HuR regulates telomerase activity through TERC methylation

Tang, Hao; Wang, Hu; Cheng, Xiaolei; Fan, Xiuqin; Yang, Fan; Zhang, Mengmeng; Chen, Yanlian; Tian, Yuyang; Liu, Cihang; Shao, Dongxing; Jiang, Bin; Dou, Yali; Cong, Yusheng; Xing, Junyue; Zhang, Xiaotian; Yi, Xia; Songyang, Zhou; Ma, Wenbin; Zhao, Yong; Wang, Xian; Ma, Jinbiao; Gorospe, Myriam; Ju, Zhenyu; Wang, Wengong

doi:10.1038/s41467-018-04617-7

Download PDF

Article
Open access
Published: 07 June 2018

HuR regulates telomerase activity through TERC methylation

Hao Tang^1,2^na1,
Hu Wang^3,4^na1,
Xiaolei Cheng¹^na1,
Xiuqin Fan¹^na1,
Fan Yang³^na1,
Mengmeng Zhang⁵,
Yanlian Chen⁶,
Yuyang Tian⁶,
Cihang Liu¹,
Dongxing Shao¹,
Bin Jiang¹,
Yali Dou⁷,
Yusheng Cong^3,4,
Junyue Xing¹,
Xiaotian Zhang¹,
Xia Yi¹,
Zhou Songyang⁶,
Wenbin Ma ORCID: orcid.org/0000-0001-8774-7593⁶,
Yong Zhao⁶,
Xian Wang²,
Jinbiao Ma ORCID: orcid.org/0000-0002-0232-1786⁵,
Myriam Gorospe⁸,
Zhenyu Ju^3,4 &
…
Wengong Wang ORCID: orcid.org/0000-0002-1720-809X¹

Nature Communications volume 9, Article number: 2213 (2018) Cite this article

6242 Accesses
26 Citations
1 Altmetric
Metrics details

Subjects

An Author Correction to this article was published on 10 July 2018

This article has been updated

Abstract

Telomerase consists of the catalytic protein TERT and the RNA TERC. Mutations in TERC are linked to human diseases, but the underlying mechanisms are poorly understood. Here we report that the RNA-binding protein HuR associates with TERC and promotes the assembly of the TERC/TERT complex by facilitating TERC C106 methylation. Dyskeratosis congenita (DC)-related TERC U100A mutation impair the association of HuR with TERC, thereby reducing C106 methylation. Two other TERC mutations linked to aplastic anemia and autosomal dominant DC, G107U, and GC107/108AG, likewise disrupt methylation at C106. Loss-of-HuR binding and hence lower TERC methylation leads to decreased telomerase activity and telomere shortening. Furthermore, HuR deficiency or mutation of mTERC HuR binding or methylation sites impair the renewal of mouse hematopoietic stem cells, recapitulating the bone marrow failure seen in DC. Collectively, our findings reveal a novel function of HuR, linking HuR to telomerase function and TERC-associated DC.

Regulation of human telomerase in homeostasis and disease

Article 02 April 2020

Mechanisms underlying the activation of TERT transcription and telomerase activity in human cancer: old actors and new players

Article Open access 08 July 2019

HnRNP F/H associate with hTERC and telomerase holoenzyme to modulate telomerase function and promote cell proliferation

Article Open access 20 December 2019

Introduction

The majority of human cancer cells and germ line cells express telomerase, a ribonucleoprotein with reverse transcriptase activity that adds telomeric DNA repeats to the end of telomeres. The telomerase holoenzyme includes hTERT, the protein catalytic subunit, and TERC, a RNA subunit. The structural integrity of TERC is important for the assembly of the telomerase holoenzyme that regulates telomerase activity¹. TERC serves as a template for telomerase to catalyze the addition of single-stranded telomere DNA repeats onto the 3′ ends of linear chromosomes^2,3. Telomerase dysfunction caused by human TERC mutations is linked to numerous human diseases, including pulmonary fibrosis, human cancer, and premature aging syndromes, such as dyskeratosis congenita (DC) and aplastic anemia^1,4,5,6. However, the mechanisms whereby these mutations cause telomerase dysfunction are largely unknown.

Methylation is a prevalent post-transcriptional modification for almost all RNA species^7,8,9. RNA methylation is of critical importance for the translation¹⁰, RNA stability and RNA processing^11,12. Apart from tRNA, rRNA, and the mRNA 5′cap, small non-coding RNAs, such as piwi RNA, Drosophila siRNA, and microRNAs are also methylated¹¹. Although, m6A is the predominant methylation site¹³, m5C is also widely identified in human coding and non-coding RNAs^9,10. Interestingly, m5C sites are also found in TERC⁹. However, the impact of m5C sites on telomerase activity has not been addressed.

Many TERC-associated proteins, such as DKC1 (dyskerin), TCAB1, the core components of box H/ACA small nucleolar ribonucleoprotein particles (snoRNPs), GAR1, NHP2, NOP10, Pontin/Reptin, DAXX, and telomeric proteins TIN2 and TPP1 were found to regulate telomerase activity^{14,15,16,17,18,19,20,21,22,23}. HuR [human antigen R, also known as ELAVL1 (embryonic lethal abnormal vision-like 1)], the ubiquitously expressed member of Hu/ELAV RNA-binding protein family, has been described to regulate the post-transcriptional fate of a number of coding and non-coding RNAs^24,25,26, thereby regulating many cell activities (proliferation, survival, apoptosis, senescence, and differentiation) and affecting broader processes, such as cancer and aging. Given that telomere metabolism is also involved in similar cellular and disease processes^27,28,29, we sought to elucidate the influence of HuR in telomere biology.

In this study, we describe evidence that HuR associates with TERC in vitro and in cultured cells. The association of HuR with TERC was required for the maintenance of TERC methylation and hence telomerase activity. Additionally, the regulation of telomerase activity by HuR was found to impact on the renewal of hematopoietic stem cells (HSCs) and was linked to dyskeratosis congenita, aplastic anemia, and autosomal dominant dyskeratosis congenita.

Results

HuR associates with TERC in vitro and in cells

The association of HuR with TERC was studied by RNA pull-down assays using HeLa cell lysates and in vitro-transcribed, biotinylated TERC (full-length and fragments; Supplementary Fig. 1a). Western blot analysis revealed that HuR was presented in the complexes pulled down by using biotinylated full-length TERC and fragment A (positions 1–139), but not fragment B (positions 140–451) (Fig. 1a), suggesting that HuR was capable of associating with TERC. To test whether HuR bound TERC directly, recombinant, in vitro-purified his-HuR and in vitro-transcribed TERC were subjected to UV-crosslinking EMSA analysis (Methods section). As shown, a UV-crosslinked complex comprising purified his-tagged HuR and TERC was detected by western blot analysis (Fig. 1b), confirming the direct binding of HuR to TERC. According to the database of RNA-binding protein specificities (http://rbpdb.ccbr.utoronto.ca), the TERC RNA segments UUUUUU (positions 38–43) and GUUUUUC (positions 98–103) are potential sites for the binding of HuR. Therefore, further RNA pull-down assays were carried out by using TERC variants bearing mutations in UUUUUU, GUUUUUC, or both sites (Supplementary Fig. 1b). Mutating U40 or U100 residues (U40A or U100A) reduced greatly the association with HuR (by ~70.7% and ~70.4%, respectively; p < 0.01, Student’s t-test), while mutating both (U40A + U100A) almost eliminated completely this association (Fig. 1c). Therefore, TERC UUUUU and GUUUUUC are the major motifs for HuR binding. These results suggest that the association of HuR with TERC may be linked to DC, since U100A is a DC-related mutation⁴. Interestingly, UUUUU and GUUUUUC are conserved in mammals (Supplementary Fig. 1c), suggesting that the association of HuR with TERC may be a common event in this class of vertebrates. By using isothermal titration calorimetry (ITC) assays, the dissociation constant (K_d) (fitting from 12 titrations) for UUUUUU and GUUUUUC was found to be ~24.3 ± 0.05 nM and ~70.4 ± 0.80 nM (± values denote standard errors), respectively (Fig. 1d, Supplementary Fig. 2 for negative control).

To test the interaction of TERC with HuR in cells, we employed human osteosarcoma U2OS cells, which do not express endogenous human TERT (hTERT) or TERC³⁰. After transfecting U2OS cells with a vector that expressed a flag-tagged MS2-binding protein (flag-MS2-BP) alone or together with a vector that express tagged TERC (MS2-TERC), cell lysates were prepared and subjected to immunoprecipitation assays (IP) by using anti-HuR or anti-flag antibodies. The presence of flag-MS2-BP or HuR in the IP materials were assessed by western blot analysis. As shown, HuR associated with flag-MS2-BP in the presence, but not in the absence of MS2-TERC (Fig. 2a), indicating that HuR may associate with TERC in cells. We also tested the association of HuR with TERC in cells by using the TriFC system, which identifies protein-RNA interactions in cells³¹. As shown in Fig. 2b, HuR and DKC1 (positive control) associated with TERC in cells, while the nuclear protein PABPC1 (negative control) did not. In agreement with this finding, we observed the co-localization of HuR and TERC (Supplementary Fig. 3a), as well as the localization of HuR in Cajal bodies, where TERC undergoes maturation, as evidenced by the co-localization of HuR and the Cajal body marker Coilin (Supplementary Fig. 3b). In sum, HuR binds to TERC in vitro and in cells.

HuR regulates telomerase activity

Next, we tested whether HuR complexes with hTERT by associating with TERC. To this end, U2OS cells were transfected with a vector expressing flag-hTERT alone or together with a vector expressing TERC. IP assays were performed by using the cell lysates and antibodies recognizing HuR or flag. As shown in Fig. 3a by western blot analysis, HuR associated with flag-hTERT in the presence, but not in the absence of TERC, indicating that HuR associates with hTERT in a TERC-dependent manner. We also tested the telomerase activity in the materials immunoprecipitated from human cervical carcinoma HeLa cells expressing flag-hTERT by using the telomere repeat amplification protocol (TRAP). As shown in Fig. 3b, telomerase activity was detected in the materials immunoprecipitated by using anti-HuR, anti-flag, or anti-hnRNPC (positive control) antibodies, but not in materials immunoprecipitated by using anti-IgG or anti-p53 antibodies (negative controls). These results further confirmed the association of HuR with hTERT.

To further analyze the influence of HuR on telomerase activity, HeLa cells were stably transfected with a vector expressing HuR shRNA. TRAP assays were performed to evaluate the influence of HuR silencing on telomerase activity. As shown, cells with silenced HuR exhibited much lower telomerase activity (<50% by 2, 30, and 60 days after silencing HuR) than control shRNA-transfected cells (Fig. 4a). Analysis of the telomere length in cells in which HuR was stably silenced, measured by southern blot analysis, revealed that HuR silencing caused a gradual shortening of telomeres (~3.44 kb vs. ~3.50 kb by day 2; ~3.5 kb vs. ~2.7 kb by day 30; ~3.5 kb vs. ~2.5 kb by day 60; Fig. 4b). In addition, modulating HuR levels did not alter the levels of flag-hTERT (expressed from full-length hTERT mRNA; Supplementary Fig. 4a), and neither transient nor long-term HuR silencing could affect TERC abundance (Supplementary Fig. 4b, c). These results indicate that HuR do not influence the abundance of hTERT or TERC but may instead regulate their function. To test this possibility directly, IP analysis of UV-crosslinked RNPs was used to test the association flag-TERT and TERC in cells with silenced HuR. As shown, HuR knockdown reduced the association of TERC with hTERT by ~74.7% (p < 0.01, Student’s t-test; Fig. 4c); the overall association of hTERT with TERC transcripts bearing mutations in the HuR-binding sites (Supplementary Fig. 1b) was markedly weaker (<50% lower) than the association of hTERT with wild-type TERC (Fig. 4d). These results indicate that HuR promotes the assembly of the TERC/hTERT core complex, in turn enabling telomerase activity.

HuR regulates telomerase activity via TERC methylation

In a previous study, C166, C323, and C445 were identified as m5C sites of TERC⁹. Among them, C323U is reported as a myelodysplastic syndrome-related mutation that reduces telomerase activity³². By using bisulfite RNA sequencing, we identified C106 as an additional m5C site in TERC. Mutation of C166 (C166U) or C445 (C445U) did not alter telomerase activity (Supplementary Fig. 5a-c). Knockdown of HuR reduced the methylation of C106 from ~32.6% to 10.1%, but did not reduce the methylation of C323 (Fig. 5a). Therefore, we focused on the role of C106 methylation in telomerase activity and the influence of HuR in this methylation event.

Mutation of HuR-recognizing sequences (U100A and U40A + U100A) reduced the methylation of C106 (with reduction from ~24.5% to 5.3% and 9.8%, respectively; p < 0.01, Student’s t-test) (Fig. 5b), underscoring the importance of HuR in TERC C106 methylation. G107U and GC107/108AG are TERC mutations related to aplastic anemia and autosomal dominant DC^5,6. Methylation of C106 was lost in G107U and GC107/108AG mutants (Fig. 5b), suggesting that the context of C106 was important for methylation. Similar to what was found for the HuR-binding motifs UUUUUU and GUUUUUC, C106 is also conserved in mammals (Supplementary Fig. 6). Moreover, an intact C106 site was important for telomerase activity, since mutation of C106 (C106G) greatly reduced telomerase activity (by ~77.1%; p < 0.01, Student’s t-test) (Fig. 5c). Interestingly, mutation of HuR binding motifs (U40A, U100A, U40A + U100A) impaired telomerase activity by ~70 or more (Fig. 5c, and Supplementary Fig. 7 for monitoring the levels of TERC variants). In keeping with earlier studies^5,6, mutations G107U and GC107/108AG similarly reduced telomerase activity without influencing the levels of these TERC variants (Supplementary Fig. 8a, b). C106G, G107U, or GC107/108AG mutants associated weakly with hTERT (Fig. 5d and Supplementary Fig. 8c), but not with HuR (Supplementary Fig. 8d, e and Supplementary Fig. 9). Therefore, the association of HuR with TERC enhances the methylation of C106, while methylation of C106 does not seem to influence the association of HuR with TERC.

To test the influence of C106 methylation on hTERT/TERC interaction, we measured the methylation of C106 in TERC immunoprecipitated from HeLa cells expressing flag-hTERT using an anti-flag antibody. As shown, the hTERT-bound TERC exhibited much higher C106 methylation (increasing from ~24.5% to 46.4%; Fig. 5e), suggesting that methylated TERC interacted more robustly with hTERT. To further test whether HuR-regulated TERC C106 methylation was important for maintaining telomerase length, HeLa cells were stably transfected with a vector expressing flag-hTERT alone or together with a vector expressing TERC or its variants (U40A + U100A or C106G). Telomere length was measured by southern blot analysis. As shown, co-expression of flag-hTERT with TERC, but not with U40A + U100A or C106G mutants, extended markedly telomere length in HeLa cells (p < 0.01, Student’s t-test) (Supplementary Fig. 10a-c). Together, HuR was found to enhance the methylation of TERC, in turn promoting the assembly of the TERC/hTERT complex and elevating telomerase activity; TERC-bearing mutations linked to DC, aplastic anemia, or autosomal dominant DC disabled TERC methylation (U100A, G107U, and GC107/108AG) or its association with HuR (U100A).

HuR-telomerase axis impacts on the renewal of mHSCs

Bone marrow failure is the leading cause of death in DC patients¹. Therefore, we asked whether the HuR-telomerase axis influenced the renewal of mHSCs. To this end, we first addressed whether the impact of HuR and TERC methylation in telomerase activity observed in human cells also occurred in mouse cells. As shown, mutation of mouse TERC (mTERC) HuR-binding sites prevented HuR binding (Fig. 6a, b). Knockdown of HuR reduced telomerase activity and mTERC methylation at C64, the conserved m5C site (Fig. 6c, d). Mutations of the mTERC sequences that HuR binds (U15A + U58A) or the m5C site (C64G) impaired telomerase activity (Fig. 6e). Therefore, the regulation of telomerase activity regulating by HuR and TERC methylation appears conserved in mouse cells.

Next, we tested whether HuR-telomerase regulatory process impacts on hematopoietic stem cell (HSC) function. To this end, Lineage⁻Sca1⁺cKit⁺ (LSK) from mTERC^+/⁻ or G3 mTERC^−/− mice were infected with lentivirus expressing a shHuR or a control shRNA together with GFP. The GFP-positive cells were sorted and transplanted into recipient mice (n = 5). The transduction efficiency and FACS analysis for sorting efficiency are shown (Supplementary Fig. 11-13). As shown, knockdown of HuR shortened telomere length and attenuated the function of mTERC^+/− HSCs (p < 0.01, Student’s t-test), but not mTERC^−/− HSCs (Fig. 7a–c). These results support the notion that HuR regulates HSC telomere length and function in a TERC-dependent manner. We then constructed lentiviral vectors expressing wild-type mTERC or mTERC bearing mutations in the motif recognized by HuR (U15A + U58A or m5C site C64G). HSCs were then infected with the vectors and transplanted into mTERC^−/− mice. Strikingly, overexpression of wild-type mTERC effectively increased telomere length and rescued the impairment of mTERC^−/− HSC function, while overexpression of mutant mTERC was much less effective in restoring these phenotypes (Fig. 7d–f). Together, these results indicate that the regulation of telomerase activity by HuR influence mHSC function in a TERC-dependent manner.

Discussion

The present study provides evidence that HuR regulates telomerase activity via TERC methylation in human cell lines and in transplanted mHSCs (Fig. 8). In previous studies, HuR was shown to promote mouse progenitor cell survival by inhibiting the MDM2-TP53 axis³³. Since telomere shortening activates TP53³⁴, the silencing of HuR and ensuing reduction in telomere length may have further increased TP53 levels. The conservation of HuR-interacting TERC region and the m5C site (Supplementary Fig. 1c and Supplementary Fig. 6) suggests that the HuR-telomerase regulatory paradigm may be conserved in mammals. Given that m5C methylation and HuR-RNA interactions occur ubiquitously in human cells^9,10,35, the influence of HuR in RNA methylation is unlikely to be limited to TERC. The finding that knockdown of HuR reduces the formation of double-stranded TERC RNA (Supplementary Fig. 14) suggests that the association of HuR with TERC may enhance TERC C106 methylation by altering the secondary structure of TERC; the influence of TERC methylation on the secondary structure of TERC remains to be further studied.

Apart from C106, cytosines C166, C323, and C455 have also been identified as m5C sites in TERC⁹. However, methylation at C166 and C455 did not appear to affect telomerase activity, since it remained unchanged after mutating C166 and C455 (Supplementary Fig. 5). In addition, although methylation at C323 may be important for maintaining telomerase activity³², this modification was not modulated by HuR (Fig. 5a). Therefore, the various TERC methylation sites, the factors that mediate TERC methylation, and its impact on telomerase activity are complex. In addition, while the transplantation experiment in mouse HSCs are evidence of the impact of HuR-regulated TERC methylation in bone marrow failure syndromes (Fig. 7), the RNA methyltransferase catalyzing the C106 methylation and the reader of C106 methylation await identification.

The finding that DC-related mutations affect the association of HuR with TERC and C106 methylation set the stage for important future studies on the clinical impact of these findings on human hematopoietic stem cell homeostasis. Given that both HuR and telomerase promote human cancer and cell growth, and that they both inhibit aging, cell senescence, and apoptosis^{24,25,26,27,28,29,36,37}, we propose that the HuR-telomerase regulatory paradigm is a major component of these processes.

Methods

Cell culture, transfections, and knockdown of HuR

Human osteosarcoma U2OS cells, human cervical carcinoma HeLa cells, and mouse NIH3T3 fibroblasts from ATCC were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin, at 37 °C in 5% CO₂. All plasmid transfections were performed using Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions. To silence the expression of HuR transiently in both human and mouse cells, a siRNA targeting HuR (AAGAGGCAAUUACCAGUUUCA) or a control siRNA (UUGUUCGAACGUGUCACGUTT) was transfected using Oligofectamine (Invitrogen) following the manufacturer’s instructions. Unless otherwise indicated, cells were collected for analysis 48 h after transfection.

In situ hybridization and immunofluorescence analysis

Cells were fixed with 4% paraformaldehyde for 30 min at room temperature and then permeabilized in 0.1% Triton X-100. For RNA FISH, cells were blocked with pre-hybridization buffer at 3 °C for 1 h and incubated in hybridization buffer (50% deionized formamide, 10% dextran sulfate, 2 mM vanadyl ribonucleotide complex, 0.002 mg/mL nuclease-free bovine serum albumin, 1 mg/mL E. coli tRNA and 250 µg/mL of N-50 DNA) containing TERC probes (fluorescein isothiocyanate-conjugated DNA probes complementary to human TERC) (TAKARA Bio Inc) at 37 °C overnight in a humidified chamber. Samples were washed three times with 2× SSC and then five times with 1× PBS before combining with immunofluorescence. For immunofluorescence, primary monoclonal antibodies recognizing coilin (Abcam, UK) or HuR (Santa Cruz) were used. Cy5 and/or FITC-conjugated secondary antibodies (Multiscience, China) were used for detection. Cells were mounted with DAPI. Fluorescence was detected and imaged using a Nikon Ti microscope.

Western blot analysis

Western blot analysis was performed following standard procedures. Cell lysates were size fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes. Monoclonal antibodies recognizing GAPDH (proteintech, Cat# 10494-1-AP (50 μg/150 μl), 1:2000), Tubulin (proteintech, Cat# 11224-1-AP (43 μg/150 μl), 1:2000), HuR (Santa Cruz, Cat#SC-5261 (200 μg/ml),1:1000), or anti-flag M2 antibody (Sigma, Cat# F1802 (1 mg/ml),1:2000) were used for the respective western blot analysis. Following incubation with the appropriate secondary antibody, signals were detected by using Odyssey CLx western blot detection system. All of the uncropped western blots with molecular weight indicated were included in Supplementary Figs. 15-24.

Reverse transcription (RT) and real-time qPCR analysis

For reverse transcription (RT) followed by real-time quantitative (q)PCR analysis to detect TERC, mTERC, and their variants, total cellular RNA was prepared using the RNeasy Mini Kit (QIAGEN) following the manufacturer’s protocol, a reverse transcription (RT) reaction was performed by using primer GCGTCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCGCATGTGTGAG, and the products from RT reaction were subjected to real-time qPCR analysis by using primer pairs TTCAGGCCTTTCAGGCCGCAGGAA and TGGTGTCGTGGAGTCGGC for TERC, and primer pairs ACCTAACCCTGATTTTCATTAGC and GGTTGTGAGAACCGAGTTCC for mTERC. U6 was used for normalization in all real-time qPCR assays. Primer GCGTCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCAAAATATGGAA was used for the reverse transcription of U6. Primer pairs CGCAAGGATGACACGCAAATTCG and TGGTGTCGTGGAGTCGGC were used for real-time qPCR analysis of U6. The reverse primers used for real-time qPCR analysis of TERC and U6 matched the sequence of the primers used for reverse transcription.

Details of the real-time qPCR analysis are as follows:

1.
Add into sterile, nuclease-free tube on ice in the indicated order (12 μl in total): nuclease-free water, DNase-treated total RNA (1 μg), stem-loop gene-specific RT primer (20 pmol).
2.
Mix gently, centrifuge briefly and incubate with the following program in a thermal cycler: 65 °C (5 min), 45 °C (5 min), 25 °C (5 min), 4 °C (hold).
3.
Add the following components in the indicated order: 5× reaction buffer (4 μl), RNase inhibitor (1 μl; 20 U, Thermo Scientific, EO0381), dNTP Mix, 10 mM each: 2 μl (1 mM final concentration, Thermo Scientific, R0191), reverse transcriptase: 1 μl (200 U, Thermo Scientific, EP0441). Mix gently and centrifuge briefly.
4.
Using a thermal cycler, proceed reverse transcription with the following program: 25 °C (10 min), 42 °C (60 min), 70 °C (10 min), 4 °C (hold).
5.
Perform qPCR assays in the following programs (Biorad CFX96 real-time system): pre-denature at 95 °C for 10 min, use [95 °C (15 s), 60 °C (45 s)] for 40 cycles, then perform melting curve analysis and normalize using comparative Ct (^△△Ct) quantification method.

RNA pull-down and immunoprecipitation (IP)

For biotin pull-down assays, PCR-amplified DNA was used as template to transcribe biotinylated RNA by using T7 RNA polymerase in the presence of biotin-UTP. One microgram of purified biotinylated transcripts was incubated with 100 µg of cytoplasmic extracts for 30 min at room temperature. Complexes were isolated with paramagnetic streptavidin-conjugated Dynabeads (Dynal, Oslo), and the pull-down material was analyzed by western blotting.

For immunoprecipitation (IP) assays, whole-cell lysates were prepared by adding 200 μl of IP buffer (10 mM Hepes, pH 7.4, 50 mM β-glycerophosphate, 1% Triton X-100, 10% glycerol, 2 mM EDTA, 2 mM EGTA, 10 mM NaF, 1 mM DTT, protease Inhibitor Cocktail). IP reactions were carried out by using 20 μl of the resulting supernatant, diluting it with 1 ml of IP buffer, and adding 2 μg of the antibodies indicated above. The washes were performed as follows: three times with IP buffer, four times with a high-stringency buffer (100 mM Tris-HCl, pH 7.4, 500 mM LiCl, 0.1% Triton X-100, 1 mM DTT, protease Inhibitor Cocktail), and then three times with IP buffer.

RNP IP assays

For RNP IP (UV-crosslinking RNP IP) assays, cells were exposed to UVC (400 mJ/cm²) and lysates were prepared for immunoprecipitation using monoclonal anti-HuR or anti-flag antibodies. The IP materials were washed twice with stringent buffer (100 mM Tris-HCl, pH 7.4, 500 mM LiCl, 0.1% Triton X-100, 1 mM DTT, protease Inhibitor Cocktail) and twice with the IP buffer. The RNA in RNP IP was assessed by RT-qPCR analysis.

UV crosslinking RNA electrophoretic mobility shift assay

For UV crosslinking RNA electrophoretic mobility shift assay (UV-crosslinking rEMSA), the RNA-protein interaction mixtures (0.02 mL) contained 50 mM Tris (pH 7.0), 150 mM NaCl, 0.25 mg/ml tRNA, 0.025 mg/ml bovine serum albumin, 500 nM of purified his-HuR and 500 nM of in vitro-transcribed TERC. Mixtures were incubated at 25 °C for 30 min, and digested with RNase T1 (100 U/reaction) for 15 min at 37 °C. After crosslinking of complexes through delivery of 1800 J/m², reactions were subjected to western blot analysis.

Constructs

For construction of the pcDNA 3.0 (+) vectors (Invitrogen) expressing TERC, mTERC, and the variants bearing TERC and mTERC mutations, primer pairs CGGGATCCGGGTTGCGGAGGGTGGGCCT and CGGAATTCGCATGTGTGAGCCGAGTCCTGG for human TERC (TERC), and CGGGATCCACCTAACCCTGATTTTCATT and CGGAATTCGGTTGTGAGAACCGAGTTCC for mouse TERC (mTERC) were used to amplify the full length of TERC and mTERC. These products were inserted between the BamH I and EcoR I sites of pcDNA 3.0 (+) vector. To construct pcDNA 3.0 (+) vectors expressing variants of TERC (U40A, U100A, U40A + U100A, C106G, G107U, GC107/108AG, C166U, C323U, and C445U) and mTERC (U15A, U58A, U15A + U58A, and C64G), we used circular site-directed mutagenesis technology. The primer pairs used are as follows: GGGGTGGTGGCCATTGTTTGTCTAAC and CAATGGCCACCACCCCTCCCAGGCCC for U40A, CTCCCCGCGCGCTGTATTTCTCGCTG and TACAGCGCGCGGGGAGCAAAAGCACG for U100A, GCGCGCTGTTTTTCTGGCTGACTTTC and CAGAAAAACAGCGCGCGGGGAGCAAA for C106G, CGCGCTGTTTTTCTCTCTGACTTTCA and AGAGAAAAACAGCGCGCGGGGAGCAA for G107U, CGCGCTGTTTTTCTCAGTGACTTTCAG and CTGAGAAAAACAGCGCGCGGGGAGCAA for GC107/108AG, GTTCATTCTAGAGTAAACAAAAAATGTCAG and TTGTTTACTCTAGAATGAACGGTGGAAGGC for C166U, GGGCTCTGTCAGGCCGTGGGTCTCTCG and ACGGCTGACAGAGCCCAACTCTTCGC for C323U, CCAGGACTCGGCTCATACATGCAATT and ATGAGCCGAGTCCTGGGTGCACGTCC for C445U, CGGGATCCACCTAACCCTGATTATCATT and CGGAATTCGGTTGTGAGAACCGAGTTCC for mTERC U15A, TTCTCCGCCCGCTGTGTTTCTCGCTG and CACAGCGGGCGGAGAACAAAAGACCA for mTERC U58A, and GCCCGCTGTTTTTCTGGCTGACTTCC and CAGAAAAACAGCGGGCGGAGAACAAA for mTERC C64G. The pcDNA 3.0 (+) vector expressing U40A + U100A of TERC or U15A + U58A of mTERC was generated by mutating U100A of TERC or U58 of mTERC from template vector bearing U40A or U15A by using circular site-directed mutagenesis technology.

To construct pcDNA 3.0 (+) vector (Invitrogen) expressing flag-tagged hTERT (human TERT), the full length of hTERT cDNA was amplified by using primer pairs ATAAGAATGCGGCCGCTATGCCGCGCGCTCCCCGCTGCCGAG and TGCTCTAGATCAGTCCAGGATGGTCTTGAAGTCT and inserted between the Not I and Xba I sites. To construct 3.0 (+) vector expressing flag-tagged mTERT (mouse TERT), primer pairs CAAGCTTATGACCCGCGCTCCTCGTTG and GGAATTCTTAGTCCAAAATGGTCTGAA were used to amplify the mTERT cDNA and inserted between the Hind III and EcoRIsites. 3× flag sequences (AGCTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCCATA) was synthesized and sub-cloned into the Hind III site.

To construct pcDNA 3.1 vector (Clontech) expressing flag-HuR, the full-length coding region of HuR was amplified by PCR using primer pairs GGAATTCATGGACTACAAGGACGACGATGACAAGTCTAATGGTTATGAA and GCTCTAGATTATTTGTGGGACTTGTTGG and inserted between the EcoR I and Xba lI sites of the pcDNA 3.1 vector.

To construct a vector expressing his-HuR in E.coli, the full-length coding region of HuR was amplified by using primer pairs CGGAATTCATGTCTAATGGTTATGAAGA and CCCAAGCTTTTATTTGTGGGACTTGTTGG and inserted between the EcoR I and Hind III sites of The PET-28A (+) vector (QIAGEN).

To construct lentivirus vector (pHBLV-CMVIE-IRES-Puro) (HANBIO, China) expressing flag-tagged hTERT and HuR shRNA, hTERT cDNA were amplified by PCR by using primer pairs CGGAATTCATGGACTACAAAGACCATGACGGTG and GGAAGATCTTCAGTCCAGGATGGTCTTGAAGTCTG and inserted between the EcoR I and Bgl II sites. To construct lentivirus vector expressing HuR shRNA, synthesized oligomer pairs GATCCGAAGAGGCAATTACCAGTTTCATTCAAGAGATGAAACTGGTAATTGCCTCTTCTTTTTTC and AATTGAAAAGAAGAAGAGGCAATTACCAGTTTCATCTCTTGAATGAAACTGGTAATTGCCTCTTCG were annealed and inserted between the EcoRI and Bgl II sites of pHBLV-U6-Puro vector (HANBIO, China).

To construct the Lentivirus vector SF-LV-EGFP (from Karl Lenhard Rudolph’s lab, Leibniz Institute on Aging - Fritz Lipmann Institute, Jena, Germany) expressing mTERC and its variants, the mTERC fragments were amplified by PCR from the pcDNA 3.0 (+) vectors expressing mTERC and its variants by using primer pairs CCGCTCGAGACCTAACCCTGATTTTCATT and CGGAATTCGGTTGTG AGAACCGAGTTCC and inserted between the XhoI and EcoR I sites of SF-LV-EGFP vector. To construct vector expressing SF-LV-EGFP vector expressing mouse shHuR, oligomers TGCTGTTGACAGTGAGCGAAAGAGGCAATTACCAGTTTCATAGTGAAGC ACAGATGTATGAAACTGGTAATTGCCTCTTCTGCCTACTGCCTCGGA and ACAGTGAGCGAAAGAGGCAATTACCAGTTTCATAGTGAAGCCACAGATGTATGAAACTGGTAATTGCCTCTTCTGCCTA were annealed and inserted between the Xho I and EcoR I sites of the SF-LV-EGFP vector.

To construct pSL-MS2 vector expressing MS2-TERC, primer pairs CCCAAGCTTGGGTTGCGGAGGGTGGGCCT and GGAATTCGCATGTGTGAGCCGAGTCCTGG were used to amplify TERC and inserted between the Hind III and EcoR I sites of the pSL-MS2 vector. To construct pCMV-7.1-3× flag (Sigma) expressing MS2-binding protein (MS2-BP), the fragment encoding coat MS2-BP was amplified by PCR by using primer pairs ATAAGAATGCGGCCGCTATGGGCTACCCCTACGACGTG and TGCTCTAGATCAGGTGGCGACCGGTGGATCCG from pMS2-BP-YFP vector and inserted between the Not I and Xba I sites of the pCMV-7.1-3× flag vector.

Preparation of the transcripts

cDNA was used as a template to amplify the different fragments of TERC or mTERC. All 5′ primers contained the T7 promoter sequence 5′-CCAAGCTTCTAATACGACTCACTATAGGGAGA-3′ (T7). To amplify templates for synthesizing RNAs TERC, TERC-A, TERC-B, mTERC, p16 CR (coding region), and p16 3′-UTR, we used following primer pairs; (T7) GGGTTGCGGAGGGTGGGCCT and GCATGTGTGAGCCGAGTCCTGG for TERC, (T7) GGGTTGCGGAGGGTGGGCCT and AGGCCGAGGCTTTTCCGCC for TERC-A, (T7) GCCGCCTTCCACCGTTCATT and GCATGTGTGAGCCGAGTCCTGG for TERC-B, (T7) ACCTAACCCTGATTTTCATTAGC and GGTTGTGAGAACCGAGTTCC for mTERC, (T7) AGCAGCATGGAGCCTTCG and GGTTCTTTCAATCGGGGAT for p16 CR, and (T7) CGATTGAAAGAACCAGAGAG and GTTCTGCCATTTGCTAGCAG for p16 3′-UTR. The templates for variants of TERC (U40A, U100A, U40A + U100A, C106G, G107U, and GC107/108AG) and mTERC (U15A, U58A, U15A + U58A, and C64G) were amplified from the pcDNA 3.0 (+) vector expressing these variants (as described in ‘Constructs’) directly by using primer pairs for wild-type TERC and mTERC. PCR-amplified DNA was used as the template to transcribe biotinylated RNA by using T7 RNA polymerase in the presence of biotin-UTP.

TriFC assays

The vectors pBabe-cmv-NLS-HA-tdMCP-NYFP, plko-TERC-24Xms2-BSD, and FG-EH-DEST2-YFPc-ppw were used in TriFC system. To construct pBabe-cmv-NLS-HA-tdMCP-NYFP containing a nuclear localization signal (NLS) and a hemagglutinin (HA) tag, two coat tdMCPs sequence linked by sequence ATCTACGCCATGGCTTCT were first cloned into a Gateway™ Entry vector then inserted into att R sites of pBabe-cmv-NYFP vector by Gateway LR reaction. To construct plko-TERC-24Xms2-BSD, we modified the pLKO.1-puro lentiviral backbone to replace the puromycin (puro) resistant selection with blasticidin (BSD) and mutated the EcoR I site GAATTC to GAATCC. The TERC and MS2 (24×) sequence linked by a Bam H I site was amplified by PCR and inserted between the EcoR I and Age I sites of plko-BSD lentiviral backbone vector. The pXPA-2/pMD2G or PCGP/VSVG packaging plasmids were packaged in 293T cells. HTC75 cells were infected with these viruses and the stably infected cells were sorted via screening with puro, BSD or G418 48 h later. The ternary cell line was analyzed by flow cytometry.

Isothermal titration calorimetry (ITC) assays

HuR constructs were amplified by PCR from the PET-HuR plasmid containing full-length HuR. PCR products were digested with restriction endonucleases BamH I and Sal I, and then ligated into pET28a-SUMO plasmid carrying the Ulp1 cleavage site. Recombinant plasmids were confirmed by DNA sequencing and transformed into E. coli BL21 (DE3) to express recombinant proteins with N-terminal 6× His-SUMO tag. E. coli cells were cultured in Luria Bertani (LB) medium at 37 °C with kanamycin (50 mg/L) until the OD₆₀₀ reached 0.6–0.8, then induced with 0.2 mM isopropyl-β-d-thiogalactoside (IPTG) at 18 °C. After 16 h of expression, cells were collected by centrifugation at 6000 r.p.m. for 15 min and further resuspended in buffer containing 20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 20 mM Imidazole, pH 8.0, then lysed using a high-pressure cell disrupter (JNBIO). Cell lysates were centrifuged at 17,000 r.p.m. for 1 h at 4 °C. Supernatants were purified with Ni-NTA (GE Healthcare), then washed with lysis buffer and eluted with buffer containing 20 mM Tris-HCl, pH 8.0, 500 mM NaCl, and 500 mM imidazole. The fusion protein was dialyzed with lysis buffer for 4 h and Ulp1 protease was added to remove the N-terminal 6xHis-SUMO tag. The mixture was applied to another Ni-NTA resin to remove the Ulp1 protease and uncleaved proteins. Eluted proteins were concentrated by centrifugal ultrafiltration, loaded onto a HiLoad 16/60 Superdex 75 column (GE Healthcare) pre-equilibrated with buffer containing 10 mM Tris-HCl, pH 8.0, 100 mM NaCl. Fractions containing purified protein were pooled together and concentrated by centrifugal ultrafiltration. Protein concentrations were determined by UV spectrophotometry with predicted extinction coefficients using Vector NTI.

The RNA oligonucleotides were ordered from Dharmacon (GE Healthcare Dharmacon Inc.) and dissolved in 10 mM Tris, pH 8.0, 100 mM NaCl. ITC analysis of HuR bound to RNA substrates was carried out using a MicroCal iTC200 calorimeter (Marvern Inc.) at 25 °C. The buffer used for proteins and RNA oligomers was 10 mM Tris, pH 8.0, 100 mM NaCl. The concentrations of proteins and RNA were determined by a UV spectrometer. The ITC experiments involved 20–30 injections of protein into RNA substrates. The sample cell was loaded with 250 μl of RNAs at 3 μM and the syringe with 80 μL of protein at 75 μM, in some cases for much better binding curve, the RNA oligomers were diluted to 5 μM and the protein was 100 μM. Reference measurements were carried out to compensate for the heat of dilution of the proteins. Curve fitting to a single-binding site model was performed by the ITC data analysis module of Origin 7.0 (MicroCal) provided by the manufacturer, the titration data were deconvoluted based on a binding model containing CCTA were annealed using a nonlinear least-squares algorithm. Δg° of protein-RNA binding was computed as RTln (1/KD), where R, T and K_D are the gas constant, temperature and dissociation constant, respectively.

Telomerase activity and telomere length measurement

Telomere repeat amplification protocol (TRAP) was used for testing telomerase activity³⁸. Cells were collected and used for the analysis of telomerase activity. The products were resolved on polyacrylamide gels (8%) and visualized by staining with SYBR Safe (Invitrogen). For telomere length measurement, we used a kit from Roche (Cat. No. 12 209 136 001) and performed southern blot analysis following the manufacturer’s instructions. Isolated genomic DNA was digested with Hinf I and Rsa I and resolved on 0.8% agarose gels. The denatured and dried gel were hybridized with Digoxin-labeled, telomere-specific hybridization probe (TAGGG) and exposed to X-ray film. The mean terminal restriction fragment (TRF) length was calculated according to the formula: mean TRF = ∑(OD_i)/ ∑(OD_i/L_i), where OD_i was the signal intensity and L_i was the molecular weight at the position i. All of the uncropped images were included in Supplementary Information.

Bisulfite RNA sequencing

For bisulfite RNA sequencing, 1 µg of cellular RNA was dissolved in 10 μl of RNase-free water and mixed with 42.5 μl 5 M sodium bisulfate (Epitect) and 17.5 μl DNA protection buffer (Epitect), incubated in 70 °C for 5 min and 60 °C for 60 min, repeating for 3–5 cycles. Samples were desalted by using Micro Bio-spin6 columns and then de-sulfonated by 1 M Tris (pH 9.0, 1/1, V/V) at 37 °C for 1 h, followed by ethanol precipitation. The bisulfite-converted RNA (0.2 µg) was reverse-transcribed by RevertAid First Strand cDNA Synthesis Kit (Thermo) using primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTAACCTTCCTACCATTCC and subjected to PCR by using following primer pairs: GCGTCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCCTTTTCC and CTAACCCTAACTGAGAAGGGTGTAG for human TERC C106, GCGTCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCTTCCTCTTCCT and CCACTGCCATTGTGAAGAGTTGGG for human TERC C323, and GCGTCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCACTTTCCT and ACCTAACCCTGATTTTTATTAGTTGTGGGTT for mTERC C64. The PCR products were inserted into the pGEM-T Easy Vector System (Promega). The plasmids prepared from single clones were sequenced and aligned with TERC sequence. The cytosine retained was considered to be methylated.

Mice

The Terc^+/− mice (Ly5.2 strains) were a gift from Dr. K. L. Rudolph. mTERC^+/− mice were crossed to produce third-generation G3 mTERC^−/− mice. The recipient mice used in the transplantation assays were either CD45.1 mice or CD45.1/45.2 mice. Lethal irradiation dose of the recipient animals was 10 Gy. All mice were maintained in C57BL/6J background. Mice were maintained on a standard diet in 12-h-light and 12-h-dark shifts in Hangzhou Normal University. All of the animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and with the approval of Animal Care and Use Committee of School of Medicine at Hangzhou Normal University.

Purification of the bone marrow derived HSCs

The bone marrow derived HSCs were purified^39,40,41 are as follows:

1.
Mice were killed by cervical dislocation, in accordance with relevant authorities’ guidelines and regulations.
2.
Using small scissors and forceps, dissected out femurs, tibias, ilium, pelvis, spine, and sternum from C57/B6 mice and placed samples in a 60 mm tissue culture dish containing 4 ml ice-cold PBS.
3.
Whole bones can be crushed using a mortar and pestle.
4.
Filter cells through 50 mm nylon mesh into a 15 ml tube.
5.
Count nucleated cells with a hemacytometer. Usually, 10⁸ bone marrow cells can be obtained from each mouse.
6.
Spin down cells for 5 min at 440 g at 4 °C.
7.
Aspirate the supernatant, carefully leaving ~30 μl staining medium above the pellet, then resuspend cells in this residuum.
8.
Add 5 μl APC-conjugated antibodies against cKit per 10⁸ cells on ice for 30 min.
9.
Wash cells with 1 ml PBS by spinning down for 5 min at 440 g at 4 °C, add 5 μl of anti-APC-conjugated magnetic beads (Miltenyi) per 10⁸ cells to stain cells for 15 min at room temperature. Usually, the enrichment of LSK cells using MACS based cKit⁺ selection is 20-fold, i.e., 2% of LSK cells in the MACS enriched cells.
10.
Wash cells with 1 ml PBS by spinning down for 5 min at 440 g at 4 °C, then add 3 μl lineage marker Ab cocktail (CD4, CD8, B220, Ter119, Mac1, Gr1) per 10⁷ cells on ice for 30 min.
11.
Wash cells with 1 ml PBS by spinning down for 5 min at 440 g at 4 °C, then stain cells with cKit-APC, Sca1-PE-Cy7, and streptavidin-PE conjugated rat anti-mouse antibodies on ice for 30 min.
12.
Wash cells with 1 ml PBS by spinning down for 5 min at 440 g at 4 °C, then sort cells by Lin⁻c-Kit⁺Sca1⁺. BD Influx^TM Cell Sorter (http://static.bdbiosciences.com/documents/BD Influx User Guide.pdf) with 86 μm nozzle was used for cell sorting. With the flow rate (drops per second) of 8000 events per second, 5000 LSK cells could be obtained per minute.
13.
Sorted LSK cells were cultured in 48-well plate with lentivirus, and were transplanted into lethally irradiated recipients 12 h after infection. The total number of the cells transplanted is about 2 × 10⁴. After calculation, ~4–6 × 10³ GFP⁺ LSK HSCs were transplanted per mouse in LV-TREC (or variants) expressing group or 1.2–1.8 × 10⁴ GFP⁺ LSK HSCs were transplanted per mouse in LV-shHuR expressing group.

Lentivirus production and transduction

Small hairpin RNA of murine HuR was cloned into the SF-LV-EGFP vector (a kind gift from Lenhard Rudolph lab). Lentivirus was produced in 293T cells after transfection of 14 mg shRNA plasmid, 10 mg pspAX₂ helper plasmid and 6 mg pMD2G by using polyethylenimine. Cells were replaced with fresh medium 12 h after transfection. Collected the virus supernatant 48 h after transfection and concentrated by centrifugation the medium at 25,000 r.p.m. for 2.5 h at 4 °C. The virus pellet was dissolved in sterile PBS. Lentiviral titers were assessed and calculated by the transfection of cKit positive cells. A total of 1 × 10⁵ sorted LSK cells were transduced with the Lentivirus⁴². The transduction efficiency was 20–30% in LV-TREC (or variants) expressing group or 60–90% in LV-shHuR expressing group (Supplementary Fig. 11).

Flow cytometry

Antibodies used for flow cytometry analysis or cell sorting were purchased from eBioscience, Biolegend, or BD Bioscience. Total bone marrow cells were stained with surface markers and sorted by flow cytometry. To quantify dead cells, DAPI (LifeTechnologies) was added before flow cytometry. Samples were analyzed on LRSFortessa (BD Biosciences) or sorted on Influx (BD Biosciences). The gating strategy for FACS analysis and sorting is shown in Supplementary Figs. 12, 13.

Real-time qPCR assays for telomere measurement

One hundred cells were sorted into lysis buffer (1/200 Proteinase K in T10E1 buffer). The sorted cells were lysed using a heat block: 1 h at 50 °C and 4 min at 99 °C. The reaction was set up with SYBR Green I in 96-well plates. Run primers against the telomeric repeats and a reference single-copy genomic gene 36B4 to allow direct input normalization across samples. Telomere forward: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT; telomere reverse: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT (36B4 forward: AGATTCGGGATATGCTGTTGGC/36B4 reverse: TCGGGTCCTAGACCAGTGTTC). The relative telomerase length was calculated as a ratio of telomere repeats to single-copy gene (SCG) copies (T/S ratio).

Double-stranded RNA pull-down assays

Double-stranded RNA (dsRNA) pull-down assays were performed as reported⁴³. Briefly, HeLa cells were transfected with a siHuR or a control siRNA. Forty-eight hours later, cells were collected by incubating in J2 lysis buffer (25 mM HEPES (pH 7.2), 75 mM NaCl, 5 mM MgCl₂, 0.5% NP40, 1 U RNasin) on ice for 30 min. The samples were sonicated (5 min, 30 s ON, 30 s OFF) and centrifuged at 12,000 r.p.m. for 20 min at 4 °C. Protein G Dynabeads (25 μl, pre-washed twice with J2 lysis buffer) and J2 mAb (2 μg, Scicons) or mouse IgG (2 μg, Santa Cruz) were incubated in 350 μl J2 lysis buffer for 1 h at 4 °C, washed twice with J2 lysis buffer and then were added to the sample volume of clarified lysates (300 μg), followed by rotation for 3 h at 4 °C. The beads were then washed three times for 5 min at 4 °C with 350 μl of J2 lysis buffer. RNA isolated from the pull-down materials was subjected to RT-qPCR analysis to assess TERC dsRNA. A total of 10% of input lysates were used as a reference for each of the pull-down assays.

Data availability

The data that support the findings of this study are available from the corresponding authors upon reasonable request.

Change history

10 July 2018
In the original version of this Article, the affiliation details for Fan Yang were incorrectly given as ‘Key Laboratory of Regenerative Medicine of Ministry of Education, Institute of Aging and Regenerative Medicine, Jinan University, Guangzhou, 510632, China’ and ‘Leibniz Institute for Age Research - Fritz Lipmann Institute, Friedrich-Schiller University of Jena, Jena, 07745, Germany’. This has now been corrected in both the PDF and HTML versions of the Article.

References

Garcia, C. K., Wright, W. E. & Shay, J. W. Human diseases of telomerase dysfunction: insights into tissue aging. Nucleic Acids Res. 35, 7406–7416 (2007).
Article PubMed PubMed Central CAS Google Scholar
Greider, C. W. Telomere length regulation. Annu. Rev. Biochem. 65, 337–365 (1996).
Article PubMed CAS Google Scholar
Nandakumar, J. & C ech, T. R. Finding the end: recruitment of telomerase to telomeres. Nat. Rev. Mol. Cell Biol. 14, 69–82 (2013).
Article PubMed PubMed Central CAS Google Scholar
Du, H. Y. et al. TERC and TERT gene mutations in patients with bone marrow failure and the significance of telomere length measurements. Blood 113, 309–316 (2009).
Article PubMed PubMed Central CAS Google Scholar
Vulliamy, T. J. et al. Differences in disease severity but similar telomere lengths in genetic subgroups of patients with telomerase and shelterin mutations. PLoS ONE 6, e24383 (2011).
Article ADS PubMed PubMed Central CAS Google Scholar
Vulliamy, T. et al. The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature 413, 432–435 (2001).
Article ADS PubMed CAS Google Scholar
Meyer, K. D. et al. Comprehensive analysis of mRNA methylation reveals enrichment in 3’ UTRs and near stop codons. Cell 149, 1635–1646 (2012).
Article PubMed PubMed Central CAS Google Scholar
Dominissini, D. et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201–206 (2012).
Article ADS PubMed CAS Google Scholar
Squires, J. E. et al. Widespread occurrence of 5-methylcytosine in human coding and non-coding RNA. Nucleic Acids Res. 40, 5023–5033 (2012).
Article ADS PubMed PubMed Central CAS Google Scholar
Gilbert, W. V., Bell, T. A. & Schaening, C. Messenger RNA modifications: form, distribution, and function. Science 352, 1408–1412 (2016).
Article ADS PubMed PubMed Central CAS Google Scholar
Ji, L. & Chen, X. Regulation of small RNA stability: methylation and beyond. Cell Res. 22, 624–636 (2005).
Article CAS Google Scholar
Hussain, S. et al. NSun2-mediated cytosine-5 methylation of vault noncoding rna determines its processing into regulatory small RNAs. Cell Rep. 4, 255–261 (2013).
Article PubMed PubMed Central CAS Google Scholar
Carroll, S. M., Narayan, P. & Rottman, F. M. N6-methyladenosine residues in an intron-specific region of prolactin pre-mRNA. Mol. Cell. Biol. 10, 4456–4465 (1990).
Article PubMed PubMed Central CAS Google Scholar
Lustig, A. The identification of telomerase subunits: catalysing telomere research. Trends Cell Biol. 7, 299–302 (1997).
Article CAS Google Scholar
Mitchell, J. R., Wood, E. & Collins, K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 402, 551–555 (1999).
Article ADS PubMed CAS Google Scholar
Wang, C. & Meier, U. T. Architecture and assembly of mammalian H/ACA small nucleolar and telomerase ribonucleoproteins. EMBO J. 23, 1857–1867 (2004).
Article PubMed PubMed Central CAS Google Scholar
Liu, D. et al. PTOP interacts with POT1 and regulates its localization to telomeres. Nat. Cell Biol. 6, 673–680 (2004).
Article PubMed CAS Google Scholar
O’Connor, M. S., Safari, A., Xin, H., Liu, D. & Songyang, Z. A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc. Natl Acad. Sci. USA 103, 11874–11879 (2006).
Article ADS PubMed CAS Google Scholar
Xin., H. et al. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature 445, 559–562 (2007).
Article ADS PubMed CAS Google Scholar
Fu, D. & Collins, K. Purification of human telomerase complexes identifies factors involved in telomerase biogenesis and telomere length regulation. Mol. Cell 28, 773–785 (2007).
Article PubMed PubMed Central CAS Google Scholar
Pogacic, E., Dragon, C. & Filipowicz, W. Human H/ACA small nucleolar RNPs and telomerase share evolutionarily conserved proteins NHP2 and NOP10. Mol. Cell. Biol. 20, 9028–9040 (2000).
Article PubMed PubMed Central CAS Google Scholar
Tang., M. et al. Disease mutant analysis identifies a novel function of DAXX in telomerase regulation and telomere maintenance. J. Cell Sci. 128, 331–341 (2014).
Article PubMed CAS Google Scholar
Zhang, Y. et al. Cold-inducible RNA-binding protein CIRP/hnRNP A18 regulates telomerase activity in a temperature-dependent manner. Nucleic Acids Res. 44, 761–775 (2016).
Article PubMed CAS Google Scholar
Wang, W. Regulatory RNA-binding proteins in senescence. Ageing Res. Rev. 11, 485–490 (2012).
Article ADS PubMed CAS Google Scholar
Simone, L. E. & Keene, J. D. Mechanisms coordinating ELAV/Hu mRNA regulons. Curr. Opin. Genet. Dev. 23, 35–43 (2013).
Article PubMed PubMed Central CAS Google Scholar
Grammatikakis, I., Abdelmohsen, K. & Gorospe, M. Posttranslational control of HuR function. Wiley Interdiscip. Rev. RNA 8, https://doi.org/10.1002/wrna.1372 (2016).
Shay, J. W. Role of telomeres and telomerase in aging and cancer. Cancer Discov. 6, 584–593 (2016).
Article PubMed PubMed Central CAS Google Scholar
Mondello, C. & Scovassi, A. I. Telomeres, telomerase, and apoptosis. Biochem. Cell Biol. 82, 498–507 (2004).
Article PubMed CAS Google Scholar
Gorbunova, V. & Seluanov, A. Telomerase as a growth-promoting factor. Cell Cycle 2, 534–537 (2003).
Article PubMed CAS Google Scholar
Liu, H. et al. hTERT promotes cell adhesion and migration independent of telomerase activity. Sci. Rep. 6, 22886 (2016).
Article ADS PubMed PubMed Central CAS Google Scholar
Han, Y. et al. In vivo imaging of protein-protein and RNA-protein interactions using novel far-red fluorescence complementation systems. Nucleic Acids Res. 42, e103 (2014).
Article PubMed PubMed Central CAS Google Scholar
Takeuchi, J. et al. Identification and functional characterization of novel telomerase variant alleles in Japanese patients with bone-marrow failure syndromes. Blood. Cells Mol. Dis. 40, 185–191 (2008).
Article CAS Google Scholar
Ghosh, M. et al. Essential role of the RNA-binding protein HuR in progenitor cell survival in mice. J. Clin. Invest. 119, 3530–3543 (2009).
Article PubMed PubMed Central CAS Google Scholar
Chin, L. et al. P53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis. Cell 97, 527–538 (1999).
Article PubMed CAS Google Scholar
Lebedeva, S. et al. Transcriptome-wide analysis of regulatory interactions of the RNA-binding protein HuR. Mol. Cell 43, 340–352 (2011).
Article PubMed CAS Google Scholar
Abdelmohsen, K., Lal, A., Kim, H. H. & Gorospe, M. Posttranscriptional orchestration of an anti-apoptotic program by HuR. Cell Cycle 6, 1288–1292 (2007).
Article PubMed CAS Google Scholar
Shin, J. S., Hong, A., Solomon, M. J. & Lee, C. S. The role of telomeres and telomerase in the pathology of human cancer and aging. Pathology 38, 103–113 (2006).
Article PubMed CAS Google Scholar
Kim, N. W. et al. Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011–2015 (1994).
Article ADS PubMed CAS Google Scholar
Ema, H., Morita, Y., Nakauchi, H. & Matsuzaki, Y. Isolation of murine hematopoietic stem cells and progenitor cells. Curr. Protoc. Immunol. 22, doi: 10.1002/0471142735.im22b01s67 (2005).
Google Scholar
Frascoli, M., Proietti, M. & Grassi, F. Phenotypic analysis and isolation of murine hematopoietic stem cells and lineage-committed progenitors. J. Vis. Exp. 65, 3736 (2012).
Google Scholar
Ema, H. et al. Adult mouse hematopoietic stem cells: purification and single-cell assays. Nat. Protoc. 1, 2979–2987 (2006).
Article PubMed CAS Google Scholar
Chen, Z. et al. Wip1 deficiency impairs haematopoietic stem cell function via p53 and mTORC1 pathways. Nat. Commun. 6, 6808 (2015).
Article PubMed CAS Google Scholar
Aktaş et al. DHX9 suppresses RNA processing defects originating from the Alu invasion of the human genome. Nature 544, 115–119 (2017).
Article ADS PubMed CAS Google Scholar

Download references

Acknowledgements

This work was supported by Grant 2017YFA0504300 and 2017YFA0103302 from the National Key Research and Development Program of China; Grants, 81420108016, 91749208, 91749203, 81525010, 81420108017, 81372166, and 81572843 from the National Natural Science Foundation of China. M.G. was supported by the NIA IRP, NIH. We thank Dr. K. L. Rudolph for providing Terc ± mice.

Author information

These authors contributed equally: Hao Tang, Hu Wang, Xiaolei Cheng, Xiuqin Fan, Fan Yang.

Authors and Affiliations

Department of Biochemistry and Molecular Biology, Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function, School of Basic Medical Sciences, Peking University Health Science Center, 38 Xueyuan Road, Beijing, 100191, China
Hao Tang, Xiaolei Cheng, Xiuqin Fan, Cihang Liu, Dongxing Shao, Bin Jiang, Junyue Xing, Xiaotian Zhang, Xia Yi & Wengong Wang
Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Peking University Health Science Center, 38 Xueyuan Road, Beijing, 100191, China
Hao Tang & Xian Wang
Key Laboratory of Regenerative Medicine of Ministry of Education, Institute of Aging and Regenerative Medicine, Jinan University, Guangzhou, 510632, China
Hu Wang, Fan Yang, Yusheng Cong & Zhenyu Ju
Institute of Aging Research, Hangzhou Normal University, School of Medicine, Hangzhou, 311121, China
Hu Wang, Yusheng Cong & Zhenyu Ju
Department of Biochemistry, School of life Sciences, Fudan University, 2005 Road Songhu, Shanghai, 200433, China
Mengmeng Zhang & Jinbiao Ma
Key Laboratory of Gene Engineering of the Ministry of Education, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, 510006, China
Yanlian Chen, Yuyang Tian, Zhou Songyang, Wenbin Ma & Yong Zhao
Department of Pathology and Biological Chemistry, University of Michigan, 1301 Catherine Street, Ann Arbor, MI, 48105, USA
Yali Dou
Laboratory of Genetics and Genomics, National Institute on Aging, National Institutes of Health, 251 Bayview Blvd., Baltimore, MD, 21224, USA
Myriam Gorospe

Authors

Hao Tang
View author publications
You can also search for this author in PubMed Google Scholar
Hu Wang
View author publications
You can also search for this author in PubMed Google Scholar
Xiaolei Cheng
View author publications
You can also search for this author in PubMed Google Scholar
Xiuqin Fan
View author publications
You can also search for this author in PubMed Google Scholar
Fan Yang
View author publications
You can also search for this author in PubMed Google Scholar
Mengmeng Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Yanlian Chen
View author publications
You can also search for this author in PubMed Google Scholar
Yuyang Tian
View author publications
You can also search for this author in PubMed Google Scholar
Cihang Liu
View author publications
You can also search for this author in PubMed Google Scholar
Dongxing Shao
View author publications
You can also search for this author in PubMed Google Scholar
Bin Jiang
View author publications
You can also search for this author in PubMed Google Scholar
Yali Dou
View author publications
You can also search for this author in PubMed Google Scholar
Yusheng Cong
View author publications
You can also search for this author in PubMed Google Scholar
Junyue Xing
View author publications
You can also search for this author in PubMed Google Scholar
Xiaotian Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Xia Yi
View author publications
You can also search for this author in PubMed Google Scholar
Zhou Songyang
View author publications
You can also search for this author in PubMed Google Scholar
Wenbin Ma
View author publications
You can also search for this author in PubMed Google Scholar
Yong Zhao
View author publications
You can also search for this author in PubMed Google Scholar
Xian Wang
View author publications
You can also search for this author in PubMed Google Scholar
Jinbiao Ma
View author publications
You can also search for this author in PubMed Google Scholar
Myriam Gorospe
View author publications
You can also search for this author in PubMed Google Scholar
Zhenyu Ju
View author publications
You can also search for this author in PubMed Google Scholar
Wengong Wang
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

W.W., Z.J., J.M., Y.D., W.M., Y.Z., X.W., Z.S. and M.G. participated in designing the study. H.T., X.C., X.F., W.M., Y.C., Y.T., M.Z., C.L., D.S., Y.C., J.M., J.X., X.Z., X.Y. and B.J. performed the in vitro and cell culture experiments. H.W., F.Y. and Z.J. performed the stem cell experiments. W.W., Z.J. and M.G. wrote the paper. Y.C. provided the p3× Flag-CMV 10 vector expressing flag-hTERT (which expressed full-length human TERT mRNA), M.G. provided the pSL-MS2 vector, and W.M. provided the FG-EH-DEST2-YFPc-ppw vector.

Corresponding authors

Correspondence to Zhenyu Ju or Wengong Wang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary Information

Peer Review File

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Tang, H., Wang, H., Cheng, X. et al. HuR regulates telomerase activity through TERC methylation. Nat Commun 9, 2213 (2018). https://doi.org/10.1038/s41467-018-04617-7

Download citation

Received: 11 July 2017
Accepted: 07 May 2018
Published: 07 June 2018
DOI: https://doi.org/10.1038/s41467-018-04617-7

This article is cited by

Molecular hallmarks of ageing in amyotrophic lateral sclerosis
- Cyril Jones Jagaraj
- Sina Shadfar
- Julie D. Atkin
Cellular and Molecular Life Sciences (2024)
Aging through an epitranscriptomic lens
- Mary McMahon
- Craig Forester
- Rochelle Buffenstein
Nature Aging (2021)
Basic and translational aging research in China: present and future
- Xiaojuan He
- Moshi Song
- Yong Shen
Protein & Cell (2019)
A novel antisense oligonucleotide anchored on the intronic splicing enhancer of hTERT pre-mRNA inhibits telomerase activity and induces apoptosis in glioma cells
- Fei Wang
- Yajing Cheng
- Xin Geng
Journal of Neuro-Oncology (2019)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.