA levels remained unchanged in As and As-T cells (Fig. 6a), indicating that arsenic did not alter FTO mRNA abundance. Next, we assessed the effect of arsenic on FTO protein stability by treating the cells with cycloheximide (CHX) over a time course. As compared with control cells, FTO protein stability was increased in As-T cells (Fig. 6b, c), indicating that arsenic increased FTO stability. Next, we assessed the role of protein degradation through either the proteasome or the autophagic-lysosomal pathways, two critical protein degradation pathways50,51,52. When the proteasome was inhibited by MG132, control cells showed FTO protein accumulation, similar to As-T cells (Supplementary Fig. 6a, b). In contrast, when the lysosome was inhibited by the lysosome inhibitor bafilomycin A1 (BfnA1), control cells showed significantly more FTO protein accumulation than As-T cells did (Fig. 6d, e). In addition, As-T cells showed reduced autophagy, as indicated by decreased accumulation of LC3-II, the surrogate marker for autophagosome accumulation, when lysosome was inhibited (Fig. 6d). To further determine the role of autophagy in FTO stability, we assessed the effect of genetic inhibition of autophagy. Deletion of the essential autophagy genes ATG5 or ATG7 increased FTO protein stability as indicated by the increased half-life (Fig. 6f, g, and Supplementary Fig. 6c). These findings suggest that arsenic mimics the effect of autophagy inhibition in stabilizing FTO.

Fig. 6: Arsenic impairs autophagic degradation of FTO to stabilize FTO protein.
figure6

a qPCR analysis of FTO mRNA levels in control, As, and As-T cells (n = 3). b Immunoblot analysis of FTO in control and As-T cells treated with cycloheximide (CHX, 100 μg/ml) over a time course. c Quantification of b. t1/2 (half-life) is indicated (n = 3). d Immunoblot analysis of FTO following treatment with Bafilomycin A1 (BfnA1, 50 nM) for 6 h in control and As-T cells. e Quantification of d (n = 3). f Immunoblot analysis of FTO and LC3-I/II in WT, ATG5 KO, and ATG7 KO MEF cells following treatment with CHX (100 μg/ml) over a time course. g Quantification of f. t1/2 (half-life) is indicated (n = 3). h Proximity ligation assay (PLA) of the interaction between FTO and LC3 in HaCaT cells treated with vehicle or BfnA1 (50 nM) for 6 h. Scale bar: 20 µm. i Quantification of the number of PLA red dots per cell in h (n = 45 cells). j Immunofluorescence analysis of LC3 and FTO in MEF cells treated with vehicle or BfnA1. DAPI is used as a nuclear counterstain (blue). Scale bar:100 µm. k, l Gene set enrichment analysis (GSEA) of Lysosome (KEGG) (k) and Phagosome (KEGG) (l) pathway-related genes in mouse UVB-induced cuSCC versus chronically irradiated skin (CHR) in SKH-1 hairless mice. ES: Enrichment score. NES: Normalized enrichment scores, p: p-value, FDR: False discovery rate. m, n Electron microscopy (EM) analysis (m) and quantification of the number of autophagic vacuoles per cytoplasm area (10 µm2) in a cell (n = 50 cells) (n). Arrows indicate autophagic vacuoles in Control and As-T cells (m). Scale bars, 1 µm, and 200 nm. All data were performed on n ≥ 3 biologically independent samples. Error bars are shown as mean ± S.D. (c, e, g, i, n). p-values by two-tailed unpaired t-test are indicated (c, e, g, i, n).

Next, we used the PLA assay to assess the plausible interaction between FTO and autophagosomes. We first validated the specificity of the PLA assay for FTO and LC3 (Supplementary Fig. 6d-f). Treatment with BfnA1 increased the interaction between FTO and LC3 (Fig. 6h, i). This was further confirmed by the co-localization of FTO and LC3 by immunofluorescence staining (Fig. 6j). It is noteworthy that FTO was localized mainly in the nucleus, consistent with the previous studies10; lysosome inhibition seemed to increase the FTO level in both the nucleus and the cytosol (Fig. 6j). Gene set enrichment analysis (GSEA) detected downregulation of both ‘Lysosome’ and ‘Phagosome’ pathway-related genes in mouse cuSCCs as compared with non-tumor skin (Fig. 6k, l). The downregulated genes were shown in the heatmap (Supplementary Fig. 6g, h). Moreover, we also found that ‘Autophagy-animal’, ‘Lysosome’, and ‘Phagosome’ pathway-related genes are downregulated in As-T cells compared to control cells (Supplementary Fig. 10a, b). Electron microscopy analysis showed that the number of autophagic vacuoles is decreased in As-T cells as compared with control cells (Fig. 6m, n), further supporting the suppression of autophagy by arsenic.

To determine the mechanism by which arsenic inhibits autophagy, we first assessed the role of Metal-activated transcription factor 1 (MTF-1), a multipotent regulator of transcription often involved in the adaptation to stress, including arsenic treatment53,54. While low-dose acute or chronic arsenic treatment did not induce MTF1, acute high-dose arsenic treatment did increase the MTF1 level (Supplementary Fig. 6i-l). However, MTF1 knockdown had no effect on the FTO level (Supplementary Fig. 6m), suggesting that MTF1 is not a major player in chronic low-level arsenic damage. Future studies are required to assess the role of MTF1 in arsenic tumorigenicity in detail. Taken together, these findings demonstrate that arsenic stabilizes FTO protein by inhibiting autophagic degradation.

p62 regulates FTO stability and is suppressed by arsenic

To determine the mechanism by which arsenic dysregulates autophagic FTO degradation, we first mined our RNA-seq data for the effect of arsenic on autophagy-related genes. We found that OPTN, LAPM1, p62, and ATG5 are decreased in As-T cells as compared with control cells (Fig. 7a). qPCR analysis showed that these genes are downregulated in both As and As-T cells as compared to control cells (Fig. 7b). Consistently, the p62 protein level was downregulated by arsenic (Fig. 7c).

Fig. 7: p62 is downregulated by arsenic and regulates FTO stability.
figure7

a Heatmap showing altered expression of the genes in autophagy/lysosome pathways between As-T and control cells. b qPCR analysis of OPTN, p62, ATG5, and LAMP1 levels in control, As, and As-T cells (n = 3). c Immunoblot analysis of FTO in control, As, and four As-T cells. d Immunoblot analysis of HA, NEDD4L, and FTO in As-T cells transfected with empty vector (EV) or p62 (HA tag). e Immunoblot analysis of FTO and HA (p62) in As-T cells as in d treated with CHX over a time course. f Quantification of e. The t1/2 (half-life) is indicated (n = 3). g Immunoblot analysis of FTO and HA (p62) in As-T cells with or without FTO deletion in combination with transfection with EV or p62-HA. h Immunoblot analysis of FTO and p62 following immunoprecipitation using species-matched control IgG and an anti-p62 antibody in HaCaT cells. i ubiquitination assay of As-T cells transfected with HA-Ub and Flag-FTO and treated with or without BfnA1 (50 nM) and MG132 (10 μM) for 6 h. j Immunoblot analysis of FTO and HA in As-T cells transfected with plasmids expressing WT and ΔUBA p62. k Immunoblot analysis of Flag-FTO and HA-p62 (WT or ΔUBA) following immunoprecipitation assay of the binding of Flag-FTO with HA-p62 WT or HA-p62 ΔUBA in HeLa cells transfected with Flag-EV (empty vector), Flag-FTO, HA-p62 WT, or HA-p62 ΔUBA. l Immunoblot analysis of FTO and HA in As-T cells transfected with constructs expressing WT p62 or LIR (W338A) mutant p62 (HA). m Representative images of immune electron microscopy (IEM) analysis for p62 and FTO in control cells. The upper panel shows the negative controls without primary antibodies. The bottom panel shows IEM staining of FTO (10 nm) and p62 (15 nm). n Quantification of the p62 levels in normal human skin (n = 6) and arsenical keratoses (n = 3). Related to Supplementary Fig. 7j. a.u.: arbitrary units. o Negative correlation of p62 levels with FTO levels by Spearman’s test in normal human skin (n = 6) and arsenical keratoses (n = 3) from Supplementary Fig. 7j. All data were performed on n ≥ 3 biologically independent samples. Error bars are shown as mean ± S.D. (b, f, n). p-values by two-tailed unpaired t-test (b, f, n); Correlation coefficient r and p-value in o are indicated from Spearman’s Correlation Rank test.

Next, we assessed whether p62 regulates FTO protein stability. Indeed, overexpression of p62 reduced the FTO protein level, whereas p62 knockdown increased it (Fig. 7d and Supplementary Fig. 7a). Moreover, p62 inhibition increased FTO protein stability in both HaCaT and MEF cells (Supplementary Fig. 7b–e), whereas overexpression of p62 deceased it in As-T cells that expressed low levels of p62 (Fig. 7e, f). Correspondingly, overexpression of p62 increased NEDD4L mRNA levels in WT cells but not in cells with FTO deletion (Fig. 7g and Supplementary Fig. 7f), indicating that p62 regulates NEDD4L expression through FTO.

Next, we assessed whether FTO interacts with p62. First, we observed that the co-localization of FTO and p62 is increased by deletion of ATG7 or by the lysosome inhibitor BfnA1 in MEF cells (Supplementary Fig. 7g). PLA assays supported the co-localization of p62 and FTO in HaCaT cells (Supplementary Fig. 7h, i). Co-immunoprecipitation analysis showed that FTO binds with p62 (Fig. 7h). As an autophagy receptor, p62 can interact with polyubiquitin chains or its ubiquitinated protein substrates through its UBA domain55 and with LC3/GABARAP proteins noncovalently via a short linear sequence known as LIR56 to deliver its substrates to autophagosomes and then lysosomes for degradation. Indeed, we found that FTO is ubiquitinated in As-T cells (Fig. 7i). Moreover, deletion of the UBA domain of p62 abolished the FTO-p62 interaction (Fig. 7j, k), indicating that FTO-p62 interaction requires p62’s UBA domain. Furthermore, overexpression of wild-type (WT) p62, but not the LIR-binding deficient mutant (W338A)57,58, reduced FTO protein levels (Fig. 7l). Immune electron microscopy analysis showed that FTO colocalizes with the p62 cluster in the cytoplasm (Fig. 7m). These p62-positive structures are shown to be liquid droplets formed by liquid-liquid phase separation and degraded by autophagy, rather than monomeric or oligomerized p6259,60,61. It is possible that FTO is translocated into the p62 bodies depending on the context and degraded by autophagy. Lastly, as compared with normal human skin, human arsenical keratoses showed decreased p62 levels (Fig. 7n and Supplementary Fig. 7j). In addition, we found that p62 is negatively correlated with FTO (Fig. 7o).

Next, we assessed the role of p62 in FTO localization in the autophagosomes. Overexpression of p62 increased autophagy in p62-low As-T cells (Supplementary Fig. 8a). In addition, it also increased the co-localization of FTO with LC3 (Supplementary Fig. 8b, c) in As-T cells, whereas p62 deletion decreased it (Supplementary Fig. 8d-h) in MEF cells. Notably, p62 deletion markedly decreased but did not completely abolish, the FTO-LC3 PLA signal, suggesting that while p62 is a crucial autophagy receptor for FTO colocalization with LC3, other autophagy factors may also play a role. Immunofluorescence analysis further confirmed that p62 deletion reduced the co-localization of FTO with LC3 (Supplementary Fig. 8i). Our data indicate that p62 is necessary and sufficient for FTO localization in the autophagosomes.

Furthermore, we showed that FTO also regulates autophagy in response to arsenic as a positive feedback signaling system. We found that FTO deletion in As-T cells increases autophagy, as shown by p62 accumulation and formation of LC3-II upon BfnA1 treatment (Supplementary Fig. 9a). FTO deletion decreased p62 mRNA levels, consistent with decreased p62 protein levels in FTO-depleted cells under homeostatic conditions (Supplementary Fig. 9a, b). In addition, we found that FTO deletion increased the phosphorylation of AMPK, decreased phosphorylation of the mTOR substrate p70S6K, and increased protein levels of ATG5 and ATG7, as well as increasing the LC3-II level, under serum starvation conditions that can induce autophagy62 (Supplementary Fig. 9c).

Next, we assessed the role of TFEB, a transcription factor that controls transcription of CLEAR and autophagy genes and is regulated by phosphorylation63,64,65,66. We found that, as compared with control cells, As-T cells showed reduced levels of TFEB protein and phosphorylation levels (S211), but not the TFEB mRNA level (Supplementary Fig. 9d, e). It is possible that chronic arsenic treatment decreases either translation or protein stability of TFEB and that the decreased TFEB phosphorylation is due to the decreased TFEB abundance, which requires further investigation. FTO deletion decreased phosphorylation of TFEB at S122 and the expression of ATG5 and ATG7 but not p62 mRNA (Supplementary Fig. 9f-h), possibly due to the reduced mTOR signaling (Supplementary Fig. 9c). These findings suggest that TFEB has a complex role in arsenic damage response and FTO function, which requires further investigation. Our results suggest a positive feedback loop between FTO and autophagy dysregulation, leading to self-sustained maintenance of FTO upregulation in arsenic-induced malignant transformation and tumorigenesis. Taken together, these findings demonstrate that p62 binds with FTO to mediates FTO degradation, and that arsenic inhibits FTO degradation by suppressing p62 expression.

Arsenic downregulates p62 expression by inhibiting the TNF/NF-κB pathway

To determine how arsenic downregulates p62 expression, we performed pathway analysis to determine which shared signaling pathways were downregulated in As and As-T cells as compared with control cells using Metascape67. Among many pathways downregulated by arsenic, the cytokine production and cytokine signaling pathways, in particular, were downregulated in As and As-T cells as compared with control cells (Fig. 8a). Moreover, KEGG network analysis showed that the ‘Autophagy-animal’,’ Phagosome’, ‘Lysosome’, and ‘NF-κB and TNF signaling pathway’ was downregulated in As-T cells as compared with control cells (Supplementary Fig. 10a, b). GSEA analysis showed that TNF-signaling genes were downregulated in As-T cells as compared with control cells, and in mouse SCC as compared with non-tumor skin (Fig. 8b and Supplementary Fig. 10c-g). qPCR analysis showed that several TNF-related genes (NFKB1, TNF, TNFRSF1A, TNFAIP3) and autophagy-related genes (ATG5, ATG7, and p62) were decreased in arsenic-treated cells as compared with control cells (Fig. 8c).

Fig. 8: p62 is downregulated by arsenic through TNFɑ/NF-ĸB signaling and regulates FTO stability.
figure8

a GO pathway analysis of downregulated genes shared in both As and As-T cells as compared with control cells. b GSEA of “TNF signaling pathway”-related genes in As-T cells versus control cells. ES: Enrichment score. NES: Normalized enrichment scores, p: p-value, FDR: False discovery rate. c qPCR analysis of NFKB1, TNF, TNFRSF1A, TNFAIP3, ATG5, ATG7, and p62 in control, As, and four As-T cells (n = 3). d Luciferase reporter analysis of NF-κB activity in control, As, and four As-T cells (n = 3). e Luciferase reporter analysis of NF-κB activity in As-T cells treated with or without TNFα (10 and 50 ng/ml) for 20 h (n = 3). f Immunoblot analysis of NEDD4L, ATG5, ATG7, FTO, and p62 in As-T cells treated with or without TNFα for 20 h. g qPCR analysis of NFKB1, p62, and NEDD4L mRNA level in cells as in f (n = 3). h Immunoblot analysis of FTO, RELA, p62, and NEDD4L in As-T cells treated with or without TNF (50 ng/ml) following transfection with or without siRNA targeting p62 or RELA. i qPCR analysis of p62 and NEDD4L mRNA level in cells as in h (n = 3). j Proximity ligation assay (PLA) of the interaction between FTO and p62 in cells as in h. DAPI is used as a nuclear counterstain (blue). All samples are pretreated with BfnA1 for 6 h. Scale bar: 20 µm. k Quantification of the number of PLA red dots per cell in j (n = 30 cells from three biologically independent replicates). All data were performed on n ≥ 3 biologically independent samples. Error bars are shown as mean ± S.D. (c–e, g, i, k). p-values of all data by two-tailed unpaired t-test are indicated.

It is known that p62 expression can be induced by NF-κB activation68. Previous studies have shown that in myometrial cells the known NF-κB-inducing cytokine TNFα induces p62 expression69. Therefore, we hypothesized that arsenic downregulates p62 expression through downregulating signaling of cytokines such as TNFα. Indeed, NF-κB activity was decreased in arsenic-treated cells (As and As-T cells) as compared with control cells (Fig. 8d), while it was increased after TNFα treatment (Fig. 8e). TNFα treatment increased the protein and mRNA levels of p62 and NEDD4L, and the protein levels of ATG5 and ATG7, while it decreased FTO protein level (Fig. 8f, g). Knocking down p62 or RELA, also known as p65 as part of the NF-κB heterodimer, prevented the effect of TNFα (Fig. 8h, i). A PLA assay showed that TNFα increased the colocalization of FTO with either p62 or LC3, which was prevented by knocking down either p62 or RELA (Fig. 8j, k, and Supplementary Fig. 10h, i).

Previous studies showed that Nrf2 and TFEB also regulate p62 expression70. However, we found that in HaCaT cells knockdown of either Nrf2 or TFEB had no effect on FTO levels, although it had a small to moderate effect on the p62 levels (Supplementary Fig. 10j–l). Future studies are needed to assess the role of Nrf2 and TEFB in arsenic-regulation of p62 in greater detail. Taken together, our findings demonstrate that arsenic suppresses p62 expression by downregulating the NF-κB pathway to upregulate FTO.

Discussion

RNA m6A modifications are shown to play important roles in cancer development and therapeutic response7. However, the role of m6A in tumorigenicity caused by environmental carcinogens such as arsenic remains unknown. Here we discovered that chronic low-level arsenic exposure upregulates FTO stability and downregulates m6A enrichment in keratinocytes, leading to malignant transformation and tumorigenesis. At the molecular level, arsenic inhibits FTO protein degradation via impairing p62-dependent selective autophagy. FTO interacts with p62 in the autophagosomes, and p62 is required for autophagic degradation of FTO. Furthermore, arsenic inhibits p62 expression by suppressing the TNFα/NF-κB signaling pathway. We identified NEDD4L as a critical downstream target of FTO in arsenic tumorigenicity. NEDD4L RNA stability is regulated by m6A modification, through the m6A readers IGF2BPs and FTO. Furthermore, FTO and autophagy dysfunction form a positive feedback loop to maintain the upregulation of FTO. Taken together, these results establish RNA modification and FTO as an epitranscriptomic mechanism in arsenic-induced tumorigenesis (Supplementary Fig. 11).

We found that FTO is upregulated and m6A enrichment is downregulated by chronic exposure to relevant low levels of arsenic. The downregulation of FTO induced by arsenic seems to depend on the dose of arsenic since only low-level arsenic upregulates FTO (Supplementary Fig. 1d). However, high-level arsenic downregulates FTO, similar to previous reports71,72. Such FTO upregulation is required for arsenic-induced tumorigenesis, as FTO deletion diminished arsenic-induced tumorigenesis in both a xenograft tumor model and an arsenic-UVB co-carcinogenesis model. FTO’s pro-tumorigenic role in arsenic damage response is mediated through m6A RNA methylation, as knockdown of METTL14/METTL3 reversed the effect of FTO deletion in vivo and in vitro. Furthermore, the FTO level is higher, while the m6A level is lower in human arsenical keratosis, a premalignant lesion induced by arsenic than in normal human skin. These findings provide an epitranscriptomic mechanism by which arsenic upregulates the RNA demethylase FTO to promote tumorigenesis.

Emerging evidence suggests that FTO and m6A RNA methylation regulate their functions in cancer and other diseases through different downstream gene targets depending on the context and cell lineage6,7. For example, in leukemia, Li and colleagues have shown that FTO promotes tumorigenesis by suppressing the expression of ASB2 and RARA genes11. In melanoma, we have recently shown that FTO promotes the mRNA stability of the melanoma-promoting genes PDCD1, CXCR4, and SOX1013. Using m6A IP seq followed by qPCR validation, we found that FTO reduces the m6A levels of the NEDD4L transcript, leading to its increased decay.

NEDD4L belongs to the NEDD4 family of the E3 HECT domain ubiquitin ligases and has been suggested to regulate several signaling pathways38,41,42, thus acting as a tumor suppressor in several cancers32,33,34,35. We found that knockdown of NEDD4L reversed the effect of FTO knockout on arsenic-induced tumorigenesis, establishing that NEDD4L is a critical mRNA target for FTO. However, in wild-type cells, knockdown of NEDD4L had no effect, suggesting that NEDD4L alone is dispensable for arsenic-induced tumorigenicity when FTO is intact to inhibit NEDD4L. In contrast to melanoma in which m6A decreases the RNA stability of melanoma-promoting gene transcripts13, in arsenic-induced tumor cells, we found that m6A increases the RNA stability of NEDD4L through the readers IGF2BP1-3. Previously IGF2BP1-3 proteins have been shown to be a distinct family of m6A readers that bind to and promote the stability and translation of m6A-modified transcripts37. We found that knockdown of IGF2BPs increases the NEDD4L decay in FTO knockout cells and reverses the effect of FTO. Future investigations are needed to determine whether IGF2BPs also play active roles in arsenic damage response and tumorigenicity and whether the FTO/IGF2BPs axis also regulates NEDD4L translation.

We found that FTO regulates the Dvl2 level through inhibiting NEDD4L, resulting in increased Wnt signaling, suggesting Wnt signaling as a downstream target for the FTO/NEDD4L axis. Taken together, our findings clearly demonstrate that FTO promotes arsenic-induced tumorigenesis through m6A RNA methylation and NEDD4L.

Intriguingly we found that chronic arsenic exposure stabilizes FTO protein by compromising its autophagic degradation. From RNA-seq analysis, arsenic suppressed the expression of several autophagy genes, including the autophagy receptor p62. Arsenic inhibited autophagy by suppressing p62 expression, as adding p62 reversed the effect of arsenic. In addition, we found that FTO degradation by autophagy is mediated by p62. FTO binds with p62’s UBA domain and colocalizes in the LC3-positive autophagosomes in a p62-dependent manner. p62 knockdown or knockout increases FTO protein stability, while p62 overexpression decreases it. It appears that arsenic downregulates cytokine signaling pathways, including the TNFα pathway. p62 expression is shown to be regulated by several signaling pathways and transcription factors such as NF-κB68, a major downstream pathway for cytokine signaling. Treatment with TNFα increases NF-κB activity, leading to increased p62 expression and decreased FTO levels. In addition, the roles of other autophagy pathways in FTO degradation will require additional investigation.

Our findings showed that chronic low-level arsenic exposure inhibits p62 expression, which at least partially leads to compromised autophagy and autophagy-mediated FTO degradation, and thus facilitates arsenic tumorigenesis. Other autophagy genes downregulated by arsenic may also play important roles in autophagy inhibition by arsenic, which needs further investigation. Our findings seem to be specific for arsenic, as previous studies have shown that multiple types of tumors exhibit elevated basal autophagy73,74, as well as p62 accumulation70, to promote tumorigenesis and tumor progression70,75,76. In addition, it seems that the effect of toxic metals on autophagy is also dependent on context, including the specific metal, cell type, concentrations of metals, and treatment duration77. We found that in HaCaT cells, cadmium has no effect on FTO levels up to 72 h (Supplementary Fig. 1f). These discrepancies could be due to the specific mechanism of action for arsenic-induced tumorigenesis and suggest a context-dependent role for FTO, as well as p62 and autophagy. The regulatory and functional roles of carcinogenic metals in autophagy warrant further investigation, in particular in the context of clinically relevant low-level chronic exposure.

Moreover, we found that FTO inhibits autophagy. FTO deletion increased the expression of autophagy genes including ATG5 and ATG7, increased phosphorylation of AMPK, and decreased phosphorylation of the mTOR target p70S6K and TFEB, pathways that regulate autophagy63,78,79, and enhanced autophagy. This is consistent with previous reports in which FTO increases activation of the mTORC1 pathway and thus inhibits autophagy80. However, our findings are opposite to those reported in preadipocytes, in which FTO knockdown decreases the expression of ATG5 and ATG7 and reduces autophagy81. These discrepancies could be due to the cell-type specific or context-dependent role of FTO in autophagy, which warrants future investigation. Nevertheless, our findings demonstrate that FTO and autophagy inhibition form a positive feedback loop, leading to self-sustained FTO upregulation and malignant traits in arsenic-induced tumorigenic cells.

In summary, we demonstrate that arsenic promotes FTO protein stability by impairing selective autophagy and thus induces malignant transformation and tumorigenesis. FTO decreases m6A modification and stability of its functional downstream target NEDD4L mRNA. Our results provide an epitranscriptomic molecular axis as the post-transcriptional mechanism in arsenic-induced tumorigenesis, and thus may help the development of new mechanism-based prevention and therapy by targeting FTO and m6A RNA methylation to reduce the skin cancer burden in arsenic-exposed individuals worldwide.

Methods

Cell culture

HeLa cells, MEF (mouse embryonic fibroblasts), HaCaT (human keratinocyte, kindly provided by Dr. Fusenig), and HEK-293T cells were maintained in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (Gibco), 100U/ml penicillin, and 100 µg/ml streptomycin (Invitrogen, Carlsbad, CA). Normal Human Epidermal Keratinocyte (NHEK) cells were purchased from Lonza and maintained in KGM Gold keratinocyte growth basal medium (Lonza, #00192151) and KGM Gold keratinocyte growth medium supplements and growth factors (Lonza, # 00192152). WT and ATG5 KO MEF cells were kindly provided by Dr. Noboru Mizushima. ATG7 KO and p62 KO MEF cells were generously provided by Dr. Masaaki Komatsu.

Lentiviral generation and infection

Lentivirus was produced by co-transfection into HEK-293T (human embryonic kidney) cells with lentiviral constructs together with the pCMVdelta8.2 packaging plasmid and pVSV-G envelope plasmid using X-tremeGENE 9. Virus-containing supernatants were collected at 24–48 h. Target cells were infected in the presence of Polybrene (8 µg/ml) (Sigma-Aldrich, St. Louis, MO) and selected with puromycin (Santa Cruz Biotechnology, Santa Cruz, CA) at 1 µg/ml for 7 days82,83.

Plasmids

Lentiviral vectors expressing shRNA targeting negative control (shNC), METTL14 (shMETTL14), METTL3 (shMETTL3), FTO (shFTO), NEDD4L (shNEDD4L), PCIF1 (shPCIF1), and p62 (shp62) for humans were purchased from Sigma. Plasmids used were as follows: GFP empty vector and FTO-GFP (Genecopea). Flag-EV and FLAG-FTO plasmids were purchased from SinoBiological. pcDNA4-HA-p62 was obtained from Addgene (#28027, kindly provided by Qing Zhong)84. p62 with deletion of UBA domain (p62 ΔUBA) was generated as described previously82, pLenti-HA-Ub purchased from Addgene (#74218, kindly provided by Melina Fan). p62 LIR-W338A was subcloned into the pcDNA4 vector (Addgene plasmid #28027, kindly provided by Qing Zhong), from the vector expressing the LIR mutant (pBABEpuro-HA-p62-LIR, Addgene plasmid #71306, kindly provided by Jayanta Debnath) using the following primers: Forward, 5‘-CCGGAATTCTATGGCGTCGCTCACCGTGAAGG-3‘; Reverse, 5‘-ATAAGAATGCGGCCGCGCAACGGCGGGGGATGCTTTGAATACTG-3‘). The PCR product was digested with EcoRI and NotI. WT and FTO mutant 1 (H231A/D233A) and mutant 2 (R316Q/R322Q) were generated as described previously10. The transcription factor TCF/lymphoid enhancer factor luciferase reporter containing TCF binding sites TOPFLASH (TOP) and its negative control plasmid containing inactive TCF binding sites FOPFLASH (FOP) plasmids were kindly provided by Tong-Chuan He (University of Chicago). pGL4 NF-κB-Luc was obtained from Promega (E8491). METTL3 WT and METTL3 D395A were provided by Hui-Lung Sun (University of Chicago)85. Cells with FTO using the CRISPR method were prepared as adapted from the method described previously8,86,87. The Cas9 lentiviral vector was kindly provided by Drs. Jiping Xie and Xiaoyang Wu (University of Chicago). The guide RNA sequences were FTO KO-1: GAAGCGCACCCCGACTGCCG; FTO KO-2: ACGGTCCCCTGGCCAGTGAA. The Tet-On inducible FTO knockdown vectors were kindly provided by Dr. Hui-Lung Sun (University of Chicago), generated by cloning two independent shRNAs targeting FTO: shFTO-1 (shRNA TRCN0000246249 CGGTTCACAACCTCGGTTTAG) and shFTO-2 (shRNA TRCN0000255404, TCTCGCATCCTCATTGGTAAT) into a Tet-On doxycycline-inducible lentiviral expression vector (Addgene Plasmid #21915, kindly provided by Dmitri Wiederschain).

siRNA transfection

Cells were transfected with siRNA targeting negative control (siNC) (Dharmacon, Lafayette, CO), or an individual gene or the combination of IGF2BP1, IGF2BP2, IGF2BP3, MTF1, TFEB, Nrf2 using GenMute™ siRNA Transfection Reagent (Signagen, Ijamsville, MD) according to the manufacturer’s instructions83.

Quantitative real-time PCR (qPCR)

Quantitative real-time PCR assays were performed using a CFX Connect real-time system (Bio-Rad, Hercules, CA) with Bio-Rad iQ SYBR Green Supermix (Bio-Rad, Hercules, CA)83. The threshold cycle number (CQ) for each sample was determined in triplicate. The CQ values for FTO, NEDD4L, ATG5, OPTN, p62, LAMP1, IGF2BP1, IGF2BP2, IGF2BP3, ATG7, NFKB1, TNF, TNFRSF1A, and TNFAIP3 were normalized against GAPDH83. Primers are shown in Supplementary Table 1.

Luciferase reporter assay

Cells were transfected with 1 µg of TOPFLASH/FOP FLASH or NF-κB Luc constructs in combination with 0.025 ĸg of pRL-TK, a transfection efficiency control (Promega, Madison, WI), using GenJetTM Plus DNA in vitro transfection reagent (Signagen, Ijamsville, MD) according to the manufacturer’s instructions. Luciferase reporter assays (Promega) were carried out according to the manufacturer’s instructions82,83,88.

m6A dot blot assay

Total RNA was isolated with RNeasy plus Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. RNA samples were loaded onto the Amersham Hybond-N + membrane (GE Healthcare, Chicago, IL) and UV cross-linked twice to the membrane. After it was dry, the membrane was blocked with 5% BSA (in 1× PBST) for 1 h and incubated with a specific anti-m6A antibody (Synaptic Systems, Goettingen, Germany) overnight at 4 °C. Next, the membrane was incubated with the HRP-conjugated anti-rabbit IgG (Cell Signaling Technology, Beverly, MA) for 1 h at room temperature, and then developed with Thermo ECL SuperSignal Western Blotting Detection Reagent (Thermo Fisher Scientific, Waltham, MA)10,83,89.

Gene-specific m6A qPCR

Total RNA was immunoprecipitated with an anti-m6A antibody followed by qPCR analysis. Primers for full-length mRNA qPCR are listed in the qPCR section. For region-specific m6A qPCR of NEDD4L, fragmented IP RNA and input RNA samples were prepared as described in the m6A IP Seq section and used as RT-qPCR templates for qPCR analysis. Target-specific primers for the m6A methylated region in NEDD4L (exon 1; NC_000018.10:58221610-58221760) were designed by using Primer-BLAST90: forward, 5’-ATCAGCAGAGGTGTGTACGG-3’, and reverse, 5’-CAGTGGTGTCTTTGTTCTTACCT-3’83,89.

CLIP-RT-qPCR

Cells in a 15 cm dish at 70–80% confluency were cross-linked twice with UVC radiation (254 nm, 150 mJ/cm2) using Stratalinker on ice. Cells were harvested and lysed, followed by RNase T1 digestion. A 1:1:1 mixture of IGF2BP1-3 antibodies and the corresponding IgG control antibody were conjugated to 1:1 mixed Dynabeads Protein A/G by incubation for 4 h at 4 °C, followed by 3× washing and incubation with pre-cleared cell lysate in RIPA buffer overnight at 4 °C. The beads conjugated with RNA-protein complex were washed and then subjected to digestion by DNase and Proteinase K. Input and co-immunoprecipitated RNAs were recovered by TRIzol (Invitrogen) extraction and used as RT-qPCR templates for qPCR analysis.

Immunoblotting

Protein extracts were obtained by washing the cells once with PBS and resuspending in RIPA buffer containing inhibitors for proteases and phosphatases, then sonicated. After quantifying protein concentrations through BCA assay, samples were heated for 10 min at 70 °C. Protein abundance was analyzed through SDS–polyacrylamide gel electrophoresis followed by immunoblotting. Antibodies used were as follows: anti-m6A (Synaptic system, Cat. # 202 003, 1:2000); anti-FTO (Santa Cruz, SC-271713, 1:500); anti-p62 (Progen Biotechnik GmbH, GP62-C, 1:10,000); anti-METTL14 (Millipore Co., ABE 1338, 1:1000); anti-ATG5 (12994, Cell Signaling Technology, 1:1000); anti-ATG7 (8558, Cell Signaling Technology, 1:1000); anti-GAPDH (Santa Cruz, sc-47724, 1:5000); anti-β-actin (Santa Cruz, SC-47778, 1:5000); anti-ALKBH5 (Millipore Co., ABE 1013, 1:2000); anti-HA (Santa Cruz, sc-7392, 1:5000); anti-IGF2BP1 (Cell Signaling Technology, 8482, 1:1000); anti-IGF2BP2 (Cell Signaling Technology,14672, 1:1000); anti-IGF2BP3 (Cell Signaling Technology, 57145, 1:1000); anti-NEDD4L (Cell Signaling Technology, 4013, 1:1000); anti-LC3 (Abcam, ab192890, 1:1000); anti-p-AMPK T172 (Cell Signaling Technology, 2535S, 1:1000, 1:000), anti-p-ULK1 S555 (Cell Signaling Technology, 5869S, 1:1000); anti-p-p70S6K T389 (Cell Signaling Technology, 9234S, 1:1000); anti-MTF1 (Proteintech, 25383-1-AP, 1:2000); anti-TFEB (Bethyl Laboratories, A303-673A-M, 1:1000); anti-Phospho-TFEB (Ser211) (Cell Signaling Technology, 37681, 1:1000); anti-Nrf2 (Cell Signaling Technology, 12721, 1:1000); Wnt3a (R&D Systems, 5036-WN-010); anti-β-Catenin (Cell Signaling Technology, 9562, 1:5000); Rabbit Anti-Mouse IgG (Cell Signaling Technology, 58802); Mouse Anti-rabbit IgG (Cell Signaling Technology, 5127); HA (Cell Signaling Technology, 3724, 1:2000).

Immunoprecipitation

Immunoprecipitation was performed using the protocol from Abcam. Briefly, cells were fixed with 0.4% formaldehyde for 10 min and then quenched with 200 mM Tris-Hcl (pH7.5) for 30 min. Fixed cells were scraped with 100 μl of cell harvest buffer, which is 1× cell lysis buffer (10× cell lysis buffer, #9803, Cell Signaling) containing 1% SDS and 5 mM EDTA, and then boiled at 95 °C for 5 min. Next 900 μl of 1× cell lysis buffer (Cell signaling, #9803) was added into the cell lysate in the harvest buffer to quench SDS in the harvest buffer. The cell lysate was mixed well, sonicated, and then incubated with 30 unit/ml of DNase I for 1 h. After centrifuging, the supernatant was used for IP experiments by using Magnetic beads (Protein A/G Magnetic Beads, 88802, Thermo Scientific™), Anti-FLAG® M2 Magnetic Beads (Sigma, M8823, 1:20), HA-Tag (C29F4) (Cell Signaling, #3724, 1:2000), DYKDDDDK Tag (9A3) (Cell Signaling, #8146, 1:2000), METTL3 (Proteintech, 15073-I-AP, 1:1000); Anti-p62/SQSTM1 (Sigma, P0067, 1:100), Anti-FTO (Santacruz, SC-271713, 1:200), Rabbit Anti-Mouse IgG (Light Chain Specific) (D3V2A) (Cell Signaling, #58802, 1:2000), and Mouse Anti-Rabbit IgG (Conformation Specific) (L27A9) (HRP Conjugate) (Cell signaling, #5127 HRP, 1:2000). Immunoprecipitation was performed at 4 °C for 1.5 h and the beads were washed five times in 1× cell lysis buffer (Cell signaling, #9803). Protein was eluted with SDS sample buffer containing Beta-Mercaptoethanol and heated at 95 °C for 20 min91,92,93,94.

Ubiquitination assay

The cells were co-transfected with Flag-tagged FTO (Flag-FTO) and HA-tagged ubiquitin (HA-Ub). Then cells were incubated in the presence of MG132 (10 µM) and BfnA1 (50 nM) for 6 h. The ubiquitination assay was performed under denaturing conditions. Briefly, cells scraped with 100 μl of cell harvest buffer, which is 1× cell lysis buffer (10× cell lysis buffer, #9803, Cell Signaling) containing 2% SDS and 5 mM EDTA, and then boiled at 95 °C for 5 min. Next 900 μl of 1× cell lysis buffer (Cell signaling, #9803) was added into the cell lysate in the harvest buffer to quench SDS in the harvest buffer. The cell lysate was mixed well, sonicated. After centrifuging the lysate was subjected to immunoprecipitation by Anti-FLAG® M2 Magnetic Beads (Sigma, M8823, 1:20). Protein was eluted with SDS sample buffer containing DTT and heated at 95 °C for 20 min. All buffers contain protease cocktail inhibitor and 5 mM NEM (N-ethylmaleimide). Ubiquitinated proteins were identified by HA-Tag (C29F4) (Cell Signaling, #3724, 1:2000) antibody95,96.

Electron microscopy (EM)

EM analysis was performed at the electron microscopy core facility on campus. Briefly, cells were fixed and then treated 1% Osmium Tetroxide in 0.1 M sodium cacodylate buffer for 60 min. Then cells were washed with sodium cacodylate buffer, rinsed with Maleate buffer (pH5.1) once for 5 min, stained with 1% aqueous uranyl acetate in Maleate buffer, and dehydrated in a graded series of ethanol. Next cells were embedded by Spurr polymerization in a 60 °C oven. Samples were then sectioned into 90 nm thick sections using Leice EM UC6, stained with Uranyl acetate and Lead citrate, and then examined under 300KV at FEI Tecnai F30.

Immune electron microscopy (IEM)

IEM analysis was performed at the electron microscopy core facility on campus. Briefly, cells were fixed for 1 h, followed by washing with 0.1 M PB buffer. Samples were then dehydrated with ethanol, embedded, cut into 80 nm-thick slides by Leice EM UC6, and then mounted on formvar/carbon-coated 200 mesh gold grids. Then slides were incubated with antibodies (p62 Sigma-Aldrich 1:20, P0067; FTO abcam, ab92821, 1:20) in 1% BSA. After rehydration with PBS and blocking with 1% BSA, slides were next washed with PBS, followed by blocking with 0.5% BSA again, and then incubated with gold-conjugated secondary antibodies (10 nm for FTO or 15 nm for p62, 1:10) in 0.5% BSA. After washing, samples were stained briefly with Uranyl Acetate and Lead Citrate, air dried, and then examined under 300KV at FEI Tecnai F30.

Flow cytometric analysis of apoptosis

Apoptotic cell death was determined using an annexin V-FITC apoptosis detection kit (eBioscience, San Diego), according to the manufacturer’s instructions. Cell samples were then analyzed by a BD FACS Calibur flow cytometer (BD Biosciences)83.

Soft agar colony formation

The soft agar assay was performed as described previously83. Briefly, cells (500 or 1000 cells) were suspended in 0.35% agar in 1XDMEM/10%FBS growth medium and seeded in 35-mm dishes pre-coated with 0.5% agar in 1× DMEM/10%FBS growth medium, then incubated at 37 °C with 5% CO2. Cells were fed 1-2 times per week with a cell culture medium. After 10–14 days, colonies were stained with 0.005% Crystal Violet for more than 1 h.

Cell proliferation assay

The number of cells was assessed with a Cell Counting Kit-8 (CCK-8) (Sigma-Aldrich, St. Louis, MO following the manufacturer’s protocol83.

Histological analysis

H&E staining was performed by the Immunohistochemistry core facility at the University of Chicago97,98.

Mouse tumorigenesis induced by UVB irradiation and arsenic treatment

All animal procedures have been approved by the University of Chicago Institutional Animal Care and Use Committee. Mice with wild-type (WT; FTO flox/lox, kindly provided by Dr. Pumin Zhang99) and conditional skin-specific FTO deletion (FTO cKO, K14Cre;FTO flox/lox) in the SKH-1 background were generated98. Mice were exposed to arsenite (106277;EMD Millipore) continuously in the drinking water at 1.25 mg/L starting at 21 days of age27. Next, at 42 days of age, mice were irradiated with sham or UVB irradiation (starting at 80 mJ/cm2 and then increasing the UVB dose by 10% every week until it reached 100 mJ/cm2) three times a week up to 25 weeks97,98,100,101. Tumor formation and growth were monitored at least weekly until the end of the experiment.

Tumorigenicity assay in immunocompromised mice

All animal procedures were approved by the University of Chicago institutional animal care and use committee. Athymic nude mice and NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice were obtained from Envigo/Charles River and the Jackson Laboratory, respectively. As cells (5 million) in Matrigel or As-T (1 million) cells in PBS with or without gene manipulations were injected subcutaneously into the right flanks of female mice (6–8 weeks of age). For treatment with CS1 or CS2, As-T cells (1 million) in PBS were injected subcutaneously into the right flanks of 6-week-old female nude mice. When tumor size reached about 50 mm3, mice were injected i.p. every other day with Vehicle, CS1 (5 mg/kg, Bisantrene, Medchemexpress LLC, Cat. HY-100875), or CS2 (5 mg/kg, Brequinar, Cayman, Cat. 24445) in PBS containing 3% DMSO and 20% HPCD (Sigma-Aldrich, C0926) (total of 8 times). For doxycycline treatment, As-T cells (5 million) expressing inducible FTO knockdown vectors in PBS were injected subcutaneously into the right flanks of 6-week-old female \ nude mice. When tumor size reached about 50 mm3, mice were treated with vehicle or 1 mg/ml Doxycycline (MP Biomedicals, Cat. ICN19895501) in acidified drinking water containing 5% sucrose (Sigma, S3929). Tumor growth was monitored and measured by a caliper, and tumor volume was calculated using the formula: tumor volume (mm3) = d2 × D/2, where d and D are the shortest and the longest diameters, respectively.

Sphere formation assay

Cells were first harvested in 10% FBS medium and passed through a 40 μm nylon mesh (Fisher, 22363547). Then cells were gently resuspended in a sphere medium (1–2 ml). Cells were next plated in 6-well ultra-low-attachment plates (Corning, 3471) at a density of 1,000 cells per well in culture medium DMEM/F12 (1:1) (Invitrogen) with 2% B27 serum-free supplement (17504-044, Invitrogen, Frederick, MD), 20 ng/ml EGF (E9644, Sigma, St. Louis), 0.4% bovine serum albumin (B4287, Sigma), 4 μg/ml insulin (Sigma, St. Louis, MO, #19278), and antibiotics, and cultured for 7–14 days at 37 °C with 5% CO2. The number of tumorspheres per well was quantified102,103.

Immunofluorescence

Cells were first fixed with 4% paraformaldehyde/PBS for 25 min and permeabilized in 0.5% (v/v) Triton X-100 in PBS for 20 min at 4 °C. Then cells were washed with PBS. PBS supplemented with 5% normal goat serum (Invitrogen, Carlsbad, California) was used as a blocking solution for 60 min at room temperature. After removal of the blocking solution, cells were incubated at 4 °C overnight with the following primary antibodies prepared in 1× PBS/1%BSA: anti-LC3B (Abcam, ab192890, 1:200), anti-FTO (Abcam, ab92821, 1:200), and anti-p62 (Sigma-Aldrich, P0067, 1:400). Next cells were washed with PBS, incubated at room temperature in the dark for 1 h with fluorochrome-conjugated secondary antibody (Jackson ImmunoResearch Lab, 715-545-150; Jackson ImmunoResearch Lab, 711-585-152; 1:200) prepared in 1× PBS/1%BSA, followed by washing with PBS three times in the dark. Cells were then fixed in Prolong Gold Antifade with DAPI (Invitrogen) to visualize the cell nuclei and observed under a fluorescence microscope (Olympus IX71)82,83.

For tissue IF staining, formalin-fixed, paraffin-embedded tissue sections were pre-treated by antigen retrieval and incubated with blocking solution with 3% albumin from chicken egg white (Sigma-Aldrich, A5503) in PBS after antigen retrieval. For RNA-specific m6A staining, DNA on the tissue slide was removed by DNase I treatment. Tissue slides were incubated at 4 °C with primary anti-FTO (Abcam, ab92821, 1:100), anti-NEDD4L (Cell signaling, #4013, 1:100), anti-p62 (Sigma, P0067, 1:100), anti-m6A (Synaptic Systems 1: 200), and anti-cytokeratin (ORIGENE, BP5069, 1:200) antibodies. After removing the primary antibodies, slides were washed with PBS solution with 0.1% Triton X-100 (Sigma-Aldrich, T8787). Slides were then incubated at room temperature with Alexa Fluor 594-conjugated secondary rabbit IgG (Jackson ImmunoResearch, 711–585-152, 1:100), Alexa Fluor 488-conjugated secondary mouse IgG (Jackson ImmunoResearch, 715–545-150, 1:100), or DyLight 405 AffiniPure secondary Guinea Pig IgG (Jackson ImmunoResearch, 706-475-148, 1:200) for 1 h, then washed 3 times with PBS solution with 0.1% TritonX-100. Slides were mounted with Fluoromount Mounting Medium (Sigma-Aldrich, F4680). Stained slide samples were analyzed using a fluorescence microscope (Olympus IX71, Olympus Life Science, Japan). For statistical analysis by ImageJ, five areas of the same size were randomly selected from each sample.

In situ proximity ligation (PLA) assay

PLA assay was performed according to the manufacturer’s instructions (Sigma). Briefly, cells were first fixed with 4% paraformaldehyde/PBS and then permeabilized in 0.5%(v/v) Triton X-100. After blocking with 5% normal goat serum (Invitrogen, Carlsbad, California), cells were incubated overnight with the following primary antibodies at 4 °C in 1XPBS/1%BSA: anti-p62 (Rabbit) (Sigma-Aldrich, P0067, 1:400); anti-LC3B (rabbit) (Abcam, ab192890,1:200), and anti-FTO (mouse) (Abcam, ab92821, 1:200). In-situ PLA detection was performed using a Duolink Detection Kit (Sigma-Aldrich) with a pair of nucleotide-labeled secondary antibodies. After ligation and amplification of PLA probes, signals were examined using a fluorescence microscope (Olympus IX71).

m6A IP seq

100–150 μg total RNA was extracted from cells using TRIzol following the manufacturer’s protocol. mRNA was purified using a Dynabeads mRNA DIRECT Kit (Thermo Fisher, # 61012). 1 μg mRNA was fragmented to 200 nt using a Bioruptor® Pico Sonication System, and 5% of the fragmented mRNA was saved as input. mRNA fragments containing m6A were enriched with an EpiMark N6-Methyladenosine Enrichment Kit (NEB, E1610S) and then extracted using RNA Clean and Concentrator (Zymo Research). RNA libraries were prepared for both input and IP samples using TruSeq® Stranded mRNA Library Prep (Illumina, 20020594) following the manufacturer’s protocol. Sequencing was performed at the University of Chicago Genomics Facility on an Illumina NextSeq 4000 machine in single-read mode with 50 bp per reading at around 25 M to 30 M sequencing depth83.

Sequencing data analysis

The adapters were removed by using cutadapt for m6A-seq, and reads were aligned to the reference genome (hg38) in Tophat v2.0.14 using the parameter -g 1–library-type = fr-firststrand. RefSeq Gene structure annotations were obtained from the UCSC Table Browser. If a gene had multiple isoforms, the longest isoform was used. In order to eliminate the interference caused by introns in peak calling, aligned reads were extended to 150 bp (average fragment size) and converted from genome-based coordinates to isoform-based coordinates. The method used for peak calling was adapted from published work with modifications29. For calling m6A peaks, a gene’s longest isoform was scanned using a sliding window (100 bp) with a step of 10 bp. To minimize bias from potential inaccuracy in gene structure annotation and/or the longest isoform, windows with read counts of less than 1/20 of the top window in both m6A-IP and the input were excluded. The read counts in each window for each gene were normalized by the median count of all windows for the gene. The differential windows between IP and input samples were identified using a Fisher exact test. If the FDR < 0.01 and log2(Enrichment Score) ≥ 1, the window was considered positive. Overlapping positive windows were merged. To obtain the enrichment score of each peak (or window), the following four numbers were calculated: (1) read counts of the IP samples in the current peak/window, (2) median read counts of the IP sample in all 100 bp windows on the current mRNA, (3) read counts of the input sample in the current peak/window, and (4) median read counts of the input sample in all 100 bp windows on the current mRNA. For each window, the enrichment score was calculated as (a × d)/(b × c)83.

Human skin and tumor samples

All human specimens were studied after approval by the University of Chicago Institutional Review Board. Normal human skin samples were obtained from the archives in the tissue bank of the Section of Dermatology (Department of Medicine, University of Chicago). The arsenical keratoses were obtained from the clinical follow-up for arsenic-exposed cohorts that evaluate the health effects of exposure, including skin cancer, in Bangladesh.

GEO datasets and analysis of differentially expressed genes (DEG)

Two RNA-seq gene expression profiles (GSE84292, GSE84293)31 were acquired from the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo)104, a public functional genomics data repository of high-throughput genomic data. GSE84282 consisted of 6 paired mouse chronically irradiated skin (CHR) and cutaneous squamous cell carcinoma (cuSCC); GSE84283 consisted of 7 cases of human normal skin (NS) and 9 cases of human cuSCC. The DEG was performed by NetworkAnalyst (http://www.networkanalyst.ca), and R programming languages-based tool for comprehensive gene expression profiling105. The edgeR method was selected with adjusted P < 0.05 to identify the DEGs between mouse and human chronically irradiated skin (CHR) and cuSCC.

GO, KEGG, GSEA, Venn diagram, and heatmap analysis

To understand the function of the differentially expressed genes, gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed using Metascape and Networkanalyst. P < 0.05 was considered to indicate a significantly enriched DEG. Metascape (https://metascape.org/) is a free gene annotation and analysis resource that helps biologists make sense of one or multiple gene lists67. Gene Set Enrichment Analysis (GSEA) and the heatmap of relative significant genes were performed using Networkanalyst and WebGestalt (http://www.webgestalt.org/106. Venn diagrams were generated using the following web tool: https://bioinfogp.cnb.csic.es/tools/venny/index.html107, with the following statistical cutoff: p-value <0.05 in combination with log2 (fold change) >0.5 or < −0.5 for human cuSCC/CHR and mouse cuSCC/NS (GSE84292, GSE84293), or log2 (TPM) > 0.5 or < −0.5 for As-T cells/Control cells.

Statistical analyses

Statistical analyses were carried out using Prism 7 and 9 (GraphPad). Data were expressed as the mean of at least three independent experiments. Error bars indicate the SDs or SEs of the means. P < 0.05 was considered statistically significant.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

m6A IP sequencing and RNA sequencing data are accessible at the GEO repository, under accession number GSE145923. Other data from this study are available from the corresponding author upon request. Source data are provided with the paper. Source data are provided with this paper.

References

  1. 1.

    Fu, Y., Dominissini, D., Rechavi, G. & He, C. Gene expression regulation mediated through reversible m(6)A RNA methylation. Nature reviews. Genetics 15, 293–306 (2014).

    CAS  PubMed  PubMed Central  Google Scholar 

  2. 2.

    Meyer, K. D. & Jaffrey, S. R. The dynamic epitranscriptome: N6-methyladenosine and gene expression control. Nature reviews. Mol. Cell Biol. 15, 313–326 (2014).

    CAS  Google Scholar 

  3. 3.

    Frye, M., Harada, B. T., Behm, M. & He, C. RNA modifications modulate gene expression during development. Science 361, 1346–1349 (2018).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  4. 4.

    Zhao, B. S., Roundtree, I. A. & He, C. Post-transcriptional gene regulation by mRNA modifications. Nat. Rev. Mol. Cell Biol. 18, 31–42 (2017).

    CAS  Article  Google Scholar 

  5. 5.

    Liu, J. et al. N (6)-methyladenosine of chromosome-associated regulatory RNA regulates chromatin state and transcription. Science 367, 580–586 (2020).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  6. 6.

    Deng, X. et al. RNA N(6)-methyladenosine modification in cancers: current status and perspectives. Cell Res. 28, 507–517 (2018).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  7. 7.

    Huang, H., Weng, H. & Chen, J. m(6)A modification in coding and non-coding RNAs: roles and therapeutic implications in cancer. Cancer Cell 37, 270–288 (2020).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  8. 8.

    Xiang, Y. et al. RNA m(6)A methylation regulates the ultraviolet-induced DNA damage response. Nature 543, 573–576 (2017).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  9. 9.

    Zhou, J. et al. Dynamic m(6)A mRNA methylation directs translational control of heat shock response. Nature 526, 591–594 (2015).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  10. 10.

    Jia, G. et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat. Chem. Biol. 7, 885–887 (2011).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  11. 11.

    Li, Z. et al. FTO plays an oncogenic role in acute myeloid leukemia as a N6-methyladenosine RNA demethylase. Cancer Cell 31, 127–141 (2017).

    PubMed  Article  CAS  PubMed Central  Google Scholar 

  12. 12.

    Cui, Q. et al. m6A RNA methylation regulates the self-renewal and tumorigenesis of glioblastoma stem cells. Cell Rep. 18, 2622–2634 (2017).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  13. 13.

    Yang, S. et al. m6A mRNA demethylase FTO regulates melanoma tumorigenicity and response to anti-PD-1 blockade. Nat. Commun. 10, 2782 (2019).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  14. 14.

    Nordstrom, D. K. Public health. Worldwide occurrences of arsenic in ground water. Science 296, 2143–2145 (2002).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  15. 15.

    Argos, M. et al. Arsenic exposure from drinking water, and all-cause and chronic-disease mortalities in Bangladesh (HEALS): a prospective cohort study. Lancet 376, 252–258 (2010).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  16. 16.

    Smith, A. H., Lingas, E. O. & Rahman, M. Contamination of drinking-water by arsenic in Bangladesh: a public health emergency. Bull. World Health Organ. 78, 1093–1103 (2000).

    CAS  PubMed  PubMed Central  Google Scholar 

  17. 17.

    Martinez, V. D., Vucic, E. A., Becker-Santos, D. D., Gil, L. & Lam, W. L. Arsenic exposure and the induction of human cancers. J. Toxicol. 2011, 431287 (2011).

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  18. 18.

    Argos, M. et al. A prospective study of arsenic exposure from drinking water and incidence of skin lesions in Bangladesh. Am. J. Epidemiol. 174, 185–194 (2011).

    PubMed  PubMed Central  Article  Google Scholar 

  19. 19.

    Hsu, L. I. et al. Use of arsenic-induced palmoplantar hyperkeratosis and skin cancers to predict risk of subsequent internal malignancy. Am. J. Epidemiol. 177, 202–212 (2013).

    PubMed  Article  PubMed Central  Google Scholar 

  20. 20.

    Chen, Y. et al. Modification of risk of arsenic-induced skin lesions by sunlight exposure, smoking, and occupational exposures in Bangladesh. Epidemiology 17, 459–467 (2006).

    PubMed  Article  PubMed Central  Google Scholar 

  21. 21.

    Argos, M. Arsenic Exposure and epigenetic alterations: recent findings based on the illumina 450K DNA methylation array. Curr. Environ. Health Rep. 2, 137–144 (2015).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  22. 22.

    Meakin, C. J., Martin, E. M. & Fry, R. C. Epigenetic mechanisms underlying arsenic-induced toxicity. Curr. Opin. Toxicol. 6, 1–9 (2017).

    Article  Google Scholar 

  23. 23.

    Pi, J. et al. Decreased serum concentrations of nitric oxide metabolites among Chinese in an endemic area of chronic arsenic poisoning in inner Mongolia. Free Radic. Biol. Med. 28, 1137–1142 (2000).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  24. 24.

    Pi, J. et al. Arsenic-induced malignant transformation of human keratinocytes: involvement of Nrf2. Free Radic. Biol. Med. 45, 651–658 (2008).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  25. 25.

    Matthews, N. H. et al. Exposure to trace elements and risk of skin cancer: a systematic review of epidemiologic studies. Cancer Epidemiol. Biomark. Prev. 28, 3–21 (2019).

    CAS  Article  Google Scholar 

  26. 26.

    Torchia, D., Massi, D., Caproni, M. & Fabbri, P. Multiple cutaneous precanceroses and carcinomas from combined iatrogenic/professional exposure to arsenic. Int. J. Dermatol. 47, 592–593 (2008).

    PubMed  Article  PubMed Central  Google Scholar 

  27. 27.

    Burns, F. J., Uddin, A. N., Wu, F., Nadas, A. & Rossman, T. G. Arsenic-induced enhancement of ultraviolet radiation carcinogenesis in mouse skin: a dose-response study. Environ. Health Perspect. 112, 599–603 (2004).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  28. 28.

    Su, R. et al. Targeting FTO suppresses cancer stem cell maintenance and immune evasion. Cancer Cell 38, 79–96 e11 (2020).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  29. 29.

    Dominissini, D. et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201–206 (2012).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  30. 30.

    Meyer, K. D. et al. Comprehensive analysis of mRNA methylation reveals enrichment in 3’ UTRs and near stop codons. Cell 149, 1635–1646 (2012).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  31. 31.

    Chitsazzadeh, V. et al. Cross-species identification of genomic drivers of squamous cell carcinoma development across preneoplastic intermediates. Nat. Commun. 7, 12601 (2016).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  32. 32.

    He, S. et al. Down-regulation of Nedd4L is associated with the aggressive progression and worse prognosis of malignant glioma. Jpn. J. Clin. Oncol. 42, 196–201 (2012).

    PubMed  Article  PubMed Central  Google Scholar 

  33. 33.

    Yang, Q. et al. Nedd4L expression is decreased in ovarian epithelial cancer tissues compared to ovarian non-cancer tissue. J. Obstet. Gynaecol. Res. 41, 1959–1964 (2015).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  34. 34.

    Hu, X. Y., Xu, Y. M., Fu, Q., Yu, J. J. & Huang, J. Nedd4L expression is downregulated in prostate cancer compared to benign prostatic hyperplasia. Eur. J. Surg. Oncol. 35, 527–531 (2009).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  35. 35.

    Tanksley, J. P., Chen, X. & Coffey, R. J. NEDD4L is downregulated in colorectal cancer and inhibits canonical WNT signaling. PLoS ONE 8, e81514 (2013).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  36. 36.

    Wang, X. et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 505, 117–120 (2014).

    ADS  PubMed  Article  CAS  PubMed Central  Google Scholar 

  37. 37.

    Huang, H. et al. Recognition of RNA N(6)-methyladenosine by IGF2BP proteins enhances mRNA stability and translation. Nat. Cell Biol. 20, 285–295 (2018).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  38. 38.

    Ding, Y., Zhang, Y., Xu, C., Tao, Q. H. & Chen, Y. G. HECT domain-containing E3 ubiquitin ligase NEDD4L negatively regulates Wnt signaling by targeting dishevelled for proteasomal degradation. J. Biol. Chem. 288, 8289–8298 (2013).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  39. 39.

    Sherwood, V. & Leigh, I. M. WNT signaling in cutaneous squamous cell carcinoma: a future treatment strategy? J. Invest. Dermatol. 136, 1760–1767 (2016).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  40. 40.

    Sharma, M., Castro-Piedras, I., Simmons, G. E. Jr. & Pruitt, K. Dishevelled: a masterful conductor of complex Wnt signals. Cell Signal 47, 52–64 (2018).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  41. 41.

    Gao, S. et al. Ubiquitin ligase Nedd4L targets activated Smad2/3 to limit TGF-beta signaling. Mol. Cell 36, 457–468 (2009).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  42. 42.

    Wang, Z. et al. NEDD4L protein catalyzes ubiquitination of PIK3CA protein and regulates PI3K-AKT signaling. J. Biol. Chem. 291, 17467–17477 (2016).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  43. 43.

    Liu, J. et al. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat. Chem. Biol. 10, 93–95 (2014).

    CAS  Article  Google Scholar 

  44. 44.

    Mauer, J. et al. Reversible methylation of m(6)Am in the 5’ cap controls mRNA stability. Nature 541, 371–375 (2017).

    ADS  CAS  Article  Google Scholar 

  45. 45.

    Akichika, S. et al. Cap-specific terminal N (6)-methylation of RNA by an RNA polymerase II-associated methyltransferase. Science 363 eaav0080 (2019).

  46. 46.

    Boulias, K. et al. Identification of the m(6)Am methyltransferase PCIF1 reveals the location and functions of m(6)Am in the Transcriptome. Mol. Cell 75, 631–643 e638 (2019).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  47. 47.

    Sendinc, E. et al. PCIF1 catalyzes m6Am mRNA methylation to regulate gene expression. Mol. Cell 75, 620–630 e629 (2019).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  48. 48.

    Sun, H., Zhang, M., Li, K., Bai, D. & Yi, C. Cap-specific, terminal N(6)-methylation by a mammalian m(6)Am methyltransferase. Cell Res. 29, 80–82 (2019).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  49. 49.

    Wei, J. et al. Differential m(6)A, m(6)Am, and m(1)A demethylation mediated by FTO in the cell nucleus and cytoplasm. Mol. Cell 71, 973–985 e975 (2018).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  50. 50.

    Amm, I., Sommer, T. & Wolf, D. H. Protein quality control and elimination of protein waste: the role of the ubiquitin-proteasome system. Biochim. Biophys. Acta 1843, 182–196 (2014).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  51. 51.

    Klionsky, D. J. Autophagy: from phenomenology to molecular understanding in less than a decade. Nat. Rev. Mol. Cell Biol. 8, 931–937 (2007).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  52. 52.

    Mizushima, N., Levine, B., Cuervo, A. M. & Klionsky, D. J. Autophagy fights disease through cellular self-digestion. Nature 451, 1069–1075 (2008).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  53. 53.

    Gunther, V., Lindert, U. & Schaffner, W. The taste of heavy metals: gene regulation by MTF-1. Biochim. Biophys. Acta 1823, 1416–1425 (2012).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  54. 54.

    Liu, J. et al. Stress-related gene expression in mice treated with inorganic arsenicals. Toxicol. Sci. 61, 314–320 (2001).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  55. 55.

    Lamark, T., Svenning, S. & Johansen, T. Regulation of selective autophagy: the p62/SQSTM1 paradigm. Essays Biochem. 61, 609–624 (2017).

    PubMed  Article  PubMed Central  Google Scholar 

  56. 56.

    Rogov, V., Dotsch, V., Johansen, T. & Kirkin, V. Interactions between autophagy receptors and ubiquitin-like proteins form the molecular basis for selective autophagy. Mol. Cell 53, 167–178 (2014).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  57. 57.

    Ichimura, Y. et al. Structural basis for sorting mechanism of p62 in selective autophagy. J. Biol. Chem. 283, 22847–22857 (2008).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  58. 58.

    Pankiv, S. et al. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J. Biol. Chem. 282, 24131–24145 (2007).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  59. 59.

    Sun, D., Wu, R., Zheng, J., Li, P. & Yu, L. Polyubiquitin chain-induced p62 phase separation drives autophagic cargo segregation. Cell Res. 28, 405–415 (2018).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  60. 60.

    Zaffagnini, G. et al. p62 filaments capture and present ubiquitinated cargos for autophagy. EMBO J. 37, e98308 (2018).

  61. 61.

    Sanchez-Martin, P. et al. NBR1-mediated p62-liquid droplets enhance the Keap1-Nrf2 system. EMBO Rep. 21, e48902 (2020).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  62. 62.

    Wei, Y. et al. EGFR-mediated Beclin 1 phosphorylation in autophagy suppression, tumor progression, and tumor chemoresistance. Cell 154, 1269–1284 (2013).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  63. 63.

    Napolitano, G. et al. mTOR-dependent phosphorylation controls TFEB nuclear export. Nat. Commun. 9, 3312 (2018).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  64. 64.

    Puertollano, R., Ferguson, S. M., Brugarolas, J. & Ballabio, A. The complex relationship between TFEB transcription factor phosphorylation and subcellular localization. EMBO J 37, e98804 (2018).

  65. 65.

    Martina, J. A., Chen, Y., Gucek, M. & Puertollano, R. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 8, 903–914 (2012).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  66. 66.

    Settembre, C. et al. TFEB links autophagy to lysosomal biogenesis. Science 332, 1429–1433 (2011).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  67. 67.

    Zhou, Y. et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 10, 1523 (2019).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  68. 68.

    Moscat, J. & Diaz-Meco, M. T. p62: a versatile multitasker takes on cancer. Trends Biochem. Sci. 37, 230–236 (2012).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  69. 69.

    Lappas, M. The adaptor protein p62 mediates nuclear factor kappaB activation in response to inflammation and facilitates the formation of prolabor mediators in human myometrium. Reprod. Sci. 24, 762–772 (2017).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  70. 70.

    Sanchez-Martin, P., Saito, T. & Komatsu, M. p62/SQSTM1: ‘Jack of all trades’ in health and cancer. FEBS J. 286, 8–23 (2019).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  71. 71.

    Zhao, T., Li, X., Sun, D. & Zhang, Z. Oxidative stress: one potential factor for arsenite-induced increase of N(6)-methyladenosine in human keratinocytes. Environ. Toxicol. Pharmacol. 69, 95–103 (2019).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  72. 72.

    Zhao, T. et al. N(6)-methyladenosine mediates arsenite-induced human keratinocyte transformation by suppressing p53 activation. Environ. Pollut. 259, 113908 (2020).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  73. 73.

    White, E. The role for autophagy in cancer. J. Clin. Invest. 125, 42–46 (2015).

    PubMed  PubMed Central  Article  Google Scholar 

  74. 74.

    Yang, S. et al. Pancreatic cancers require autophagy for tumor growth. Genes Dev. 25, 717–729 (2011).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  75. 75.

    Saito, T. et al. p62/Sqstm1 promotes malignancy of HCV-positive hepatocellular carcinoma through Nrf2-dependent metabolic reprogramming. Nat. Commun. 7, 12030 (2016).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  76. 76.

    Umemura, A. et al. p62, upregulated during preneoplasia, induces hepatocellular carcinogenesis by maintaining survival of stressed HCC-initiating cells. Cancer Cell 29, 935–948 (2016).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  77. 77.

    Chatterjee, S., Sarkar, S. & Bhattacharya, S. Toxic metals and autophagy. Chem. Res Toxicol. 27, 1887–1900 (2014).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  78. 78.

    Egan, D. F. et al. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 331, 456–461 (2011).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  79. 79.

    Kim, J., Kundu, M., Viollet, B. & Guan, K. L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 13, 132–141 (2011).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  80. 80.

    Gulati, P. et al. Role for the obesity-related FTO gene in the cellular sensing of amino acids. Proc. Natl Acad. Sci. USA 110, 2557–2562 (2013).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  81. 81.

    Wang, X. et al. m(6)A mRNA methylation controls autophagy and adipogenesis by targeting Atg5 and Atg7. Autophagy 16, 1–15 (2019).

  82. 82.

    Qiang, L. et al. Regulation of cell proliferation and migration by p62 through stabilization of Twist1. Proc. Natl Acad. Sci. USA 111, 9241–9246 (2014).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  83. 83.

    Yang, S. et al. m(6)A mRNA demethylase FTO regulates melanoma tumorigenicity and response to anti-PD-1 blockade. Nat. Commun. 10, 2782 (2019).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  84. 84.

    Fan, W. et al. Keap1 facilitates p62-mediated ubiquitin aggregate clearance via autophagy. Autophagy 6, 614–621 (2010).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  85. 85.

    Sun, H. L. et al. Stabilization of ERK-Phosphorylated METTL3 by USP5 Increases m(6)A Methylation. Mol. Cell 80, 633–647 e637 (2020).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  86. 86.

    Ran, F. A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380–1389 (2013).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  87. 87.

    Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84–87 (2014).

    ADS  CAS  Article  Google Scholar 

  88. 88.

    Qiang, L. et al. Autophagy positively regulates DNA damage recognition by nucleotide excision repair. Autophagy 12, 357–368 (2016).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  89. 89.

    Li, Z. et al. FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase. Cancer Cell 31, 127–141 (2017).

    PubMed  Article  CAS  PubMed Central  Google Scholar 

  90. 90.

    Ye, J. et al. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinforma. 13, 134 (2012).

    CAS  Article  Google Scholar 

  91. 91.

    Hoffman, E. A., Frey, B. L., Smith, L. M. & Auble, D. T. Formaldehyde crosslinking: a tool for the study of chromatin complexes. J. Biol. Chem. 290, 26404–26411 (2015).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  92. 92.

    Klockenbusch, C. & Kast, J. Optimization of formaldehyde cross-linking for protein interaction analysis of non-tagged integrin beta1. J. Biomed. Biotechnol. 2010, 927585 (2010).

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  93. 93.

    Li, Y. et al. RBM45 homo-oligomerization mediates association with ALS-linked proteins and stress granules. Sci. Rep. 5, 14262 (2015).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  94. 94.

    Hall, D. B. & Struhl, K. The VP16 activation domain interacts with multiple transcriptional components as determined by protein-protein cross-linking in vivo. J. Biol. Chem. 277, 46043–46050 (2002).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  95. 95.

    Lee, M. S. et al. Loss of the E3 ubiquitin ligase MKRN1 represses diet-induced metabolic syndrome through AMPK activation. Nat. Commun. 9, 3404 (2018).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  96. 96.

    Yoon, W. J. et al. The Boston-type craniosynostosis mutation MSX2 (P148H) results in enhanced susceptibility of MSX2 to ubiquitin-dependent degradation. J. Biol. Chem. 283, 32751–32761 (2008).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  97. 97.

    Qiang, L., Sample, A., Liu, H., Wu, X. & He, Y. Y. Epidermal SIRT1 regulates inflammation, cell migration, and wound healing. Sci. Rep. 7, 14110 (2017).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  98. 98.

    Qiang, L. et al. Autophagy gene Atg7 regulates ultraviolet radiation-induced inflammation and skin tumorigenesis. Autophagy 13, 2086–2103 (2017).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  99. 99.

    Gao, X. et al. The fat mass and obesity associated gene FTO functions in the brain to regulate postnatal growth in mice. PLoS ONE 5, e14005 (2010).

    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

  100. 100.

    Ming, M., Soltani, K., Shea, C. R., Li, X. & He, Y. Y. Dual role of SIRT1 in UVB-induced skin tumorigenesis. Oncogene 34, 357–363 (2015).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  101. 101.

    Wu, C. L. et al. Role of AMPK in UVB-induced DNA damage repair and growth control. Oncogene 32, 2682–2689 (2013).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  102. 102.

    Aceto, N. et al. Tyrosine phosphatase SHP2 promotes breast cancer progression and maintains tumor-initiating cells via activation of key transcription factors and a positive feedback signaling loop. Nat. Med. 18, 529–537 (2012).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  103. 103.

    Civenni, G. et al. Human CD271-positive melanoma stem cells associated with metastasis establish tumor heterogeneity and long-term growth. Cancer Res. 71, 3098–3109 (2011).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  104. 104.

    Barrett, T. et al. NCBI GEO: archive for high-throughput functional genomic data. Nucleic Acids Res. 37, D885–D890 (2009).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  105. 105.

    Zhou, G. et al. NetworkAnalyst 3.0: a visual analytics platform for comprehensive gene expression profiling and meta-analysis. Nucleic Acids Res. 47, W234–W241 (2019).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  106. 106.

    Liao, Y., Wang, J., Jaehnig, E. J., Shi, Z. & Zhang, B. WebGestalt 2019: gene set analysis toolkit with revamped UIs and APIs. Nucleic Acids Res. 47, W199–W205 (2019).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  107. 107.

    Oliveros, J. C. Venny. An interactive tool for comparing lists with Venn’s diagrams. https://bioinfogp.cnb.csic.es/tools/venny/index.html (2007–2015).

Download references

Acknowledgements

We thank Dr. Ann Motten for the critical reading of the manuscript. This work was supported in part by NIH grants ES031534 (Y.Y.H.), ES024373 (Y.Y.H.), ES030576 (Y.Y.H.), ES030546 (C.H.), the CACHET (NIH ES027792), the University of Chicago Comprehensive Cancer Center (NIH CA014599), the CTSA (NIH UL1 TR000430), and the University of Chicago Friends of Dermatology Endowment Fund. C.H. is an investigator of the Howard Hughes Medical Institute (HHMI).

Author information

Affiliations

Authors

Contributions

Y.Y.H. conceived the project. Y.C., S.Y., J.W., C.H., and Y.Y.H. designed the research. Y.C., S.Y., and J.W. carried out most of the experiments and/or performed data analyses with input from Y.Y.H. and C.H. C.R.S. performed the histological analysis of the human samples. W.Z., F.W., and P.S. helped with some of the experiments. M.G.K. and H.A. provided the human samples. X.C. contributed m6A seq and RNA seq data analysis. Y.C. and Y.Y.H. wrote the manuscript with input from S.Y., J.W., C.R.S., M.G.K., H.A., and C.H. All authors reviewed the results and the manuscript.

Corresponding author

Correspondence to Yu-Ying He.

Ethics declarations

Competing interests

C.H. is a scientific founder and a member of the scientific advisory board of Accent Therapeutics, Inc. The remaining authors declare no competing interests.

Additional information

Peer review information Nature Communications thanks Masaaki Komatsu, Guohui Wan and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Source data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Cui, YH., Yang, S., Wei, J. et al. Autophagy of the m6A mRNA demethylase FTO is impaired by low-level arsenic exposure to promote tumorigenesis. Nat Commun 12, 2183 (2021). https://doi.org/10.1038/s41467-021-22469-6

Download citation

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing