Complete sequences of Schizosaccharomyces pombe subtelomeres reveal multiple patterns of genome variation

Oizumi, Yusuke; Kaji, Takuto; Tashiro, Sanki; Takeshita, Yumiko; Date, Yuko; Kanoh, Junko

doi:10.1038/s41467-020-20595-1

Download PDF

Article
Open access
Published: 27 January 2021

Complete sequences of Schizosaccharomyces pombe subtelomeres reveal multiple patterns of genome variation

Nature Communications volume 12, Article number: 611 (2021) Cite this article

5169 Accesses
17 Citations
6 Altmetric
Metrics details

Subjects

Abstract

Genome sequences have been determined for many model organisms; however, repetitive regions such as centromeres, telomeres, and subtelomeres have not yet been sequenced completely. Here, we report the complete sequences of subtelomeric homologous (SH) regions of the fission yeast Schizosaccharomyces pombe. We overcame technical difficulties to obtain subtelomeric repetitive sequences by constructing strains that possess single SH regions of a standard laboratory strain. In addition, some natural isolates of S. pombe were analyzed using previous sequencing data. Whole sequences of SH regions revealed that each SH region consists of two distinct parts with mosaics of multiple common segments or blocks showing high variation among subtelomeres and strains. Subtelomere regions show relatively high frequency of nucleotide variations among strains compared with the other chromosomal regions. Furthermore, we identified subtelomeric RecQ-type helicase genes, tlh3 and tlh4, which add to the already known tlh1 and tlh2, and found that the tlh1–4 genes show high sequence variation with missense mutations, insertions, and deletions but no severe effects on their RNA expression. Our results indicate that SH sequences are highly polymorphic and hot spots for genome variation. These features of subtelomeres may have contributed to genome diversity and, conversely, various diseases.

A pan-genome of 69 Arabidopsis thaliana accessions reveals a conserved genome structure throughout the global species range

Article Open access 11 April 2024

Endogenous aldehyde-induced DNA–protein crosslinks are resolved by transcription-coupled repair

Article Open access 10 April 2024

Single-mitosis dissection of acute and chronic DNA mutagenesis and repair

Article Open access 16 April 2024

Introduction

Genomic DNA sequences provide fundamental information for biological study. The genomes of model organisms, such as Saccharomyces cerevisiae (S. cerevisiae)¹, Schizosaccharomyces pombe (S. pombe)², Caenorhabditis elegans³, Drosophila melanogaster⁴, Arabidopsis thaliana⁵, and Homo sapiens^6,7,8, have been sequenced in the past two decades, and most parts of these sequences have been reported. However, sequencing of long repetitive regions has not been completed because of technical difficulties in sequencing and chromosome allocation of such regions, as well as frequent occurrence of mutations and structural changes caused by chromosome rearrangements, such as recombination, translocation, chromosome breakage, and fusion^{9,10,11,12,13}.

Incomplete genomic DNA information can lead to inaccurate data in some experiments. For instance, we are unable to determine the precise chromatin localization of proteins in repetitive regions without actual DNA sequences. Evaluation of protein localization by chromatin immunoprecipitation assays involves PCR with sets of representative primers that target repetitive sequences or Southern blot analysis with representative probes. Chromatin localization values obtained using representative primers or probes merely show averages of all regions that have the target sequences, and they do not reflect actual patterns of chromatin association. Next-generation sequencers (NGSs) do not solve this problem if complete genome sequences are not provided. In addition, there may be uncharacterized genes in un-sequenced regions. Therefore, complete sequences of genomic DNA are crucial for accurate analyses and a deeper understanding of model organisms.

Telomeres, which exist at chromosome ends and possess species-specific tandem repeat sequences, play crucial roles in several cellular activities required for cell survival, including protection of chromosome ends, length regulation of telomere-specific repeat DNA, and regulation of chromosome movements during mitosis and meiosis^14,15,16,17. Subtelomeres, which are adjacent to telomeres, have sequences distinct from telomere repeats and generally contain multiple species-specific segments that share high similarity with other subtelomeres. In the budding yeast S. cerevisiae, the subtelomeres contain X and Y′ elements, the latter of which includes the open reading frame (ORF) of a helicase gene¹⁸. In humans, the subtelomeres are mosaics of ~50 types of common segments containing various ORFs, such as those for the DUX4 gene, which is related to facioscapulohumeral muscular dystrophy, and for the olfactory receptor family genes^9,19,20. Although substantial knowledge of telomeres has accumulated, research on subtelomeres has progressed slowly compared with research on other chromosomal regions because of technical difficulties caused by long and repetitive nature of this region and partially unknown sequences.

The fission yeast S. pombe is one of the most commonly used yeast model organisms for biological study. It preferentially proliferates as haploid in nutrient-rich media and possesses only three chromosomes (chromosome 1 [Ch1], 5.6 Mb; Ch2, 4.6 Mb; Ch3, 3.5 Mb), which enables the whole package of genetic analyses, such as screening for both dominant and recessive mutations, and generation of cells with circular chromosomes by deleting telomere DNA. S. pombe subtelomeres spanning ~100 kb are subdivided into two regions of ~50 kb each, the telomere-adjacent and telomere-distal regions (Fig. 1a). The telomere-adjacent regions (SH [subtelomeric homologous] regions) of subtelomeres contain SH sequences, which share high similarity (>90% identity) with at least one other subtelomere in S. pombe²¹ and form heterochromatin structures^22,23. This SH region is subdivided into two regions, the telomere-proximal SH-P and telomere-distal SH-D regions by their different features in 972 strains (Fig. 1a; see below). In contrast, the SH-adjacent regions (SU [subtelomeric unique] regions) share almost no sequence similarity with other subtelomeres, but exhibit common highly condensed chromatin structures called knobs²⁴ (Fig. 1a). Because of high sequence similarity, it is very difficult to distinguish individual SH regions of subtelomeres at different chromosome ends and to assemble repetitive subtelomeric sequences accurately, even if we use latest NGSs. Therefore, parts of SH regions remain un-sequenced for 19 years after vast majority of the S. pombe genome sequence was reported (S. pombe genome database, PomBase: http://www.PomBase.org/status/sequencing-status)² (Fig. 1b). Previously, parts of the four SH regions have been cloned and sequenced (pNSU series, see below)²⁵; however, they have not yet been allocated to specific subtelomeres (see PomBase).

**Fig. 1: Structures and previously unsequenced regions of subtelomeres in *S. pombe 972* strain.**

Results

Construction of strains containing single SH regions of 972

To overcome the difficulty in allocating each SH sequence to a specific subtelomere, we constructed strains containing single SH regions of the standard S. pombe strain 972 (h⁻). Strain 972 used in this study (a derivative of the original 972 (ref. ²⁶)), which has not been crossed with other strains, possesses four SH sequences (SH1L, SH1R, SH2L, and SH2R, as shown in Fig. 2a) adjacent to the telomeres of Ch1 and Ch2, but no SH sequence in Ch3 (note that some descendent strains of 972 possess a partial (~16 kb-long) SH sequence adjacent to the telomeres of the left and/or right arms of Ch3; see Supplementary Fig. 1)^21,27,28. We previously produced the SD5 (SH deletion 5) strain, in which all five SH regions that are located at both ends of Ch1 and Ch2, and the left end of Ch3 were replaced with a marker gene (his7⁺ or ura4⁺) in a nonstandard strain JP1225 background²¹. Strain 972 was crossed with SD5, and the first or second filial progeny were analyzed for the presence or absence of each SH region by pulse-field gel electrophoresis (PFGE) followed by Southern blotting (Fig. 2a–d; also see “Methods” section). We screened for strains that exhibit a single band of telomere-associated sequence (TAS)²⁹ (i.e., SH). We obtained strains that contain a single SH region of 972 and named them 972SD4[1L+, 1R+, 2L+, or 2R+], since they carry deletions of four SH regions in the original SD5 and one intact SH region from 972. Each intact SH region in 972SD4 was named as 972SD4-SH1L, 972SD4-SH1R, 972SD4-SH2L, or 972SD4-SH2R.

**Fig. 2: Construction of *972SD4* strains containing a single SH region of strain *972*.**

Cloning and sequencing of SH-P regions

From the data in PomBase, multiple common segments aligned in a mosaic pattern were expected for the SH-P region (see below). In order to accurately assemble such repetitive sequences, we amplified the SH-P region (~5 kb) in each 972SD4 by PCR and cloned into a vector. Partial deletion series of the SH-P fragments was constructed by digesting the plasmids with restriction enzymes followed by treatment with exo- and endo-nucleases. Re-circularized plasmids that carry the SH-P fragments with various lengths were sequenced using primers that anneal to the vector (Supplementary Fig. 2, see “Methods” section).

SH-P regions exhibit highly variable mosaic structures consisting of common segments

We classified the sequences of SH-P regions of the 972SD4 strains, a part of SH2R in PomBase (PomBase-SH2R), and insertions in the pNSU series in PomBase²⁵ into common segments (A–X) as follows. First, the sequences of SH-P regions were classified into common segments that meet the criteria of ≥ 50 bp and >95% identity using NCBI nucleotide BLAST (blastn) program (v2.10.0+, https://blast.ncbi.nlm.nih.gov/Blast.cgi). Then, gaps between the segments were classified into additional segments that meet the criteria ≥14 bp and >95% identity. Segments were classified into variants (e.g., A1 and A2) that meet the criteria of 100% identity (Fig. 3a and Supplementary Fig. 3). To reduce the number of common segments, exceptional rules were applied for subtypes C (C1–3) and C′, E, E′, and E′′, K and K′, and S and S′, which contain different copies of several common sequence motifs that show 100% identities except for motifs in subtype C, c1–8 (Fig. 3b and Supplementary Fig. 3). SH-P regions in two independent strains (#1 and #2) of 972SD4[1L+], 972SD4[1R+], and 972SD4[2L+] exhibit 100% sequence identity, suggesting that no mutation or rearrangement have been introduced to the SH-P sequences of these 972SD4 strains during crossing, amplification by PCR, cloning using Escherichia coli (E. coli), and construction of serial deletion mutants. In contrast, two strains of 972SD4[2R+] contain different variants of segment D, D1 and D3, which show differences in two nucleotides, suggesting that the two point mutations at segment D and/or interchromosomal recombination have occurred in 972 or 972SD4[2R+] (Fig. 3a and Supplementary Fig. 3d).

**Fig. 3: Highly variable *SH-P* regions consist of common segments in strain *972*.**

We found that none of the SH-P regions of 972SD4 show the same pattern in the alignment of segments to each other; however, two pairs of regions, 972SD4-SH1L and pNSU21/65, and 972SD4-SH2L and pNSU64, each exhibit the same segment patterns over the whole SH-P regions, suggesting the possibility that these pairs were derived from the same subtelomeres. However, the compositions of the C and D variants are different (C1 vs. C2 or C3, and D1 vs. D3; Fig. 3a, gray dotted lines). We found that segments C in 972SD4 strains are particularly different from those of pNSUs (Fig. 3a, gray dotted lines); i.e., variant C1 is the majority in the SH-P sequences of 972SD4, whereas variant C2 is the majority in those of pNSUs. These data suggest that segment C is prone to mutation and recombination possibly due to its highly repetitive structure (Fig. 3b).

In contrast to 972SD4-SH1L and 972SD4-SH2L, 972SD4-SH1R and 972SD4-SH2R show combinations of pNSU patterns (Fig. 3a). Moreover, subtypes E′′ and K′, and variant H2 are unique to 972SD4-SH1R among the SH-P sequences of 972SD4 and PomBase-972, suggesting that multiple times of mutation and recombination have occurred at 972SD4-SH1R. Surprisingly, 972SD4-SH2R exhibits a pattern different from a part of the PomBase-SH2R sequence; indeed, the pattern of PomBase-SH2R is found in a part of 972SD4-SH1L, implying that SH1L and SH2R have exchanged their chromosomal positions over repeated rounds of cell divisions.

Although we identified several variants for each segment, these variants are not randomly combined, and partial sequences show the same alignments; for instance, there are two common alignments: P1-Q1-----V-Q3 (in 972SD4-SH1L, PomBase-SH2R, pNSU21/65, and pNSU70/77) and E-F2-----P3-Q3 (in 972SD4-SH2L, 972SD4-SH2R #1, 972SD4-SH2R #2, and pNSU64). Overall changes in the segment and variant compositions imply that SH-P regions are prone to nucleotide change and chromosome rearrangement.

SH-P regions exhibit high variation in segmental arrangement among 972 strains and natural isolates of S. pombe

To elucidate how SH-P regions have changed in the course of culturing or evolution, we next extracted uncharacterized sequences of the SH-P regions in various natural isolates of S. pombe in J. Bähler’s laboratory in UK (JB strains), using previous raw data by Tusso et al. (long-read sequencing using Nanopore MinION and PacBio RS II)³⁰ (Fig. 4a, see “Methods” section for details). Our analyses on chromosome configuration suggested that chromosome end fragment of Ch1R has been swapped with that of Ch2R in JB934 in comparison with 972, as described previously (Supplementary Fig. 4)³⁰. Although long-read sequencing data lack accuracy, we were able to analyze patterns of segments (A–X) and subtypes, but not at the variant level (see figure legends of Fig. 4 for details).

**Fig. 4: High variation in *SH-P* regions in diverse *S. pombe* strains.**

JB22 (972), another clone of 972, has SH regions only at the ends of Ch1 and Ch2, not in Ch3, as in the strain 972 in our laboratory. However, SH-P regions in JB22 (972) have different segment patterns and lengths from those in 972SD4 except for SH2R, which does not contain a segment alignment homologous with PomBase-SH2R. These data indicate that chromosome rearrangement occurs frequently in SH-P regions during culturing in laboratories (Figs. 3a and 4b).

Segment patterns and lengths of SH-P regions in each 972 strain are divergent, whereas JB760, JB1174 (except for SH1R), JB858, and JB1197 exhibit almost uniform segment patterns and lengths among the subtelomeres (Fig. 4c, d, f, h). It is unclear which type is the original SH-P in S. pombe; however, the divergent property is likely ancestral because repeated interchromosomal rearrangements will result in uniform patterns of SH-P regions.

We detected some sequences that have not been found in 972 strains but shared by several subtelomeres in JB strains (indicated by black boxes α–δ in Fig. 4 and Supplementary Fig. 5). Particularly, partial sequences of SH1L and SH2R in JB873 (segments A-I-----∆P-∆Q containing black boxes) are highly homologous with the SH-P sequences in JB1197 (Fig. 4g, h). Furthermore, JB934 does not possess any SH sequence in Ch1L, and JB873 contains partial sequence of long terminal repeat (LTR) of retrotransposon in the SH-P region of SH2L (Fig. 4e, g).

Interestingly, there are two major types of structures at chromosome ends, telomere-segment A-segment B (Tel-A-B) and telomere-partial segment F-segment G (Tel-∆F-G). Tel-A-B is found in 972 and JB760 (Figs. 3a and 4b, c), whereas Tel-∆F-G is found in JB1174, JB934, JB858, and JB873 (Fig. 4d–g). We found that the sequences of segments A and B is highly similar to those of partial segment F and segment G, suggesting the possibility that homologous recombination (HR) between them resulted in a Tel-∆F-G structure (Supplementary Fig. 6a). Other possibilities are that nucleotide changes have occurred in either A-B or ∆F-G (Supplementary Fig. 6b), or that the G-rich sequences located at the telomere-proximal ends of segment A and ∆F formed G-quadruplex-like structures and stalled replication fork progression³¹, which resulted in chromosome breakage accompanied by de novo telomere synthesis (Supplementary Figs. 3 and 6c). Overall diversity of the SH-P regions in JB strains further support our hypothesis that SH-P regions are hot spots for genome evolution.

SH-D regions in 972 strains are variable and accumulate insertions and deletions

We also determined sequences of SH-D regions in 972SD4 strains by integrating the partial SH-D sequences in PomBase and our newly determined SH-D sequences. The integrated SH-D sequences were classified into common block sequences I–XI (>90% identities between the sequences of the same blocks), and supplemental homologous box sequences Ψ and Ω (Fig. 5a and Supplementary Table 1). In contrast to the SH-P regions, the SH-D regions in strain 972 do not show duplications or differences in orders of blocks I–XI. However, we found differences in length; multiple insertions or deletions were identified in these regions (Fig. 5b).

**Fig. 5: Sequence variations of *SH-D* regions in *972SD4* and PomBase-*972*.**

There are three big differences between subtelomeres (Fig. 5b, thick lines; note that part of them has been described in a previous study³²). First, there are 3.7 kb deletions in SH1R, SH2L, and SH2R at position 4,520,423 of PomBase-SH2R. Second, there is a 7.1 kb deletion in SH1R at nucleotides 4,514,836–4,507,710 of PomBase-SH2R. This deletion was detected in the three independent strains of 972SD4[1R+] by PFGE-Southern analysis (Fig. 2d). Third, there is a 1.9 kb deletion in SH1L at nucleotides 4,500,309–4,498,438 of PomBase-SH2R.

Intriguingly, boxes Ψ exist at the ends of the 3.7 kb change (Fig. 5a, b, purple and pink boxes, Supplementary Fig. 7a, b, and Supplementary Table 1). Similarly, boxes Ω exist at the ends of 7.1 kb changes (Fig. 5a, b, brown, red, and orange boxes, Supplementary Fig. 7c, d, and Supplementary Table 1). These data imply that the deletions and/or insertions have occurred using these homologous sequences. It is noteworthy that among Ω sequences that are indicated by different colored boxes, there are multiple insertions and deletions in the region where various repeat sequences are arranged intricately, and the sequence of ΩSH1L-L (indicated by a brown box) shows lowest sequence identity (83–85%) with other red or orange boxes (Supplementary Fig. 7c, d).

There are also smaller insertions or deletions in SH-D regions (Fig. 5b, thin dotted lines for changes of 10–40 bp compared with PomBase-SH2R). Many of these are observed in no less than two SH-D regions, suggesting that these changes have been copied to other SH regions by chromosome rearrangement. It is also noteworthy that the newly sequenced SH2R in 972SD4[2R+] contains an insertion at position 4,529,376 of PomBase-SH2R, indicating that this insertion has been introduced to SH2R of strain 972 in laboratories after separated from PomBase-972.

To examine stability of the SH-D regions, their DNA structures in two independent strains of 972SD4[1L+], 972SD4[1R+], 972SD4[2L+], and 972SD4[2R+] were analyzed by PCR using multiple primer sets (PCR products i–ix are indicated by gray arrows in Fig. 5b, top. Note that the fragments i–ix in Fig. 5b roughly correspond to blocks I–IX in Fig. 5a). We found that lengths of the all PCR products matched those predicted from PomBase sequence (Fig. 5c), indicating that the overall DNA structures of SH-D regions are stably maintained between PomBase-972 and 972SD4 strains in contrast to those of SH-P regions. We calculated the full length of each SH region (SH-P and SH-D): SH1L, 61.9 kb; SH1R, 39.1 kb; SH2L, 59.1 kb; and SH2R, 49.5 kb, with SH1R having the shortest SH sequence, although these lengths are likely to change through chromosome rearrangements at SH regions.

To examine evolutional change of SH-D regions, we next analyzed SH-D regions in JB strains using previous NGS data (long-read sequencing) by Tusso et al.³⁰. The SH-D regions in JB22 (972) show clear differences compared with those in PomBase-972 and 972SD4, although the overall pattern of common blocks is very similar (Fig. 6a, b). Block IV and a purple box (Ψ) sequences are present in both SH1L and SH2L in JB22 (972), but not in SH2L in 972SD4. In addition, a brown box sequence (Ω) resides between blocks V and VI in SH1L and SH2L in JB22 (972), whereas the sequence is replaced by a red box sequence (Ω) in SH2L in 972SD4. These data suggest the possibility that HR has occurred between the SH-D regions in SH1L and SH2L in JB22 (972). Thus, the SH-D regions in 972 strains are not highly stable; rather, changeable via recombination.

**Fig. 6: Sequence variations of *SH-D* regions in JB strains.**

SH-D regions exhibit striking variations among JB strains

The SH-D regions of the other JB strains show striking variation in numbers and orders of block sequences. Furthermore, various box sequences that are not categorized as SH-D in 972 strains are shared by multiple SH-D regions in JB strains (Fig. 6c–h). It is noteworthy that 972 strains have no SH sequence in Ch3, whereas JB760, JB1174, JB858, and JB873 possess SH-P and SH-D sequences in Ch3 (Figs. 4 and 6). Intriguingly, some descendent strains of 972 also possess SH sequences at either or both ends of Ch3 (Supplementary Fig. 1, KYP33 and JP1225). These data suggest two possibilities; one is that another standard strain 975 (h⁺) contains SH sequence(s) in Ch3, and it has been transferred to descendent strains via mating and meiosis. Another is that SH regions in Ch1 or Ch2 have been translocated to Ch3 via interchromosomal recombination. In fact, the SH-P sequence in JP1225 shows high similarity with those of 972SD4-SH2R and pNSU71 (Fig. 3a and Supplementary Fig. 1c). However, the former is more possible because of the existence of a black box θ sequence associated with SH-D in Ch3, which has not been found in 972 strains (see below).

Interestingly, multiple copies of brown box sequences (Ω) and SH-P sequences [1]–[8] are found in the SH-D sequence in JB760 (Fig. 6c). Moreover, adjacent to block II is a black box θ. The alignment of I-II-θ is also found in Ch3 of JB1174, JB858, and JB873, although partial LTR sequences are inserted in block I in JB1174 and JB873 (Fig. 6d, f, g). Intriguingly, the sequence of box θ is almost identical with that of SAS (spanning ~1.1 kb), which was identified as a subtelomere-associated sequence adjacent to block II in Ch3 in the descendent strains of 972 previously^21,27 (Supplementary Fig. 1b–d). Thus, structures of SH-D regions in Ch3 are highly conserved in S. pombe in contrast to other parts of SH-D possibly because the ends of Ch3 are located in the nucleolus apart from those of Ch1 and Ch2 located in the nucleus in vegetatively growing cells¹⁷, which may restrain interchromosomal recombination between Ch3 and Ch1 or Ch2.

The SH-D regions of JB strains except for JB22 (972) and JB760 showed high variation in their compositions and lengths; however, they share some common features. (1) Blocks I and II are highly conserved. (2) Multiple copies of parts of the SU regions in 972 (indicated by pale blue boxes, ε–η, in Fig. 6a, see Supplementary Table 1 for their positions) are found in the SH regions in these strains (indicated by blue boxes in Fig. 6). (3) Multiple black boxes, θ–τ, which are not found in 972 are also shared by the subtelomeres of JB strains except for JB22 (972) (Fig. 6). (4) Blocks I and XI (green) and boxes ε (blue) and ζ (blue) are found inverted compared with those in 972 (Fig. 6d, e, g). (5) Surprisingly, the SU region of JB858 and the SH-D regions of JB858 and JB873 contain sequences of parts of mitochondrial genome (indicated by Mt in Fig. 6f, g). The overall changes in SH-D regions in JB strains indicate that complexed chromosome rearrangements have occurred in the course of evolution of S. pombe even after strain 972 has been isolated.

Subtelomeres are hot spots for mutations

Given that the SH-P regions of 972SD4 contain multiple nucleotide changes compared with those in PomBase-972 (Fig. 3 and Supplementary Fig. 3), we examined whether mutation rates are specifically high in subtelomeres. First, sequences of multiple loci in the SH-D of SH2R in two independent 972SD4[2R+] strains (#1 and #2) were determined and compared with those of PomBase-972 (Fig. 7 and Supplementary Table 2). We found that regions around the tlh2 gene locus exhibit high rates of mutations. Most of them are point mutations, but some are changes of numbers of repeat sequences, such as [T]_n. It should be noted that the two 972SD4[2R+] strains possess different sequences in the tlh2 locus (99.44% vs. 99.41% identities with PomBase). In contrast, the telomere-distal half of SH-D region and all chromosomal regions outside of SH, i.e., the SU region, the subtelomere boundary region, the SA region (see Fig. 1a), and various gene loci in Ch1 or Ch2 in the two 972SD4[2R+] strains show 100% sequence identities with those in PomBase-972, indicating strict preservation of their DNA sequences through repeated rounds of cell division. These data suggest that the telomere-proximal half of SH-D regions (~20 kb), as well as SH-P regions are particularly prone to the accumulation of mutations.

**Fig. 7: Subtelomeres are hot spots for sequence variation.**

We next examined mutation rates in JB strains using previous NGS data (long-read sequencing by Tusso et al.³⁰ and short-read sequencing with high accuracy using Illumina HiSeq 2000 by Jeffares et al.³³, see “Methods” section for details). Only the chromosomal loci outside of SH were analyzed because SH regions are not distinguishable using short reads. We found that JB22 (972) showed 100% sequence identities with PomBase-972 at the all loci examined (Fig. 7 and Supplementary Table 2), indicating that genome integrity is strictly maintained through repeated rounds of cell division at these loci.

In striking contrast, JB strains other than JB22 (972) exhibit high mutation rates at the SU, subtelomere boundary, and SA regions in Ch2R (Fig. 7 and Supplementary Table 2), indicating that subtelomeres are prone to nucleotide changes during the long-time course of S. pombe evolution. Interestingly, some JB strains show relatively high mutation rates at the chromosome loci of nonessential genes, especially the rap1 gene (Fig. 7 and Supplementary Table 2). Rap1 is a subunit of the shelterin complex, which protects chromosome ends and regulates various telomere functions^15,34. Rap1 is recruited to telomeres partly through interaction with a telomere DNA-binding protein Taz1 and associates with multiple proteins to regulate various telomere functions^34,35,36. Amino acid changes of Rap1 are rarely found in the regions for interactions with its partners (Supplementary Fig. 8). We found one amino acid change, glutamic acid (E) 671 to arginine, in the RCT (Rap1 C-terminal) domain of Rap1, which mediates interaction of Rap1 with Taz1; however, it was suggested that E671 is not involved in their direct interaction³⁷. Moreover, one amino acid change, E424 to alanine, is found in the DD (dimerization domain) of Taz1, which is important for Taz1 binding to telomere DNA; however, E424 is located outside of the direct interaction domain³⁸. Furthermore, we found that the sequences of telomere repeats in JB strains are highly similar to those in 972 strains. Thus, it seems that the principal functions of Rap1 and Taz1 are conserved during the course of S. pombe evolution. It is likely that the higher mutation rates in the rap1 and taz1 genes are because their gene products are more tolerant to amino acid changes than other gene products.

Identification of additional members of the subtelomeric RecQ helicase gene family

In genome sequences in PomBase-972, there are two RecQ helicase genes, tlh1 (partial) and tlh2, which have been allocated to SH1L and SH2R, respectively. Parts of the DNA sequences of tlh1/2 are homologous with the dh repeat sequence of pericentromeres and serve as templates for small interfering RNA (siRNA) produced by RNA interference (RNAi) machinery; further, the siRNA participates in the initiation of subtelomeric heterochromatin formation^22,23. Our sequencing data of SH regions newly identified two members of the tlh gene family, tlh3 and tlh4, in SH1R and SH2L, respectively. Thus, genome of strain 972 contains four tlh genes in total (Fig. 8a and Supplementary Fig. 9).

**Fig. 8: Identification of *tlh* genes with multiple mutations.**

The descendent strains of 972 possess additional tlh ORF(s) in Ch3 (Supplementary Fig. 1), that may have transferred from their other chromosome ends or from mating partners. We also found multiple putative tlh genes in the SH-D regions of JB strains (Fig. 6, blue arrows). All JB strains possess at least two tlh genes because tlh genes are located in block II, which is highly conserved among the strains.

The tlh genes contain multiple nucleotide changes

Examination of the tlh sequences raised the possibility that the ORF for the tlh2 gene is not properly defined in PomBase. In the sequence of PomBase-SH2R, there is an in-frame methionine (Met) codon (uMet [upstream Met]) 543 bases (corresponding to 181 amino acids) upstream of the original first Met codon (dMet [downstream Met]) that was defined by PomBase (Fig. 8b and Supplementary Fig. 9). The sequences surrounding these Met codons match the Kozak consensus sequence (A/GNNATGG, the initiation codon underlined), which participates in the initiation of translation in eukaryotes³⁹, suggesting that the uMet may be the true initiation codon for translation.

Unexpectedly, each of the newly sequenced tlh1–4 genes of 972SD4 was found to contain multiple nucleotide changes (i.e., point mutations, insertions, and deletions) compared with the tlh2 gene in PomBase (Fig. 8b and Supplementary Fig. 9). There are tandem repeat sequences at the loci where insertion occurred in the long coding region: [ATGACA]_n at the most N-terminal insertion (the 6 bp insertion), [CGACAA]_n at the middle insertion (the 18 or 24 bp insertion), and [TGATGG]_n at the most C-terminal insertion (the 6 bp insertion), suggesting that these repetitive sequences are highly prone to recombination (Fig. 8b, orange arrowheads). Because of these changes, the uMet′ codons of tlh1, tlh2, and tlh4 located upstream of uMet are no longer in-frame to the long coding sequence from the dMet codons, and only short coding sequences are predicted because of a termination codon derived by a point mutation (Fig. 8b, light purple lines with a dark green line). Intriguingly, multiple nucleotide changes, including point mutations, insertions, and deletions, did not introduce premature termination codons within the long ORFs of the tlh genes in 972SD4. Similarly, the tlh gene(s) of Ch3 in the 972 descendent strains (KYP33 and JP1225) lack 24 bp immediate downstream of the dMet codons; however, no frame shift occurs, and uMet′ codons are supplied by the SAS sequence in the same codon frame (Supplementary Fig. 1d).

RNA expression from the tlh genes in 972SD4

To examine our assumption that the tlh genes have longer protein-coding sequence than that previously predicted by PomBase, we determined ranges of tlh RNA expression by reverse transcription (RT)-PCR (Supplementary Fig. 10). We detected RNAs of tlh genes that contain at least 950 bases upstream of the dMet codon (~400 bp upstream of the uMet codon). These data suggest that the tlh genes may have protein-coding sequences that are potentially 543 bases longer than that defined in PomBase (Fig. 8b, a light purple line in the top panel).

To examine whether the tlh genes in 972SD4 carrying multiple mutations are capable to produce dh RNAs that participate in the formation of subtelomeric heterochromatin, we determined the RNA expression level from the dh-homologous region of each tlh gene in clr4∆ cells where the strong gene silencing by subtelomeric heterochromatin is omitted²³. We found that these four tlh genes express dh RNAs; however, the expression levels were lower than one-fourth of that in the wild-type strain possibly due to lack of positive feedback regulation by other tlh RNA expression (Fig. 8c). These results suggest that DNAs of the tlh genes are prone to mutations without severely affecting RNA expression.

Discussion

This study describes in-depth analyses of subtelomeres in S. pombe. We obtained complete sequences of subtelomeres in the standard S. pombe strain 972 by producing strains with single SH regions. We also extracted SH sequences of some natural isolates of S. pombe strains (JB strains) from previous NGS data. The whole sequences revealed that SH regions are composed of two parts: the telomere-adjacent SH-P region and telomere-distal SH-D region. The SH-P region is a mosaic of multiple common segments that vary among subtelomeres and strains, suggesting that this region is highly prone to chromosomal rearrangement during cell divisions. In contrast, the SH-D region shows high sequence similarity among subtelomeres and 972 strains, although there are some insertions, deletions, and chromosomal rearrangement, suggesting that the overall DNA structure of this region is stably maintained during short-term culturing. However, JB strains other than JB22 (972) exhibited striking variation in the structures of SH-D regions, indicating that SH-D regions are also susceptible to chromosomal rearrangement during long-term evolution of S. pombe. Interestingly, not only SH but also SU regions exhibit high rates of nucleotide changes among strains, whereas chromosomal regions outside of this region are subject to highly strict genome preservation. Thus, subtelomeres are hot spots for genome evolution and exhibit multiple patterns of genome variation (Fig. 9).

**Fig. 9: Summary of features of *S. pombe* subtelomeres.**

Human subtelomeres (SH regions in humans) are also mosaics of multiple common segments that correspond to the SH-P region in S. pombe. However, they contain no sequence equivalent to that of the SH-D region, i.e., a relatively long common sequence shared by all subtelomeres^9,19. Common segments of the same categories are mostly nonidentical (~90–100% identities), and the location and copy number of each segment vary among individuals^9,40. In S. cerevisiae, the subtelomeres have common X and Y′ elements, and ORFs of proteins such as PAU and FLO families; however, copy numbers of the Y′ element and the ORFs are highly variable among strains^18,41. Based on these findings and studies in other species, along with our results in S. pombe, we propose that high variation in SH sequences is a common feature in eukaryotes.

What underlies this high variation of SH regions? First, DNA double-strand breaks (DSBs) are repaired by either HR or nonhomologous end joining. Vegetative cell cycle of the wild-type S. pombe strain lacks G₁ phase because cells already possess sufficient mass to proceed to S phase when the previous mitosis is completed. Therefore, ~80% period of the S. pombe cell cycle is G₂ phase, when HR predominates for DSB repair⁴². Because of the high sequence identities among SH regions, DNA repair by HR may occur frequently between SH regions of different chromosomes (interchromosomal repairs), as well as between sister chromosomes (intrachromosomal repairs), which causes gross rearrangement of chromosomes. Second, repetitive sequences within SH regions may be recognized by HR machineries, causing amplification or deletion of the repeat units. Third, repetitive sequences, including S. pombe telomeres and subtelomeres, are regions intrinsically difficult to replicate during S phase^43,44,45. Replication fork collapse and erosion of telomeres and subtelomeres can result in formation of single-ended DNA breaks that are repaired by break-induced replication (BIR)⁴⁶. Recent studies suggested that BIR is a highly inaccurate DNA repair mechanism, and causes high levels of mutations and chromosome rearrangements^{47,48,49,50,51,52}. Therefore, BIR may cause high rates of mutations and chromosome rearrangements in SH regions. Fourth, the SH-D region serve as a fusion point of chromosome circularization when telomeres are lost⁵³. S. pombe has only three chromosomes, which enables cells to survive telomere crisis by self-circularization of each chromosome²⁹. Chromosome end fusions of Ch1 and Ch2 take place between H1–5 and their inverted sequences, H1′–5′, which are located in blocks I, II, and V (Fig. 5b, pink arrows)⁵³. It is possible that chromosome circularization and re-linearization promote chromosome rearrangement of SH-D regions.

Importantly, in the subtelomeres (i.e., the SH and SU regions) of S. pombe, there is no gene essential for cell growth under normal culture conditions, and deletion of all SH regions does not affect cell growth per se²¹. Genomes of other species also contain multiple copies of the same genes in SH regions. This may explain why cells can continue to grow, even with mutations in SH (and SU) regions, resulting in the accumulation of mutations. The SU regions are known to form knob bodies that are highly condensed chromatin structures, which may prevent precise DNA replication or normal DNA repair, and causes the accumulation of nucleotide alterations^21,24 (Fig. 9).

Surprisingly, the tlh genes in 972SD4 contain no nonsense mutation in their ORFs, although they contained various mutations compared with the tlh2 gene in PomBase. We found that some of the mutations cause alterations in the amino acid sequences of the conserved RecQ motif (Supplementary Fig. 11). Absence of premature termination codon is important for suppression of mRNA degradation mediated by the NMD (nonsense-mediated mRNA decay) mechanism⁵⁴. Thus, it is likely that the principal function of the tlh genes is to produce RNAs containing dh sequences, and that presence of the tlh ORFs is advantageous for their normal RNA expression, which induces heterochromatin formation. Although a previous study suggested that the tlh genes are involved in survival after telomere shortening⁵⁵, functions of the Tlh protein is not clarified yet.

Over 70 years since Dr. Urs Leupold isolated S. pombe standard strains, 968 (h⁹⁰), 972 (h⁻), and 975 (h⁺), from the Delft culture²⁶, it has been believed that these three strains possess almost the same genetic information except for the mating-type genes. This and previous studies have shown that 972 has no SH sequence in Ch3, whereas some of its descendent strains possess SH region(s) with SAS in Ch3^21,27,28 (Fig. 6 and Supplementary Fig. 1). It is noteworthy that the SAS sequence is absent from the genome of 972. The three standard strains have been traveling over the world to produce numerous number of descendent strains through mating and meiosis⁵⁶. Therefore, the assumption is that 968 and/or 975 had already had SH region(s) in Ch3 when they were first isolated.

Taken together, we propose that subtelomeres are highly polymorphic chromosomal regions and contribute to genome evolution. In this study, we have shown that the DNA sequence of the tlh2 gene has changed from that of the original strain 972 after repeated rounds of cell division (Fig. 8b). Human SH regions also contain various genes, such as DUX4 (associated with facioscapulohumeral muscular dystrophy) and olfactory receptor genes^9,19. Thus, the high rates of polymorphisms in SH regions may contribute to human diversity and sometimes to disease susceptibilities. It is intriguing to investigate correlation between various human diseases and SH sequences. Overall, genome rearrangement, deletion, insertion, and mutation can cause changes in ORFs, which may result in diversification of species.

Methods

Strains and general techniques for S. pombe

S. pombe strains used in this study are listed in Supplementary Table 3. Growth media and basic genetic and biochemical techniques used in this study were described previously^57,58,59.

Construction of 972SD4 strains

To construct 972SD4 strains carrying single SH regions of the standard wild-type strain 972, the SD5 strain (ST3524)²¹, in which all five SH regions were replaced with selective marker genes (his7⁺ or ura4⁺), was crossed with strain 972, and then the progeny were crossed back with the SD5 strain (ST3479 or ST3524) again. The presence or absence of each SH region in the resulting progeny were examined by PFGE followed by Southern blotting.

PFGE

PFGE of NotI-digested chromosomal DNA was performed using a CHEF-DR III Pulsed-Field Electrophoresis System (BioRad) under the following conditions: 1% SeaKem Gold Agarose (Lonza) in 0.5× TBE; temperature, 10 °C; initial switch time, 40 s; final switch time, 80 s; run time, 18 h; voltage gradient, 6.8 V/cm; and angle, 120°.

Southern blotting

NotI-digested chromosomal DNA was separated by PFGE and subjected to Southern blotting. Telomeric DNA and TAS fragments (TAS1, TAS2, and TAS3) were excised from pNSU70²⁵, and used as the telomere and TAS probes, respectively. The SPBCPT2R1.03 ORF was amplified by PCR and used as the probe that specifically recognizes the SH-D regions of subtel1L, subtel2L, and subtel2R, but not subtel1R in 972. These DNA fragments were labeled with digoxigenin (DIG), using a DIG High Prime DNA Labeling and Detection Starter Kit II (Roche), and signals were detected according to the manufacturer’s instructions.

Cloning and sequencing of SH regions

DNA fragments containing SH-P regions (~5 kb) were amplified by PCR from genomic DNA of each 972SD4 strain using Phusion High-Fidelity DNA polymerase (Thermo Fisher) and the following primers.

$${\!\!\!\!}{\mathrm{jk}}1861\!:\!5^\prime \!- {\mathrm{ACTAGTGGATCCCCCTGTAACCACGTAACCTTGTAACC}} - 3^\prime$$

$${\mathrm{jk}}1862\!:\!5^\prime\! - {\mathrm{GAATTCCTGCAGCCCGGTTTGAGCATCTGTCAGAGGTAA}} - 3^\prime$$

Each DNA fragment was inserted at the Sma1 site of pBluescript SK(−) (Stratagene) using In-Fusion HD Cloning Kit (Clontech). The resulting plasmids were digested with Kpn1 and Xho1 at the multiple cloning site of the vector and treated with exonuclease III (Takara) and mung bean nuclease (Takara) for fixed times to obtain deletion series from the XhoI cutting site (5′-protruding end). Both ends of the plasmids were blunted with Klenow fragments (Takara) and ligated with DNA ligase (Takara). The re-circularized plasmids were cloned using E. coli, XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacI^qZ∆M15 Tn10 (Tet^r)]), and then sequenced using the following primers that anneal to the vector.

$${\mathrm{st}}13\,\left( {{\mathrm{M}}13\,{\mathrm{primer}}\,{\mathrm{M}}3} \right){\!}:{\!}5^\prime \!- {\mathrm{GTAAAACGACGGCCAGT}} - 3^\prime$$

$${\mathrm{st}}14\,\left( {{\mathrm{M}}13\,{\mathrm{primer}}\,{\mathrm{RV}}} \right){\!}:{\!}5^\prime\! - {\mathrm{CAGGAAACAGCTATGAC}} - 3^\prime$$

The DNA sequence of SH-P was assembled using the overlapping sequences of serial deletion plasmids (Supplementary Fig. 2). Two independent strains of each 972SD4 were analyzed.

DNA fragments (1.3–2.9 kb) of the SH-D region were amplified by PCR and sequenced, except for the regions with some repeats that were sequenced using the deletion method described above. Two independent strains of each 972SD4 were analyzed.

DNA sequences were determined using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), Prism 3130xl Genetic Analyzer (Applied Biosystems), and DNA Sequencing Analysis Software v5.4 (Applied Biosystems). In addition, some DNA sequences were determined by Eurofins Genomics Inc.

Analyses of previous NGS data of JB strains

To analyze DNA sequences at subtelomeres and other chromosomal loci in JB strains, we utilized previous raw data from NGS by Tusso et al. (long-read sequencing by Nanopore MinION and PacBio RS II; NCBI Sequence Read Archive, PRJNA527756 [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA527756])³⁰ and those by Jeffares et al. (short-read sequencing by Illumina HiSeq 2000; European Nucleotide Archive, PRJEB2733 [https://www.ebi.ac.uk/ena/browser/view/PRJEB2733])³³.

De novo assembly of the long reads (by MinION) were performed as follows. Adaptor and its adjacent (10–20 bp) sequences in raw read data were trimmed using Porechop (v0.2.4, https://github.com/rrwick/Porechop) and fastp (v0.20.1)⁶⁰. The trimmed long reads were assembled by Canu 2.0 (ref. ⁶¹), using the NIG supercomputer. Chromosome configurations compared with those in strain 972 were analyzed using MUMmer4 (ref. ⁶²).

To determine sequences at SH regions, we collected long reads that contain telomere repeats and telomere-adjacent segments at their ends using NCBI nucleotide BLAST (blastn). The collected reads were classified into several categories using AliView (v1.26)⁶³ and MAFFT (v7.453)⁶⁴, and the sequences of each category were combined into one consensus sequence using Minimap2 (v.2.17-r941)⁶⁵ and Racon (v1.4.13)⁶⁶. Locations of the SH sequences were determined by search for homologous sequences in the chromosome assembly described above. Long-read data (by PacBio RS II) were also used to improve the quality of sequences.

To determine sequences other than SH, we searched target sequences in the de novo assembly described above and polished them by Pilon (v1.23)⁶⁷ using short-read data.

RNA analyses

Total RNA was purified from exponentially growing cells as described previously²⁸. For the RT-PCR, complementary DNA was synthesized with random primers using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and analyzed by conventional PCR (Supplementary Fig. 10) or quantitative PCR using a StepOne Real-Time PCR System (Fig. 8c). Primer sequences are listed in Supplementary Table 4.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

DNA sequences of newly sequenced SH regions are available in the DNA Data Bank of Japan (DDBJ) under accession codes LC521649 (~1.7 kb of the SH-D region [SH1L] in 972SD4[1L+] #1), LC521650 (~1.7 kb of the SH-D region [SH1L] in 972SD4[1L+] #2), LC521651 (the SH1L region in 972SD4[1L+] #1), LC521652 (the SH1L region in 972SD4[1L+] #2), LC521653 (the SH1R region in 972SD4[1R+] #1), LC521654 (the SH1R region in 972SD4[1R+] #2), LC521655 (the SH2L region in 972SD4[2L+] #1), LC521656 (the SH2L region in 972SD4[2L+] #2), LC521657 (the SH2R region in 972SD4[2R+] #1), and LC521658 (the SH2R region in 972SD4[2R+] #2). Figures 3, 5a, b, 6a, 7, and 8a, b, Supplementary Figs. 3, 6, 7, 9, and 11, and Supplementary Table 2 are associated with these sequence data. Source data are provided with this paper.

References

Goffeau, A. et al. The yeast genome directory. Nature 387, 5 (1997).
Article CAS Google Scholar
Wood, V. et al. The genome sequence of Schizosaccharomyces pombe. Nature 415, 871–880 (2002).
Article ADS CAS PubMed Google Scholar
C. elegans Sequencing Consortium. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282, 2012–2018 (1998).
Adams, M. D. et al. The genome sequence of Drosophila melanogaster. Science 287, 2185–2195 (2000).
Article PubMed Google Scholar
The Arabidopsis Genome Initiative. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796–815 (2000).
Lander, E. S. et al. Initial sequencing and analysis of the human genome. Nature 409, 860–921 (2001).
Article ADS CAS PubMed Google Scholar
Venter, J. C. et al. The sequence of the human genome. Science 291, 1304–1351 (2001).
Article ADS CAS PubMed Google Scholar
International Human Genome Sequencing Consortium. Finishing the euchromatic sequence of the human genome. Nature 431, 931–945 (2004).
Article ADS CAS Google Scholar
Linardopoulou, E. V. et al. Human subtelomeres are hot spots of interchromosomal recombination and segmental duplication. Nature 437, 94–100 (2005).
Article ADS CAS PubMed PubMed Central Google Scholar
Arlt, M. F., Durkin, S. G., Ragland, R. L. & Glover, T. W. Common fragile sites as targets for chromosome rearrangements. DNA Repair 5, 1126–1135 (2006).
Article CAS PubMed Google Scholar
Kurosawa, K. & Ohta, K. Genetic diversification by somatic gene conversion. Genes 2, 48–58 (2011).
Article CAS PubMed PubMed Central Google Scholar
Almeida, H. & Godinho Ferreira, M. Spontaneous telomere to telomere fusions occur in unperturbed fission yeast cells. Nucleic Acids Res. 41, 3056–3067 (2013).
Article CAS PubMed PubMed Central Google Scholar
Chen, N. W. G. et al. Common bean subtelomeres are hot spots of recombination and favor resistance gene evolution. Front. Plant Sci. 9, 1185 (2018).
Article PubMed PubMed Central Google Scholar
Chikashige, Y. et al. Telomere-led premeiotic chromosome movement in fission yeast. Science 264, 270–273 (1994).
Article ADS CAS PubMed Google Scholar
Miyoshi, T., Kanoh, J., Saito, M. & Ishikawa, F. Fission yeast Pot1-Tpp1 protects telomeres and regulates telomere length. Science 320, 1341–1344 (2008).
Article ADS CAS PubMed Google Scholar
de Lange, T. How telomeres solve the end-protection problem. Science 326, 948–952 (2009).
Article ADS PubMed PubMed Central CAS Google Scholar
Fujita, I. et al. Telomere-nuclear envelope dissociation promoted by Rap1 phosphorylation ensures faithful chromosome segregation. Curr. Biol. 22, 1932–1937 (2012).
Article CAS PubMed Google Scholar
Louis, E. J. The chromosome ends of Saccharomyces cerevisiae. Yeast 11, 1553–1573 (1995).
Article CAS PubMed Google Scholar
Stong, N. et al. Subtelomeric CTCF and cohesin binding site organization using improved subtelomere assemblies and a novel annotation pipeline. Genome Res. 24, 1039–1050 (2014).
Article CAS PubMed PubMed Central Google Scholar
Stadler, G. et al. Telomere position effect regulates DUX4 in human facioscapulohumeral muscular dystrophy. Nat. Struct. Mol. Biol. 20, 671–678 (2013).
Article CAS PubMed PubMed Central Google Scholar
Tashiro, S., Nishihara, Y., Kugou, K., Ohta, K. & Kanoh, J. Subtelomeres constitute a safeguard for gene expression and chromosome homeostasis. Nucleic Acids Res. 45, 10333–10349 (2017).
Article CAS PubMed PubMed Central Google Scholar
Cam, H. P. et al. Comprehensive analysis of heterochromatin- and RNAi-mediated epigenetic control of the fission yeast genome. Nat. Genet. 37, 809–819 (2005).
Article CAS PubMed Google Scholar
Kanoh, J., Sadaie, M., Urano, T. & Ishikawa, F. Telomere binding protein Taz1 establishes Swi6 heterochromatin independently of RNAi at telomeres. Curr. Biol. 15, 1808–1819 (2005).
Article CAS PubMed Google Scholar
Matsuda, A. et al. Highly condensed chromatins are formed adjacent to subtelomeric and decondensed silent chromatin in fission yeast. Nat. Commun. 6, 7753 (2015).
Article ADS CAS PubMed Google Scholar
Sugawara, N. F. DNA sequences at the telomeres of the fission yeast S. pombe. Ph.D. Thesis, Harvard University (1988).
Leupold, U. Die vererbung von homothallie und heterothallie bei Schizosaccharomyces pombe. C. R. Trav. Lab. Carlsberg Ser. Physiol. 24, 381–480 (1950).
Google Scholar
Ohno, Y., Ogiyama, Y., Kubota, Y., Kubo, T. & Ishii, K. Acentric chromosome ends are prone to fusion with functional chromosome ends through a homology-directed rearrangement. Nucleic Acids Res. 44, 232–244 (2016).
Article CAS PubMed Google Scholar
Tashiro, S. et al. Shugoshin forms a specialized chromatin domain at subtelomeres that regulates transcription and replication timing. Nat. Commun. 7, 10393 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Nakamura, T. M., Cooper, J. P. & Cech, T. R. Two modes of survival of fission yeast without telomerase. Science 282, 493–496 (1998).
Article ADS CAS PubMed Google Scholar
Tusso, S. et al. Ancestral admixture is the main determinant of global biodiversity in fission yeast. Mol. Biol. Evol. 36, 1975–1989 (2019).
Article CAS PubMed PubMed Central Google Scholar
Bochman, M. L., Paeschke, K. & Zakian, V. A. DNA secondary structures: stability and function of G-quadruplex structures. Nat. Rev. Genet. 13, 770–780 (2012).
Article CAS PubMed PubMed Central Google Scholar
Chaudari, A. & Huberman, J. A. Identification of two telomere-proximal fission yeast DNA replication origins constrained by nearby cis-acting sequences to replicate in late S phase. F1000Res. 1, 58 (2012).
Article PubMed PubMed Central Google Scholar
Jeffares, D. C. et al. The genomic and phenotypic diversity of Schizosaccharomyces pombe. Nat. Genet. 47, 235–241 (2015).
Article CAS PubMed PubMed Central Google Scholar
Fujita, I., Tanaka, M. & Kanoh, J. Identification of the functional domains of the telomere protein Rap1 in Schizosaccharomyces pombe. PLoS ONE 7, e49151 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Cooper, J. P., Nimmo, E. R., Allshire, R. C. & Cech, T. R. Regulation of telomere length and function by a Myb-domain protein in fission yeast. Nature 385, 744–747 (1997).
Kanoh, J. & Ishikawa, F. spRap1 and spRif1, recruited to telomeres by Taz1, are essential for telomere function in fission yeast. Curr. Biol. 11, 1624–1630 (2001).
Article CAS PubMed Google Scholar
Chen, Y. et al. A conserved motif within RAP1 has diversified roles in telomere protection and regulation in different organisms. Nat. Struct. Mol. Biol. 18, 213–221 (2011).
Article CAS PubMed PubMed Central Google Scholar
Deng, W. et al. Fission yeast telomere-binding protein Taz1 is a functional but not a structural counterpart of human TRF1 and TRF2. Cell Res. 25, 881–884 (2015).
Article CAS PubMed PubMed Central Google Scholar
Kozak, M. An analysis of 5’-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 8125–8148 (1987).
Article CAS PubMed PubMed Central Google Scholar
Young, E., Abid, H. Z., Kwok, P. Y., Riethman, H. & Xiao, M. Comprehensive analysis of human subtelomeres by whole genome mapping. PLoS Genet. 16, e1008347 (2020).
Article PubMed PubMed Central CAS Google Scholar
Yue, J. X. et al. Contrasting evolutionary genome dynamics between domesticated and wild yeasts. Nat. Genet. 49, 913–924 (2017).
Article CAS PubMed PubMed Central Google Scholar
Ferreira, M. G. & Cooper, J. P. Two modes of DNA double-strand break repair are reciprocally regulated through the fission yeast cell cycle. Genes Dev. 18, 2249–2254 (2004).
Article CAS PubMed PubMed Central Google Scholar
Miller, K. M., Rog, O. & Cooper, J. P. Semi-conservative DNA replication through telomeres requires Taz1. Nature 440, 824–828 (2006).
Article ADS CAS PubMed Google Scholar
Takikawa, M., Tarumoto, Y. & Ishikawa, F. Fission yeast Stn1 is crucial for semi-conservative replication at telomeres and subtelomeres. Nucleic Acids Res. 45, 1255–1269 (2017).
Article CAS PubMed Google Scholar
Ivanova, T. et al. Budding yeast complete DNA synthesis after chromosome segregation begins. Nat. Commun. 11, 2267 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Kramara, J., Osia, B. & Malkova, A. Break-induced replication: the where, the why, and the how. Trends Genet. 34, 518–531 (2018).
Article CAS PubMed Google Scholar
Smith, C. E., Llorente, B. & Symington, L. S. Template switching during break-induced replication. Nature 447, 102–105 (2007).
Article ADS CAS PubMed Google Scholar
Deem, A. et al. Break-induced replication is highly inaccurate. PLoS Biol. 9, e1000594 (2011).
Article CAS PubMed PubMed Central Google Scholar
Pardo, B. & Aguilera, A. Complex chromosomal rearrangements mediated by break-induced replication involve structure-selective endonucleases. PLoS Genet. 8, e1002979 (2012).
Article CAS PubMed PubMed Central Google Scholar
Anand, R. P. et al. Chromosome rearrangements via template switching between diverged repeated sequences. Genes Dev. 28, 2394–2406 (2014).
Article PubMed PubMed Central CAS Google Scholar
Sakofsky, C. J. et al. Break-induced replication is a source of mutation clusters underlying kataegis. Cell Rep. 7, 1640–1648 (2014).
Article CAS PubMed PubMed Central Google Scholar
Sakofsky, C. J. et al. Translesion polymerases drive microhomology-mediated break-induced replication leading to complex chromosomal rearrangements. Mol. Cell 60, 860–872 (2015).
Article CAS PubMed PubMed Central Google Scholar
Wang, X. & Baumann, P. Chromosome fusions following telomere loss are mediated by single-strand annealing. Mol. Cell 31, 463–473 (2008).
Article CAS PubMed Google Scholar
Behm-Ansmant, I. et al. mRNA quality control: an ancient machinery recognizes and degrades mRNAs with nonsense codons. FEBS Lett. 581, 2845–2853 (2007).
Article CAS PubMed Google Scholar
Mandell, J. G., Goodrich, K. J., Bahler, J. & Cech, T. R. Expression of a RecQ helicase homolog affects progression through crisis in fission yeast lacking telomerase. J. Biol. Chem. 280, 5249–5257 (2005).
Article CAS PubMed Google Scholar
Fantes, P. A. & Hoffman, C. S. A Brief history of Schizosaccharomyces pombe research: a perspective over the past 70 years. Genetics 203, 621–629 (2016).
Article PubMed PubMed Central Google Scholar
Bahler, J. et al. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943–951 (1998).
Article CAS PubMed Google Scholar
Forsburg, S. L. & Rhind, N. Basic methods for fission yeast. Yeast 23, 173–183 (2006).
Article CAS PubMed Google Scholar
Moreno, S., Klar, A. & Nurse, P. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795–823 (1991).
Article CAS PubMed Google Scholar
Chen, S., Zhou, Y., Chen, Y. & Gu, J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34, i884–i890 (2018).
Article PubMed PubMed Central CAS Google Scholar
Koren, S. et al. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Res. 27, 722–736 (2017).
Article CAS PubMed PubMed Central Google Scholar
Marcais, G. et al. MUMmer4: A fast and versatile genome alignment system. PLoS Comput. Biol. 14, e1005944 (2018).
Article PubMed PubMed Central CAS Google Scholar
Larsson, A. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30, 3276–3278 (2014).
Article CAS PubMed PubMed Central Google Scholar
Katoh, K., Misawa, K., Kuma, K. & Miyata, T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30, 3059–3066 (2002).
Article CAS PubMed PubMed Central Google Scholar
Li, H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics 34, 3094–3100 (2018).
Article CAS PubMed PubMed Central Google Scholar
Vaser, R., Sovic, I., Nagarajan, N. & Sikic, M. Fast and accurate de novo genome assembly from long uncorrected reads. Genome Res. 27, 737–746 (2017).
Article CAS PubMed PubMed Central Google Scholar
Walker, B. J. et al. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS ONE 9, e112963 (2014).
Article ADS PubMed PubMed Central CAS Google Scholar

Download references

Acknowledgements

We thank H. Kohno for valuable advices on analyses of NGS data, S. Kuraku, H. Innan, H. Michida, T. Nakagawa, and H. Niki for insightful comments, H. Maekawa for critical reading of the manuscript, C. Hoffman, C. Shimoda, M. Yamamoto, and T. Nakamura for lectures on the history of S. pombe strains, and all of the lab members for discussion and support. Computations were partially performed on the NIG supercomputer at ROIS National Institute of Genetics. This work was supported by Japan Society for the promotion of Science (JSPS) KAKENHI (JP17H03606, JP19H05262, JP20H03185, and JP20H05388), Ohsumi Frontier Science Foundation, and the publication support from Initiative for the Implementation of the Diversity Research Environment of Osaka University to J.K., and Grant-in-Aid for JSPS Research Fellows to Y.O.

Author information

Sanki Tashiro
Present address: Institute of Molecular Biology, University of Oregon, 1370 Franklin Blvd, Eugene, OR, USA

Authors and Affiliations

Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo, 3-8-1 Komaba, Meguro-ku, Tokyo, 153-8902, Japan
Yusuke Oizumi, Yuko Date & Junko Kanoh
Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka, 565-0871, Japan
Yusuke Oizumi, Takuto Kaji, Sanki Tashiro, Yumiko Takeshita & Junko Kanoh
Department of Biological Sciences, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-0033, Japan
Junko Kanoh

Authors

Yusuke Oizumi
View author publications
You can also search for this author in PubMed Google Scholar
Takuto Kaji
View author publications
You can also search for this author in PubMed Google Scholar
Sanki Tashiro
View author publications
You can also search for this author in PubMed Google Scholar
Yumiko Takeshita
View author publications
You can also search for this author in PubMed Google Scholar
Yuko Date
View author publications
You can also search for this author in PubMed Google Scholar
Junko Kanoh
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

J.K. conceived the project, Y.O. and J.K. analyzed sequence data, T.K., S.T., and J.K. designed and performed experiments. Y.T. and Y.D. contributed to the analysis of SH regions. Y.O. and J.K. analyzed data and wrote the manuscript.

Corresponding author

Correspondence to Junko Kanoh.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Nature Communications thanks Sigurd Braun and Maria Teresa Teixeira for their contribution to the peer review of this work. Peer reviewer reports are available.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Oizumi, Y., Kaji, T., Tashiro, S. et al. Complete sequences of Schizosaccharomyces pombe subtelomeres reveal multiple patterns of genome variation. Nat Commun 12, 611 (2021). https://doi.org/10.1038/s41467-020-20595-1

Download citation

Received: 25 February 2020
Accepted: 03 December 2020
Published: 27 January 2021
DOI: https://doi.org/10.1038/s41467-020-20595-1

This article is cited by

Fungal antigenic variation using mosaicism and reassortment of subtelomeric genes’ repertoires
- Caroline S. Meier
- Marco Pagni
- Philippe M. Hauser
Nature Communications (2023)
Molecular cytogenetics and development of St-chromosome-specific molecular markers of novel stripe rust resistant wheat–Thinopyrum intermedium and wheat–Thinopyrum ponticum substitution lines
- Siwen Wang
- Changyou Wang
- Wanquan Ji
BMC Plant Biology (2022)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.