Abstracts from the 53rd European Society of Human Genetics (ESHG) Conference: e-Posters

    Volume 28 | Supplement 1

    Virtual Conference

    June 6-9, 2020

    Sponsorship: Publication of this supplement was sponsored by the European Society of Human Genetics. All content was reviewed and approved by the ESHG Scientific Programme Committee, which held full responsibility for the abstract selections.

    Disclosure Information: In order to help readers form their own judgments of potential bias in published abstracts, authors are asked to declare any competing financial interests. Contributions of up to EUR 10 000.- (Ten thousand Euros, or equivalent value in kind) per year per company are considered “Modest”. Contributions above EUR 10 000.- per year are considered “Significant”.

    Presenting authors are indicated with bold typeface in the contributor lists.

    e-Posters

    E-P01 Reproductive Genetics/Prenatal Genetics

    E-P01.07 Epidemiological monitoring of congenital malformations in Yakutia from 2007 to 2018

    A. I. Fedorov1, A. L. Sukhomyasova1,2, A. N. Sleptsov2,1, N. R. Maksimova1

    1Research Laboratory “Molecular Medicine and Human Genetics”, Medical Institute, M. K. Ammosov North-Eastern Federal University, Yakutsk, Russian Federation, 2Medical Genetic Center, Republican Hospital №1 – “National Medical Center”, Yakutsk, Russian Federation

    Introduction: Congenital malformations represent an urgent problem that affects the structure of infant and child mortality. In Yakutia, the prevalence of congenital malformations is recording in Register of Medical Genetic Center, Republican Hospital №1 - “National Medical Center”. The purpose of epidemiological monitoring is to improve the prevention and treatment of congenital malformations.

    Material and methods: The data from Medical Genetic Center Register was analyzing by the MedCalc 15.8 program.

    Results: The incidence rate of congenital malformations over a 12-year period averaged 29.4 cases per 1000 newborns with a standard deviation of 2.9. It’s high indicator In Russia (>20 ‰). At this period, the average annual number of births was 15725.7 (SD 1174.3). The high frequencies of malformations in 2012, 2017 and 2018 was observing (Table 1). The observed differences are statistically significantly (p < 0.05).

    Table 1. Congenital malformations prevalence

    YearsIncidences with 95% CI
    20070.0296 (0.02694-0.03246)
    20080.02734 (0.02479-0.03008)
    20090.02743 (0.02492-0.03012)
    20100.02893 (0.02636-0.03168)
    20110.02981 (0.02723-0.03258)
    20120.03336 (0.03067-0.03622)
    20130.0273 (0.02485-0.02992)
    20140.02704 (0.02463-0.02963)
    20150.02527 (0.02289-0.02783)
    20160.02977 (0.0271-0.03263)
    20170.03265 (0.02973-0.03579)
    20180.03464 (0.03154-0.03797)

    Conclusion: Thus, Yakutia is region with a high frequency of congenital malformations, and in recent years an increase the frequency of their registration. The prevalence of congenital malformations is vary at approximate intervals of 4-5 years and increase tendency may persist for several years because improved diagnostic methods.

    Research is part of the project FSRG-2020-0014 “Arctic Genomics: epidemiology, heredity and pathology”.

    A.I. Fedorov: None. A.L. Sukhomyasova: None. A.N. Sleptsov: None. N.R. Maksimova: None.

    E-P01.09 Analysis of the minor allele frequency of WNT7A (rs2639607), WNT4 (rs7521902), TWIST1 (rs4721745) and HOXA10 gene (exon2) in women with presumably hereditary forms of endometriosis.

    N. S. Osinovskaya1,2, N. Y. Shved1, O. V. Malysheva1, M. I. Yarmolinskaya1, V. S. Baranov1

    1Ott’s Scientific Research Institute of Obstetrics, Gynecology and Reproductology, St. Petersburg, Russian Federation, 2North-Western State Medical University named after I.I. Mechnikov, Saint-Petersburg, Russian Federation

    Introduction: According to GWAS, over 100 genes are associated with development of endometriosis (EM) - common gynecologic disorder. The present work was devoted to the study of exon 2 polymorphism in HOXA10 gene as well as the frequency of minor allelic variants of the WNT7A, WNT4, TWIST1 genes.

    Materials and methods: DNA samples extracted from peripheral blood of 41 patients with laparoscopically proved endometriosis and 43 ones from the control cohort were used. Real-time PCR was applied to analyze allelic variants of the WNT7A, WNT4, TWIST1 genes. Sanger sequencing of the 2nd exon of the HOXA10 gene was performed in 41 patients with proved endometriosis.

    Results: The frequencies of the minor variants: rs12639607 (WNT7A), rs4721745 (TWIST1), rs7521902 (WNT4) corresponded its rate in European populations. In the HOXA10 gene, we identified two variants: rs34957925 and rs560654095. The frequency of the rs34957925 minor variant in the endometriosis group corresponded its rate in European populations. The frequency of the minor rs560654095 variant was 0.061 (G-0.00001, 1000 Genomes).

    Conclusions: We did not found statistically significant differences in allele frequencies of EM patients and control groups for the polymorphic variants the WNT7A, TWIST1 and WNT4 genes. In endometriosis patients a high representation (6%) of the rs560654095 minor allele was found. The HOXA10 gene product binds to the β-actin promoter and regulates its expression in the endometrium. Further studies are in progress to check this unusual finding. This work was financially supported by the Russian Science Foundation (No. 19-15-00108)

    N.S. Osinovskaya: None. N.Y. Shved: None. O.V. Malysheva: None. M.I. Yarmolinskaya: None. V.S. Baranov: None.

    E-P01.12 NFE2L2 and JUN transcription study in fetal and maternal tissues of women with pregnancy loss in the first trimester

    E. Mashkina, K. Kovalenko

    Southern Federal University, Rostov-on-Don, Russian Federation

    Background: The cells constantly interact with many signaling molecules. This leads to dynamic changes in the spectrum of expressed genes. Nrf2 and JUN are transcription factors that are involved in maintaining intracellular redox homeostasis, which is necessary for cells proliferation and differentiation. These transcription factors activate the antioxidant defense of cells from oxidative stress. In current work, we investigated the expression of NFE2L2, JUN, SOD1 genes in chorionic and decidual tissues after spontaneous abortion compared to normal first trimester pregnancies.

    Materials and methods: Samples of chorionic tissue and decidua were taken after surgical termination of normally progressing pregnancies and spontaneous abortion in 5-9 week of gestation. RNA expression was analyzed using quantitative real-time PCR method. Data were analyzed using the 2-ΔΔCT method.

    Results: The transcription level of the NFE2L2, JUN, SOD1 genes is significantly higher in decidual tissue cells compared to chorion cells during normal pregnancy (p<0.0001). Thus, the tissue-specific transcription level of the NFE2L2, JUN, SOD1 genes has been revealed for physiological pregnancy. The correlation in the mRNA levels of the JUN, NFE2L2 and SOD1 genes was detected in decidua. In chorionic tissue during normal pregnancy, the level of mRNA of the SOD1 gene is directly proportional to the mRNA of the NFE2L2 gene (r=0.81 p=0.0002). With miscarriage the level of mRNA of the JUN gene in the chorionic tissue is significantly higher compared to the control.

    Conclusion: The results demonstrated that high JUN transcription level in chorionic tissue could be associated with miscarriage in first trimester of pregnancy.

    E. Mashkina: None. K. Kovalenko: None.

    E-P01.14 Prenatal diagnosis of Xq28 microdeletion including exon 10 of IKBKG gene in male fetus with increased nuchal translucency and hydrops and a family history of Incontinentia Pigmenti

    S. Koka1, O. Lobel1, E. Zivi1, Z. Ben-Neriah1, A. Frumkin2, O. Weiss1, S. Zeligson1, R. Segel1

    1Shaare Zedek Medical Center, Jerusalem, Israel, 2Cytogenetics Lab, Department of Genetics, Hadassah Medical Center, Jerusalem, Israel

    Introduction: Incontinentia Pigmenti (IP), is an X-linked dominant Male-lethal disorder, caused by devastating mutations in IKBKG gene. A recurrent exon 4_10 deletion in the IKBKG gene accounts for 60 to 80% of IP-causing mutations, but other point mutations along the gene as well as exon 10 (which include the zinc-finger domain) truncating mutation were described previously.

    Materials and methods: Chromosomal Microarray Analysis (CMA) was performed in chorionic villi sample of aborted pregnancy of fetus with increased nuchal translucency and hydrops, and his 31 years old healthy mother.

    Results: CMA of the fetus found a 34kbp deletion on Xq28 chromosome including at least exon 10 of IKBKG gene - arr[hg19]Xq28(153,792,620-153,826,362)x0. Preliminary results show that the healthy mother carries the deletion in a mosaic state. Family history includes another termination of pregnancy of a male fetus with increased nuchal translucency, two spontaneous early abortions, a girl with suspected clinical diagnosis of IP and one health boy. The recurrent exon 4_10 deletion in IKBKG was previously excluded in the symptomatic girl.

    Conclusions: Here we describe a 34kbp deletion on Xq28 chromosome including exon 10 of IKBKG gene inherited from a healthy mother as a cause for increased nuchal translucency and hydrops in male fetus with family history suspicious for familial IP. The deletion segregation in the family is now in progress and we believe it will explain the girl phenotype as well as the obstetric history. This report stresses the importance of molecular diagnosis in IP for genetic counseling of the entire family.

    S. Koka: None. O. Lobel: None. E. Zivi: None. Z. Ben-Neriah: None. A. Frumkin: None. O. Weiss: None. S. Zeligson: None. R. Segel: None.

    E-P01.18 Reciprocal 7p deletion-7q duplication in a malformed fetus due to maternal inversion of chromosome 7 - cytogenetic and microarray analysis

    M. Hristova-Savova1, R. Bozhilova2, V. Peycheva2, E. Dimova3, K. Belemezova1, S. Yovinska1, M. Rizov1, P. Chaveeva1, A. Shterev1, R. Kaneva2, I. Dimova1,2

    1SAGBAL "Dr Shterev", Sofia, Bulgaria, 2Molecular Medicine Center, Medical University Sofia, Sofia, Bulgaria, 3RWTH, Aachen, Germany

    Pericentric inversions occur in human with a frequency of 1-2% of general population. These balanced chromosomal rearrangements do not cause any problem for the carrier, but during meiosis there is a risk of inversion loop formation in the offspring leading to de novo duplication, deletion or a combination of both [duplication q/deletion p (dup q/del p) or del q/dup p]. Significant numbers of recombinants are produced when the inverted segment size is >50% of the total length of the affected chromosome. We report here a case of prenatal diagnostics of a fetus with multiple anomalies: severe growth retardation, enlarged third ventricle, agenesis of ductus venosus, and cyst of the blood cord. Cytogeneic analysis was performed after amniocentesis and pathologic duplication of chromosome 7q was revealed. To clarify the aberration we made array CGH analysis; the results showed combined aberrations: 3.96 Mbp deletion of 7p (arr[hg19] 7p22.3p22.2(54,185-4,017,864)x1) and 47 Mbp duplication of 7q (7q31.1q36.3(111,668,521-159,118,566)x3). We tested the parents by cytogenetic analysis in a meantime. The mother was revealed to be a carrier of pericentric inversion in chromosome 7 - 46,XX,inv(7)(p22;q31). Thus, we clarify the genetic diagnosis in the fetus - the recombinant chromosome 7 [rec(7)dup(7q)inv(7)(p22q31)mat] must have arisen through meiotic crossing-over between the inverted chromosome and the normal chromosome 7 in the maternal germline. Conclusion: Array CGH is the most powerful technique in determining the exact size and boundaries of the unbalanced segments in case of rearranged chromosomes and, in combination with parental cytogenetic analysis, for providing the adequate genetic counselling.

    M. Hristova-Savova: None. R. Bozhilova: None. V. Peycheva: None. E. Dimova: None. K. Belemezova: None. S. Yovinska: None. M. Rizov: None. P. Chaveeva: None. A. Shterev: None. R. Kaneva: None. I. Dimova: None.

    E-P01.19 The impact of maternal inherited thrombophilia on intra uterine growth restriction

    K. Kartvelishvili1,2, N. Pirtskhelani2,3, N. Kochiashvili2, L. Makhaldiani4

    1Tbilisi State Medical University, Tbilisi, Georgia, 2National Forensics Bureau/Forensic Biology (DNA) Department, Tbilisi, Georgia, 3Tbilisi Open University, Tbilisi, Georgia, 4K. Eristavi National Center of Experimental and Clinical Surgery, Tbilisi, Georgia

    Introduction: Intrauterine growth restriction (IUGR) is defined as estimated fetal weight below gestational age. Inherited thrombophilia is a blood coagulation disorder, which predisposes to thrombosis. Since the placenta is rich in blood vessels, it is reasonable to infer that clot formation within the placental vasculature may result in placental insufficiency, intrauterine growth restriction and other complications.

    Aim: The aim of this study was to determine the intensity of connection between inherited thrombophilia (Factor V Leiden, Prothrombin G20210A and MTHFR C677T gene mutations) and IUGR.

    Materials and methods: 48 Georgian women with pregnancy complication (IUGR of unknown origin) and 100 controls (women with three or more uncomplicated pregnancies) were investigated for detection of inherited thrombophilia by PCR analyses.

    Results: Relationships between IUGR and FVL (12.5% in patients and 0% in control; χ2(1,N=148)=13.028, p=0.001) and Prothrombin (8.33% in patients and 1% in control; χ2(1,N=148)=5.343, p=0.038) mutations were significant. Relationship between IUGR and MTHFR mutation (6.25% in patients and 1% in control; χ2(1,N=148)=3.399, p=0.1) was weak. The combined double and triple mutations were seen in 4 cases, which was not seen in control group. It is important to note that 46(95.83%) patients had a history of other pregnancy complications and thrombosis, 19(39.53%) patients had a history of stillbirth.

    Conclusion: There are few studies concerning the association between IUGR and thrombophilia. Our study reconfirms impact of studied mutations (totally 23%) on IUGR. Further research will help to clarify who should receive thromboprophylaxis to prevent adverse pregnancy outcomes in women with inherited thrombophilia.

    K. Kartvelishvili: None. N. Pirtskhelani: None. N. Kochiashvili: None. L. Makhaldiani: None.

    E-P01.20 Panels of genetic tests in infertile men with severe spermatogenic failure

    S. Yovinska1, M. Hristova-Savova1, K. Belemezova1, M. Rizov1, T. Milachich1, T. Timeva1, P. Andreeva1, D. Savova1, M. Yunakova1, A. Shterev1, I. Dimova2

    1SAGBAL “D Shterev”, Sofia, Bulgaria, 2SAGBAL “D Shterev”; Department of Medical genetics, Medical University Sofia, Bulgaria, Sofia, Bulgaria

    We offered in our clinics different kinds of genetic analyses with the aim to clarify diagnosis in men with severe spermatogenic failure. We have performed cytogenetic analysis in 770 men attending reproductive clinics (group I), 88 with confirmed diagnosis of oligoastenozoospermia (group II) and 43 with confirmed azoospermia (group III). Numerical sex chromosomal aberrations (incl. mosaicism) were found in 3.3% of group I, 3.4% of group II (mainly polysomy Y) and 9.3% of group III (mainly Klinefelter syndrome); female karyotype was diagnosed in 0.6% of men. Structural chromosomal aberrations (mainly translocations) were detected in 1.2% of group I, 3.4% of group II and none of group III. Chromosomal heteromorphism was revealed, respectively, in 13%, 13.6% and 11.5%. DNA analysis for 10 pathogens (CT, MG, MH, UP, UU, TV, NG, TP, HS1 and 2) was performed in ejaculate of men with oligoastenozoospermia and azoospermia. The test was positive in 61.5% of azoospermic men and in 21% of oligoastenozoospermic (p<0.01) as double infection was revealed in 38% and 12%, respectively (p<0.05). The statistically higher frequency was established for Ureaplasma parvum (54% vs 15%) and Herpes simplex (23% vs 3%). Genotyping for 24 mutations and IVS 8 intron polymorphism in CFTR gene was performed in 52 men with severe male factor. Both delf508 mutation and IVS 8 5T was found in 5.8% of the analyzed men. In conclusion, by applying all of the above mentioned analyses in 52 men with severe male factor, we were able to make diagnosis in 60% of them.

    S. Yovinska: None. M. Hristova-Savova: None. K. Belemezova: None. M. Rizov: None. T. Milachich: None. T. Timeva: None. P. Andreeva: None. D. Savova: None. M. Yunakova: None. A. Shterev: None. I. Dimova: None.

    E-P01.21 Recurrent congenital microcephaly: a case report

    M. N. Komnenić Radovanović1, I. Novaković2, G. Čuturilo3,2, J. Ruml Stojanović3, B. Petrović1, O. Kontić-Vučinić1,2

    1Clinic for gynecology and obstretrics, Clinical centre of Serbia, Belgrade, Serbia, 2Faculty of Medicine, University of Belgrade, Serbia, Belgrade, Serbia, 3University Children’s Hospital, Belgrade, Serbia, Belgrade, Serbia

    Introduction: We report the case of a couple with three lost pregnancies, two with primary congenital microcephaly (the first and the third pregnancy, both with male fetuses). The second pregnancy ended as a missed abortion. Karyotyping was perfomed to the couple and results were normal karyotypes. Couple negated the family burden, but X-linked and primary autosomal recessive microcephaly was suspected.

    Materials and methods: After fetal ultrasonogram showing recurrent primary microcephaly in the third pregnancy, fetal blood sample obtained by cordocentesis. The sample was used for standard cytogenetic analysis, aCGH and clinical exome next generation sequencing.

    Results: The fetal karyotyping showed a normal male karyotype (46,XY), confirmed by aCGH analysis. Clinical exome testing and bioinformatic analysis of the genes known to be associated with microcephaly and similar pathological conditions detected pathogenic and likely pathogenic variant in the ASPM (abnormal spindle-like microcephaly-associated) gene. Pathogenic variant was ASPM c.7324C> T, known stop gained mutation with confirmed maternal origin. Likely pathogenic variant was newely described fremeshift deletion ASPM c.10148 delC, with confirmed paternal origin.

    Conclusions: Comprehensive genetic testing of affected fetus showed compound heterozygous mutations in ASPM gene, designed as MCPH5 (microcephaly primary hereditary) locus. An autosomal recessive pattern of inheritance of the detected mutations is most likely involved in the formation of primary congenital microcephaly. Patients are genetically informed about the mode of inheritance of these mutations, possibility of prenatal testing, as well as of the possibility of in vitro fertilization for the purpose of preimplantation genetic diagnosis of detected mutations.

    M.N. Komnenić Radovanović: None. I. Novaković: None. G. Čuturilo: None. J. Ruml Stojanović: None. B. Petrović: None. O. Kontić-Vučinić: None.

    E-P01.24 PGT-A because of male 9qh chromosomal heteromorphism revealed only unbalanced embryos

    M. Rizov1, K. Belemezova1, M. Hristova-Savova1, S. Yovinska1, T. Milachich2, G. Ganeva3, T. Timeva3,4, A. Shterev3, I. Dimova1

    1Genetics laboratory, SAGBAL “Dr Shterev”, Sofia, Bulgaria, Sofia, Bulgaria, 2IVF laboratory, SAGBAL “Dr Shterev”, Sofia, Bulgaria, Sofia, Bulgaria, 3SAGBAL “Dr Shterev”, Sofia, Bulgaria, Sofia, Bulgaria, 4“Angel Kanchev” University of Ruse, Ruse, Bulgaria

    Structural chromosomal abnormalities are responsible for different reproductive issues such as infertility and recurrent pregnancy loss. Polymorphic variations are known to occur in the general population. They include varying sizes of heterochromatin blocks, satellite or repeat sequence regions and inversions. However, previous studies have reported that heterochromatin polymorphisms are more frequent in infertile men. This may be associated with infertility and unsuccessful pregnancy. Preimplantation genetic testing for aneuploidy (PGT-A) is a common method in the assisted reproduction techniques (ART) to determine the genetic status of human embryos. In the presented case we report an infertile couple with recurrent implantation failures (RIF). Karyotyping by G-banding of cultured peripheral blood lymphocytes was performed on both patients. After the analysis, in the male partner was detected heterochromatin polymorphism, karyotype- 46, XY, 9qh+. After genetic counseling, PGD-A was used. For detection of chromosomal imbalances a laser-assisted biopsy was performed on blastocyst stage embryos followed by whole genome amplification (WGA) and next generation sequencing (NGS) was performed according to manufacturer’s instructions. 6 embryos were biopsied and analyzed. None of the embryos was euploid. Various aberrations - from single to complex monosomies and trisomies, were detected. Due to the lack of an euploid embryo, transfer was not performed. This case report is a good example for the reproductive failures at carriers of chromosomal heterochromatin polymorphisms. NGS allows screening of all 24 chromosomes. It’s effective, ensuring a high level of confidence in the results and subsequent selection of euploid embryos for transfer.

    M. Rizov: None. K. Belemezova: None. M. Hristova-Savova: None. S. Yovinska: None. T. Milachich: None. G. Ganeva: None. T. Timeva: None. A. Shterev: None. I. Dimova: None.

    E-P01.25 Chromosomal centromeric polymorphisms and couple infertility

    P. Gkika1, D. Athanasiou1, P. Symeonidis2, F. Gkaitatzi2, E. Kontomanolis2, N. Koutlaki2, T. S. Lialiaris1

    1Demokritus University of Thrace, Medical School, Dept of Genetics, Alexandroupolis, Greece, 2Demokritus University of Thrace, Medical School, Dept of Obstetrics & Gynecology, University Hospital of Alexandroupolis,, Alexandroupolis, Greece

    Introduction: A possible association between the appearance of pericentric chromosomal polymorphisms in cytogenetic examinations and idiopathic reproductive failure in northeastern Greek population was examined.

    Material and methods: Lymphocyte cultures of peripheral blood from 150 individuals, mainly couples, were harvested and processed according to standard laboratory protocols. The samples were visualized using C-banding technique. At least 15 metaphases were analyzed visually per case, and 5 of them were karyotyped using MetaSystems Ikaros software and a Zeiss Axio Imager. Z.2 microscope.

    Results: Chromosomal variations in centromere area of 1,9 and 16 chromosomes were identified in 115 of 150 individuals with failed reproductive clinical histories. After dividing the results by gender, a higher frequency of the chromosome 9 polymorphism was observed in women. The frequency of chromosomal polymorphisms in chromosome 1 and 16 were broadly similar for both genders. As for the couples, we observed that appearance of chromosomal centromeric polymorphisms in both partners was significantly higher, reaching a considerable number of 74%.

    Conclusions: Increasing evidence from our research has confirmed that infertility and subfertility are closely related to chromosomal polymorphisms as 80 % of the patients were identified with a centromeric chromosomal variation. Nevertheless, their mechanism and reason of appearance is yet unclear and to explain the potential reasoning and the meaning of this phenomenon further studies will be needed.

    P. Gkika: None. D. Athanasiou: None. P. Symeonidis: None. F. Gkaitatzi: None. E. Kontomanolis: None. N. Koutlaki: None. T.S. Lialiaris: None.

    E-P01.26 Prenatal detection of a 3p-duplication / 6q-deletion by array-Analysis not visible in GTG-banding

    U. Siebers-Renelt1, I. van Deest2, J. Steinhard2, C. Müller-Hofstede1, Y. Stratis1, A. Bohring1, A. Röpke1

    1Institut für Humangenetik, University Hospital, Muenster, Germany, 2Zentrum für Pränatalmedizin, Muenster, Germany

    We report on a non-consanguineous couple who presented in the 25th week of their second pregnancy. The fetus showed mild cerebral ventriculomegaly, hypoplasia of the cerebellum and a peculiar posture of the fingers without further abnormalities. Family history revealed that his 1.5 year old sister postnatally showed a fixed posture of the fingers and a general developmental delay but no diagnostics had been done so far. In order to exclude trisomy 18, the couple decided for amniocentesis. Array-analysis showed a gain of 14.7 Mb in the chromosomal region 3p25.1-p26.3 and a loss of 5.3 Mb in 6q27 not visible in conventional karyotype (GTG-banding, 400 bands). The sister clinically exhibits a striking similarity with features already described in partial trisomy 3p like hypertelorism, round face, short neck, down slanting palpebral fissures, psychomotor delay and behavioral problems. Chromosomal analysis and array-analysis were performed and revealed the same abnormalities as in the fetus. We therefore suspected a balanced translocation in one of the parents and indeed the mother carries a balanced reciprocal translocation (46,XX,t(3;6)(p25.1;q27)). Despite the clinical variability, the parents felt reassured because they did not experience their daughter as a handicapped child. Therefore, they decided to continue pregnancy. Our case illustrates, that minor findings in prenatal ultrasound and detailed family history may be crucial in prenatal diagnosis. Moreover, it stresses the importance of array-analysis in the prenatal setting. We postulate that genetic counselling should be offered early in pregnancy to all families with retarded children.

    U. Siebers-Renelt: None. I. van Deest: None. J. Steinhard: None. C. Müller-Hofstede: None. Y. Stratis: None. A. Bohring: None. A. Röpke: None.

    E-P01.29 Expression Profile of Complement Activation at Decidual Tissue in Patients with Recurrent Pregnancy Loss

    I. Yilmaz1, P. Ata1, N. Karakas2, E. Buyukbayrak2

    1Marmara University School of Medicine Medical Genetics, Istanbul, Turkey, 2Marmara University School of Medicine Dept of Obstetrics and Gynecology, Istanbul, Turkey

    Recurrent pregnancy losses (RPL) are seen in approximately 1% of fertile women. RPL are defined as spontaneous and terminating at least two or more consecutive pregnancies, seen in 0.5-3% of all pregnancies. Damage in decidual tissue occuring with the effect of maternal antibodies, has a contribution of complement activation. Seventeen percent of women with at least 2 recurrent abortions and thirtyseven percent of those with more than 3 abortions were detected in idiopathic RPL patients having no autoimmune background. The complement system, is a first defense mechanism towards unwanted pathogens and host elements. Decay accelerating factor (DAF,CD55), MAC inhibitory protein (MAC-IP,CD59) and membrane co-factor protein (MCP,CD46) are major complement inhibitory proteins which are highly expressed in normal placenta. Herein, we had nine women with spontaneous abortion as our control group and seventeen women with RPL as our study group. TSH, T3, T4, and progesterone, also C3, C4 serum levels were determined. Since CD55, CD46 and CD59 of fetal trophoblast and maternal tissues are crucial to provide tissue homeostasis, we analyzed the expression of these genes using CFX real-time PCR setting. The statistical analysis according to average CT values were done through Qiagen GeneGlobe assay tool. As a preliminary finding of this research, CD55 expression level was reasonably elevated at decidual tissues of our cases compared to that of controls. Although, CD46 expression levels were different among two groups, the difference was not remarkable as CD55 expression (p>0.05). To support pregnancy in RPL, regulation of complement activation might be crucial.

    I. Yilmaz: None. P. Ata: None. N. Karakas: None. E. Buyukbayrak: None.

    E-P01.31 Progesterone Receptivity and Expression of Progesterone Triggered Genes at the Decidual Tissue in Patients with Recurrent Pregnancy Loss.

    P. Ata1, I. Yilmaz1, N. Karakas2, A. Eren3, E. Buyukbayrak2

    1Marmara University School of Medicine Medical Genetics, Istanbul, Turkey, 2Marmara University School of Medicine Dept of Obstetrics and Gynecology, Istanbul, Turkey, 3Koc University College of Sciences Molecular Biology and Genetics, Istanbul, Turkey

    Recurrent pregnancy losses (RPL) are defined as spontaneous termination of at least two or more consecutive pregnancies. It accounts 0.5-3% of all pregnancies. Its etiology is still unknown in about half of the cases. Since progesterone stabilizes endometrial tissue, it affects decidual tissue during differentiation by changing the expressivity of different genes. Progesterone unresponsiveness due to decreased expression of its receptor and downstream genes, rather than hormone deficiency may effect the fate of pregnancy itself. Herein, nine women with spontaneous abortion as control groups, and seventeen women with RPL as our case group were analyzed; and TSH, T3,T4, progesterone, and C3,C4 levels were determined in the patients’ sera. Patient group had higher progesterone level and lower TSH level compared to controls. We evaluated the expression level of Progesterone Receptor Gene (PGR), and downstream genes; Inositol 1,4,5-Trisphosphate Receptor Type 3 (ITPR3), Extracellular Signal-Regulated Kinase 1 (MAPK1) and Proline Rich Transmembrane Protein 2 (PRRT2) of the decidual tissue. The expression analysis using CFX real-time PCR platform were done through Qiagen GeneGlobe assay tool. Internal control gene was GAPDH for analysis. As a preliminary finding, PGR gene expression level was diminished in our case group compared to that of controls. Conversely, ITPR3 expression was elevated and there was a slight increase in MAPK1 gene expression in patients compared to controls (p>0.05). As protective effect of progesterone on decidual tissue is strongly associated with expression of PGR and its down-stream genes, possible future treatment targets could be identified for RPL.

    P. Ata: None. I. Yilmaz: None. N. Karakas: None. A. Eren: None. E. Buyukbayrak: None.

    E-P01.32 Maternal pathogenic KCNQ1 variant and predisposition to recurrent fetal loss

    L. Kasak1, K. Rull1,2, T. Yang3, D. Roden3, M. Laan1

    1Institute of Biomedicine and Translational Medicine, University of Tartu, Tartu, Estonia, 2Women’s Clinic, Tartu University Hospital, Tartu, Estonia, 3Departments of Medicine, Pharmacology and Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN, United States

    Introduction: Recurrent pregnancy loss (RPL) concerns up to 5% of women of childbearing age. Up to 25% of RPL cases remain idiopathic, suggesting a possible monogenic origin. The study aimed to identify the genetic cause of idiopathic late RPL in a family with multiple miscarriages without fetal malformations or chromosomal abnormalities.

    Materials and methods: Exome sequencing was applied to three miscarried fetuses and the mother, who had experienced five live births, intersected by three early pregnancy losses, and six fetal deaths. Interestingly, 4/5 karyotyped fetal losses had a normal female karyotype, whereas all but one live-born children are male.

    Results: The miscarried conceptuses do not share any rare single nucleotide variants not detected in live-born children. However, the mother carries a KCNQ1 p.Val173Asp substitution (rs199472695), previously reported in a patient with long QT syndrome (LQTS; PMID:16414944). KCNQ1 protein forms potassium channels and regulates the cardiac action potential duration. Consistent with a recent epidemiological study (PMID:31520628), mothers carrying pathogenic heterozygous variants in LQTS genes have an elevated risk of fetal death regardless of the carrier status of the fetus. Functional assay confirmed pathogenicity of the p.Val173Asp variant. The mutant channel significantly reduced total activating and deactivating currents, with dramatically positive shift of voltage dependence of activation by ~10 mV.

    Conclusions: Dysfunction of KCNQ1 contributes not only to the risk of sudden death from LQTS, but also as a maternal risk factor to RPL. The exact molecular mechanism behind this effect is still to be clarified.

    Funding: Estonian Research Council grant IUT34-12

    L. Kasak: None. K. Rull: None. T. Yang: None. D. Roden: None. M. Laan: None.

    E-P01.33 Prenatal diagnosis of a complex skeletal dysplasia case deciphered by exome sequencing and postmortem pathological examination

    G. Christopoulou1, A. Oikonomaki1, S. Samara1, A. Xefteris2, A. Κonstantinidou3, P. Constantoulakis1

    1Genotypos Science Labs MSA, Athens, Greece, 2Eurogenetica S.A., Thessaloniki, Greece, 3Department of Pathology, Unit of Perinatal Pathology, National & Kapodistrian University of Athens (NKUA), Athens, Greece

    Introduction: We present a prenatal and postmortem diagnosis of diastrophic dysplasia (DD) in a fetus conceived by a mother with hypochondroplasia.

    Materials and methods: Prenatal testing at 13 weeks gestation was requested due to a maternal hypochondroplasia phenotype of unknown genetic background. Clinical exome sequencing was performed on DNA extracted from chorionic villi and maternal blood, using Sophia Genetics’ Clinical Exome Solution v2. Following preparations according to the manufacturer’s protocol, DNA libraries were sequenced on an Illumina NextSeq-500 genetic analyser. Data processing, variant calling and pre-classification were conducted by SOPHiA DDM® bioinformatics pipelines.

    Results: A FGFR3 pathogenic variant was identified in the mother, confirming her phenotype; this variant was not detected in the fetus. However, one maternally inherited pathogenic and one of unknown significance SLC26A2 variants were identified, related, according to the literature, to four distinct genetic skeletal dysplasias of various severity and prognosis. On 2nd trimester ultrasound the fetus presented short long bones and, following clinical genetic counselling, the pregnancy was terminated. Postmortem radiographical and histopathological findings were consistent with Diastrophic Dysplasia.

    Discussion: Targeted FGFR3 mutation testing, based on the mother’s phenotype, would have missed the Diastrophic Dysplasia diagnosis in the fetus, preventing informed decision for this pregnancy and proper genetic counselling for the family. Therefore, this case highlights the utility of exome sequencing for complex overlapping prenatal phenotypes such as skeletal dysplasia, and underscores the contribution of postmortem pathological examination to the phenotype - genotype correlation, which is essential for the correct interpretation of exome sequencing results.

    G. Christopoulou: None. A. Oikonomaki: None. S. Samara: None. A. Xefteris: None. A. Κonstantinidou: None. P. Constantoulakis: None.

    E-P01.34 Homozygous hypomorphic SOX9 mutation in two 46,XY sisters without skeletal malformations

    S. Ledig1, A. Tewes1, T. Özdemir2, A. Bohring1, P. Wieacker1

    1Institute for Human Genetics, Münster, Germany, 2Department of Medical Genetics, Izmir, Turkey

    Haploinsufficiency of the SOX9 gene in humans causes the skeletal malformation syndrome campomelic dysplasia (CD), which is a semilethal disorder characterised by congenital bowing of the long bones, cleft palate, absence of olfactory bulbs and tracts, heart and renal malformations, hypoplastic lungs, narrow thoracic cage, and delayed bone age. CD patients generally die from respiratory distress. Together with the bone disease 75% of CD-patients show testicular dysgenesis leading to sex reversal. Here, we describe two sisters with the suspicion of non-syndromic XY DSD (disorder of sexual development) and no signs of skeletal malformations. Causative mutations in SRY, NR5A1 and DHH have been excluded by Sanger-sequencing before whole-exome-sequencing was performed and surprisingly revealed in both sisters homozygosity for undescribed variant c.1518C>G p.(Leu506Val) in SOX9. The consanguine parents are heterozygous for c.1518C>G p.(Leu506Val) in SOX9. Functional characterization of SOX9 c.1518C>G p.(Leu506Val) by luciferase assay showed no decrease of transactivating function on Col2a1 promotor in contrast to two SOX9 mutations (c.347C>T p.(Ala116Val) and c.358C>T p.(Arg120Cys)) known to be associated with CD, explaining the non-skeletal phenotype of our patients. Therefore, we suggest that SOX9 variant c.1518C>G p.(Leu506Val) is a hypomorphic mutation that causes XY DSD without raising any SOX9 related skeletal phenotype.

    S. Ledig: None. A. Tewes: None. T. Özdemir: None. A. Bohring: None. P. Wieacker: None.

    E-P01.35 Vascular endothelial growth factor serum level during pregnancy and VEGF rs2010963 polymorphism among women with congenital heart defects in the fetus

    Y. Sharhorodska1,2,3, I. Haiboniuk1, A. Malahova1, U. Dorofeyeva3, O. Shkolnyk1, H. Makukh1

    1Institute of Heredetary Pathology NAMS, Lviv, Ukraine, 2Danylo Halytsky Lviv National Medical University, Lviv, Ukraine, 3Medical Center Intersono Medicover Group, Lviv, Ukraine

    The aim of the study to determine serum level of vascular endothelial growth factor (VEGF) during pregnancy as a possible diagnostic marker of congenital heart defects in offspring. Materials and methods. The serum concentration of VEGF by ELISA was measured among 24 pregnant women (term 20-30 weeks of gestation) with prenatally diagnosed congenital heart defects (CHDs) in fеtus. For control group we studied the serum of 45 pregnant women without complicated genetic and obstetric history. For the analysis of rs2010963 VEGF the PCR - RFLP method was used. Results. Maternal VEGF 405GG genotype was significantly correlated with congenital heart defects of the fеtus (p=0.017, OR = 3.45 (95% CI: 1.22 - 9.72)). In the CHD group, compared with controls, VEGF serum levels were significantly higher (285.6±4.5 vs. 268,0±5,2 pg/mL, p=0.029). The VEGF serum level in pregnant women with genotype VEGF 405GG was higher compare with another genotypes group 405GC and 405CC. Conclusions. Our study suggests that evaluation of VEGF serum level during pregnancy may provide prognostic data, and help identify patients who would have CHD of fetus. Mothers rs2010963 VEGF genotype may play a role in the susceptibility of conhenital heart defects in offspring.

    Y. Sharhorodska: None. I. Haiboniuk: None. A. Malahova: None. U. Dorofeyeva: None. O. Shkolnyk: None. H. Makukh: None.

    E-P01.36 Detection of complete delection of CRRPA gene in prenatal CGH-Array performer by eco anomalies. A case report.

    M. Perez Sanchez1, M. Bellido díaz1, T. De Haro Romero.1, A. González Ramírez2

    1Servicio Andaluz de Salud (SAS)., Granada, Spain, 2FIBAO., Granada, Spain

    Introduction: Wlaker-Warburg syndrome (WWS) is clinically defined as congenital muscular dystrophy acompanied by a variety of brain and eye malformations. Its represents the most severe clinical phenotype in a spectrum of alpha-dystroglycan posttranslational proccesing abnormalities, wich share a defect in laminin bindin glycan synthesis. Homozygotics or compound heterozygotics mutations in several genes had been described as causative for WWS, but very low cases with complete homozygotics delections. Here we described two cases of prenatal diagnosis in a couple with complete CRPPA gene delection. In the first pregnancy, amniocentesis was done for genetics prenatal diagnosis, when by eco at 16 gestation week, was detected absence of cerebellar vermis, megacisterna magna with occipital bone defects and. At a second pregnancy chorionic villis sampling was performed at 12 gestation week.

    Materials and methods: Karyotype was performed with the standar methods. Comparative genomic hybridation (CGH-Array) was performed with the Agilent platform, suplied by PerkinElmer.

    Results: In the first fetus, the fetal Karyotype was normal (46,XX), but the CGH-Array detected an homozygotic 354,58 Kb delecttion at 7p21.2. CGH-Array of both parents presented the same chromosomal microdelection in heterozygosis and was recomended genetic prenatal diagnosis for another pregnancies. In the next pregnancy, chorionic villis sample was analided with de same reults; normal karyotype (46,XY) and homozygotic 354,58 Kb delection at 7p21,2. In both cases the gestation was finised.

    Conclusions: The use of CGH-Array in prenatal diagnosis when ecografics anomalies are detected is the election method for detection of chromosomal microdelections and microduplications.

    M. Perez Sanchez: None. M. Bellido díaz: None. T. De Haro Romero.: None. A. González Ramírez: None.

    E-P01.37 Fetal mosaicism in dichorionic twin pregnancies: challenges for accurate diagnosis and results interpretation

    E. Margarit1,2, M. Vallecillos1, M. Rubio1, I. Madrigal1,2, C. Badenas1,2, A. Soler1,2

    1HOSPITAL CLÍNIC, BARCELONA, Spain, 2IDIBAPS, Barcelona, Spain

    The risk of fetal structural abnormalities and chromosomal aneuploidy is increased in twin pregnancies compared with singleton gestations. In many cases, the chromosome constitution of twin fetuses is discordant, so an accurate prenatal diagnosis is needed. We report two dichorionic/diamniotic twin pregnancies presenting with ultrasound anomalies affecting only one of the fetuses (fetus B). A chorionic villus sample (CVS) was obtained separately for each one of the fetuses, allowing individual analyses to determine possible chromosomal abnormalities. In both cases, samples were first analyzed by QF-PCR to detect possible common aneuploidies. In three of the fetuses, an X chromosome aneuploidy in mosaic form was detected. Additional analyses by conventional cytogenetics, QF-PCR and/or array were performed first in CVS and later in amniotic fluid (AF) samples in order to interpretate the results, detecting possible confined placental mosaicism and allowing a definitive diagnosis for each fetus. Detailed results and possible embryological interpretations are presented.

     Fetus AFetus B
    CASE 1
     Ultrasound1normal fetal structureedema+increased nuchal fold+ductus agenesis
     QF-PCR(CVS)mos 90% X/10% XXmos 10% X/90% XX
     CVS-short culture45,X-
     CVS-long culturemos 45,X[3]/46,XX[27]-
     Array(CVS)-mos 10% X/90% XX
     QF-PCR(AF)≈ XXX
     AF-culturemos 45,X[2]/46,XX[78]45,X[20]
     Control ultrasoundnormal fetal structuresubcutaneous edema+ascitis
    CASE 2
     Ultrasound1normal fetal structureedema+increased NT+reverse ductus venosus
     QF-PCR(CVS)mos X/XX or XXXXX
     CVS-long culture45,X46,XX,+11,der(11;22)(p10;q10)
     Array(CVS)mos X/XX or XXXdup11p
     QF-PCR(AF)XX-
     Array(AF)XX-
     Control ultrasoundnormal fetal structureno fetal activity

    E. Margarit: None. M. Vallecillos: None. M. Rubio: None. I. Madrigal: None. C. Badenas: None. A. Soler: None.

    E-P02 Sensory Disorders (Eye, Ear, Pain)

    E-P02.04 Congenital bilateral iris coloboma in a patient with 16q23.1q23.2 deletion

    B. Aleksiūnienė1, B. Tumienė1, R. Strupaitė–Šileikienė2, A. Utkus1

    1Department of Human and Medical Genetics of Institute of Biomedical Sciences, Faculty of Medicine, Vilnius University, Vilnius, Lithuania, 2Centre of Eye Diseases, Vilnius University Hospital Santaros Klinikos, Vilnius, Lithuania

    Clinical and molecular characterization of rare chromosomal abnormalities helps to detect the candidate genes for congenital anomalies. Congenital ocular coloboma is a birth defect caused by abnormal development of the eye during embryogenesis. We report on a 33-year-old man with bilateral congenital coloboma of the iris at 6 o‘clock. The patient has a high myopia and myopic astigmatism, BCVA of BE - 0,7. Choroidal nevi of both eyes were also noticed. He has no other specific complaints as photophobia or nictalopia, the color vision is full. There were no dysmorphic signs or developmental issues. Chromosomal microarray analysis using the HumanCytoSNP-12v2.1 BeadChip (Illumina Inc., San Diego, CA, USA) was performed and revealed a 2.96 Mb in size deletion in the 16q23.1q23.2 region, arr[GRCh37]16q23.1q23.2(78473430_81434676)×1. The deleted region encompasses 12 protein-coding genes, including 5 disease-associated genes WWOX, MAF, GCSH, BCO1 and GAN. Three genes WWOX, GCSH and GAN are associated with autosomal recessive disorders. MAF is associated with Ayme-Gripp syndrome and various types of cataracts. BCO1 encodes beta-carotene oxygenase 1, which is a key enzyme in the production of vitamin A from carotenoids. Deficiency of this enzyme results in hypercarotenemia and secondary vitamin A deficiency. We speculate that haploinsufficiency of BCO1 may be related to congenital bilateral iris coloboma in our patient.

    B. Aleksiūnienė: None. B. Tumienė: None. R. Strupaitė–Šileikienė: None. A. Utkus: None.

    E-P02.07 First reported case of Doyne Honeycomb Retinal Dystrophy (Malattia Leventinese/Autosomal Dominant Drusen) in Scandinavia

    I. N. Sheyanth1,2,3, M. B. Petersen1,2,3, L. P. Kiruparajan4, S. K. Abildgaard4

    1Research and Knowledge Center in Sensory Genetics, Aalborg, Denmark, 2Department of Clinical Medicine, Aalborg University, Aalborg, Denmark, 3Department of Clinical Genetics, Aalborg University Hospital, Aalborg, Denmark, 4Department of Ophthalmology, Aalborg University Hospital, Aalborg, Denmark

    Introduction: Doyne Honeycomb Retinal Dystrophy (DHRD)/ Malattia Leventinese (ML) is an autosomal dominant, progressive eye disorder characterized by massive central retinal drusen often partly coalescent forming a characteristic honeycomb pattern. Debut of vision loss often occurs in mid-early adulthood and the degree varies. A single mutation in EFEMP1c.1033C>T p.(Arg345Trp) has been identified as the cause.

    Materials and methods: We report a 57-year-old Scandinavian woman of non-consanguineous Danish Caucasian parents presenting with vision loss and metamorphopsia. Ophthalmological examination revealed massive hard drusen on both eyes in the macular region and nasal to the disc as well as macular hyperpigmentation. Optical coherence tomography on the left eye showed partly affected foveal configuration with slightly increased foveal thickness. The patient was clinically diagnosed with DHRD/ML and followed annually with stable conditions. Ten years later reduced visual acuity primarily on the left eye and increased atrophy with subretinal fluid were observed. Anti-vascular endothelial growth factor (anti-VEGF) was administrated, but without effect. Family history revealed no other cases of reduced vision. Diagnostic next generation sequencing of seven genes (Amplexa FleckRet7 Panel) associated with flecked retina was performed at Amplexa Genetics using NovaSeq 6000. The mutation was verified by bidirectional Sanger sequencing.

    Results: A known pathogenic mutation NM_001039348 (EFEMP1): c.1033C>T, p.(Arg345Trp) previously seen in relation to DHRD/ML was identified in a heterozygote state in the index. No other causative variants were identified.

    Conclusion: To our knowledge this case represents the first molecular genetically verified case of DHRD/ML in Scandinavia. Grants: The Obel Family Foundation

    I.N. Sheyanth: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; The Obel Family Foundation. M.B. Petersen: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; The Obel Family Foundation. L.P. Kiruparajan: None. S.K. Abildgaard: None.

    E-P02.08 LOXL1 and CACNA1A SNPs associated with exfoliation syndrome susceptibility in a sample of Northern Spanish population, revealed by high-resolution melting analysis.

    L. Escudero-Arrarás1, A. Lara1, M. Rodríguez-Hidalgo1, T. Alberdi2, A. Basasoro2, I. Rodríguez-Agirretxe2,3,4, J. Mendicute2, J. Ruiz Ederra1,4

    1Biodonostia Health Research Institute, San Sebastián, Spain, 2Department of Ophthalmology, Donostia University Hospital, San Sebastián, Spain, 3Instituto Clínico-Quirúrgico de Oftalmología, Bilbao, Spain, 4RETICS OFTARED, National Institute of Health Carlos III, Ministry of Economy and Competitiveness, Madrid, Spain

    Introduction: Exfoliation syndrome (XFS) is a systemic disease associated with age and characterized by the formation and deposition of a whitish fibrillar substance in the anterior segment of the eye. XFS is a multifactorial disease with genetic and non-genetic factors associated. LOXL1 and CACNA1A are the main genes associated with an increased risk.

    Materials and methods: High resolution melting (HRM) is a simple and high-throughput assay, which has been widely applied in sequence polymorphism identification. Our main goal was to test the suitability of HRM analysis as a genetic screening technique for XFS. We analyzed 26 XFS patients and 52 controls. We analyzed LOXL1 (rs1048661, rs3825942, rs2165241, rs16958477, rs12914489, rs11638944, rs7173049) and CACNA1A (rs4926244) genes. Detected variants were confirmed by Sanger sequencing.

    Results: The allelic and genotypic frequencies of the SNPs are shown in the Table 1. Most XFS SNP were properly resolved by this technique, with the exception of rs1048661 and rs3825942. This is like due to the high percentage of CG (~70%) surrounding these SNP.

    Conclusion: Our method provides a genotyping strategy for identifying individuals with XFS-SNPs in a cost-effective way for most variants analyzed.

    LEA is supported by fellowships from Fundación Jesús de Gangoiti Barrera and from the Health Department of the Basque Government (2018111062 and MTVD19/BD/006). Supported by grants from the ISCIII and FEDER (PI18/00507) and BEGISARE.

    Table 1. Allelic and genotypic frequencies for the most prevalent SNPs in LOXL1 and CACNA1A.

    SNPXFS (n=24)Controls (n=52)SNPXFS (n=24)Controls (n=52)SNPXFS (n=24)Controls (n=52)SNPXFS (n=24)Controls (n=52)
    rs2165241rs1048661rs16958477rs11638944
    AlleleAlleleAlleleAllele
    C0.8850.702G0.9230.933A0.7880.865C0.9420.981
    T0.1150.298T0.0770.067C0.2120.135G0.0580.019
    GenotypeGenotypeGenotypeGenotype
    CC0.8080.673GG0.8850.885AA0.7310.577CC0.8850.962
    CT0.1540.058GT0.0770.096AC0.2690.423CG0.1150.038
    TT0.0380.269TT0.0380.019CC00GG00
    rs4926244rs3825942rs12914489rs7173049
    AlleleAlleleAlleleAllele
    T0.9710.981G10.981G0.8080.827A0.9810.942
    C0.0290.019A00.019A0.1920.173G0.0190.058
    GenotypeGenotypeGenotypeGenotype
    TT0.9420.962GG10.962GG0.6150.654AA0.9620.885
    TC0.0580.038GA00.038GA0.3850.346AG0.0380.115
    CC00AA00AA00GG00

    L. Escudero-Arrarás: None. A. Lara: None. M. Rodríguez-Hidalgo: None. T. Alberdi: None. A. Basasoro: None. I. Rodríguez-Agirretxe: None. J. Mendicute: None. J. Ruiz Ederra: None.

    E-P02.11 Overview of mutations causing early nonsyndromic hearing loss among Czech patients with excluded pathogenic mutations in GJB2 gene.

    D. Šafka Brožková1, S. Poisson Marková1, J. Laštůvková2, D. Rašková3, A. Uhrová Mészárosová1, P. Seeman1

    12nd Faculty of Medicine, Charles University and University Hospital Motol, Prague, Czech Republic, 2Department of Medical Genetics, Masaryk Hospital in Usti nad Labem, Regional Corporation, Usti nad Labem, Czech Republic, 3Centre for Medical Genetics and Reproductive Medicine, Gennet,, Prague, Czech Republic

    Nonsyndromic autosomal recessive hearing loss is a heterogeneous disease where over 80 genes has been reported to be associated with. We examined a group of patients with early/prelingual nonsyndromic hearing loss (NSHL) in which we excluded pathogenic mutations in GJB2 gene. We examined 421 unrelated patients for deletions of STRC gene with quantitative comparative fluorescent PCR (QCF PCR) and 201 unrelated patients with next generation sequencing by custom designed NSHL gene panel. We discovered the disease cause in 54 patients, from which 43 we diagnosed with NSHL panel examination (21.4 %). The most frequent type of nonsyndromic hearing loss is DFNB16, caused by biallelic mutations in the STRC gene and detected to be a cause of hearing loss in 23 patients, almost half of the clarified patients (43%). The spectrum of STRC gene mutations was as follows; A) twelve patients were homozygotes for STRC gene deletion, B) eight were compound heterozygotes for STRC gene deletion and point inactivating mutation and C) three were compound heterozygotes for point inactivating mutations. Other biallelic pathogenic mutations were detected in genes MYO15A (six patients), LOXHD1 (five patients), TMPRSS3 (five patients), CDH23 (four patients), OTOG (two patients). Other genes with biallelic pathogenic mutations were detected only once among patients. Supported by AZV 16-31173A.

    D. Šafka Brožková: None. S. Poisson Marková: None. J. Laštůvková: None. D. Rašková: None. A. Uhrová Mészárosová: None. P. Seeman: None.

    E-P02.12 Possible digenic inheritance of mutations in OTOG and OTOGL as cause of prelingual mild hearing loss

    M. Sinnema1, V. Vernimmen1, H. Yntema2

    1Department of Clinical Genetics, MUMC, Maastricht, Netherlands, 2Department of Human Genetics, Radboud University Medical Centre, Nijmegen, Netherlands

    Normal 0 21 false false false NL X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:Standaardtabel; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:“Calibri”,“sans-serif”; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-fareast-language:EN-US;} Background: Autosomal recessive non-syndromic hearing loss (DFNB) is a genetically heterogeneous disorder. OTOG and OTOGL were identified as autosomal recessive hearing loss genes. Patient: We describe a 20-year old girl with moderate prelingual hearing loss. Whole exome sequencing showed a pathogenic nonsense mutation in the OTOG gene (c.2500C>T) and a partial gene deletion of the OTOGL gene (deletion exon 9-41). Additional Sanger sequencing of both genes did not show a second mutation in one of the genes. The father of the proband is the only family member with the same audiologic profile. Co-segregation between the hearing loss phenotype and the potential causative mutations was verified in all family members by Sanger sequencing. Father and daughter are the only family members with the combination of the OTOG and OTOGL mutation. Conclusions: We identified heterozygous mutations in OTOG and OTOGL in a girl and her father with prelingual hearing loss. OTOG and OTOGL show striking similarities in terms of structure, expression as well as clinical phenotype. To the best of our knowledge, this is the first report of possible biallellic inheritance of mutations in OTOG and OTOGL.

    M. Sinnema: None. V. Vernimmen: None. H. Yntema: None.

    E-P02.13 Whole exome sequencing in hearing loss Mexican family cases

    M. Arenas-Sordo1, P. Linares Mendoza1, J. Doll2, P. Bahena2, M. Hofrichter2, B. Vona2, K. Peñuelas-Romero1, T. Haaf2

    1Instituto Nacional de Rehablitacion, Mexico City, Mexico, 2Institute of Human Genetics, Julius Maximilians University, Würzburg, Germany

    Introduction: Congenital hearing loss is one of the most frequent and genetically heterogeneous sensory diseases in humans. Its prevalence is 1-2 per 1000 live newborns. Globally, the GJB2 gene is responsible for almost 20% of congenital hearing loss but in Mexico it is lower. Mutations in about 200 other genes have been associated. Current studies of new generation sequencing (NGS) has a diagnostic rate of about 40%.

    Material and method: Ten familial cases of bilateral sensorineural hearing loss, severe to profound, non-syndromic, with complete audiological studies and tomographic image of the ear, were studied. Sanger sequencing of GJB2 was done and when no pathogenic variants were found in this gene, WES was performed.

    Results: 1 patient presented pathogenic variants of GJB2 (c.139G> T and c.551G> C), the rest of the results are shown in the table. In 4 patients, the origin of the hearing loss could not be determined. The results found, for the most part, are those expected according to what is reported in other populations, especially variants in genes that cause Usher syndrome.

    Conclusion: The aetiological diagnosis of hearing loss requires the clinical study of patients and their families and molecular studies, starting with the one with the highest prevalence to subsequently move to the different possibilities. It is not possible to date to know the etiology in 100% of cases.

    GeneVariantProteinZygosityRelated disease
    GPR98c.5167C>G/ c.14939T>Cp.(Pro1723Ala)/ p.(Val4980Ala)Compound HeterozygosityUsher syndrome type 2C
    LRP5c.442C>Tp.(Gln148*)HeterozygosityOsteopetrosis Dominant 1
    TNCc.5317G>Ap.(Val1773Met)HeterozygosityDFNA 56
    HK1c.60+2T>Ap.?HomozygosityNeuropathy hereditary sensorimotor (Russe Type)
    USH1Gc.742C>Tp.(Gln248*)HomozygosityUsher Syndrome type 1G

    M. Arenas-Sordo: None. P. Linares Mendoza: None. J. Doll: None. P. Bahena: None. M. Hofrichter: None. B. Vona: None. K. Peñuelas-Romero: None. T. Haaf: None.

    E-P02.14 Mutational spectrum of the SLC26A4 gene and its contribution to the etiology of hearing loss in the indigenous peoples of Southern Siberia (Russia)

    V. Y. Danilchenko1, M. V. Zytsar1, M. S. Bady-Khoo2, E. A. Maslova1,3, A. A. Bondar4, I. V. Morozov3,4, N. A. Barashkov5,6, O. L. Posukh1,3

    1Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russian Federation, 2Perinatal Center of the Republic of Tyva, Kyzyl, Russian Federation, 3Novosibirsk State University, Novosibirsk, Russian Federation, 4Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russian Federation, 5Yakut Scientific Centre of Complex Medical Problems, Yakutsk, Russian Federation, 6M.K. Ammosov North-Eastern Federal University, Yakutsk, Russian Federation

    Introduction: Mutations in the SLC26A4 gene (7q22-q31) lead to recessively inherited deafness (DFNB4) and Pendred syndrome. More than 500 pathogenic SLC26A4-variants are currently revealed in deaf patients in different populations worldwide. This study aimed to investigate the SLC26A4 pathogenic contribution in deafness with unknown etiology in patients belonging to indigenous peoples of Southern Siberia: Tuvinians (the Tyva Republic) and Altaians (the Altai Republic).

    Materials and methods: The study included 232 patients (171 Tuvinians, 61 Altaians) with hearing loss of unknown etiology. Analysis of the SLC26A4 complete sequence including all 21 exons and flanking regions was performed by Sanger sequencing.

    Results: High contribution of the SLC26A4 mutations in deafness was found in Tuvinian patients (28.2%) in contrast to Altaian patients (4.3%). Both known (c.170C>A, c.919-2A>G, c.2027T>A, c.2034+1G>A, c.2168A>G) and several novel pathogenic variants as well as a wide range of benign variants were found in the SLC26A4 sequences of patients. High frequency of mutation c.919-2A>G in Tuvinians (69.9% of all mutant alleles detected in patients and carrier frequency reaching to 5.1% in controls) is probably due to the founder effect.

    Conclusion: This is the first study to address the SLC26A4 mutations contribution in deafness in Siberian populations. Contrast differences in the proportion of deafness caused by SLC26A4 mutations were revealed in Tuvinians and Altaians despite of their related ethnicity and close residence of these indigenous peoples of Southern Siberia. Obtained data significantly contribute to the SLC26A4 allelic diversity worldwide.

    Study was supported by Projects #0259-2019-0010-C-01, #0324-2019-0041-C-01 and RFBR grants #17-29-06016_ofi-m, #20-015-00328_a.

    V.Y. Danilchenko: None. M.V. Zytsar: None. M.S. Bady-Khoo: None. E.A. Maslova: None. A.A. Bondar: None. I.V. Morozov: None. N.A. Barashkov: None. O.L. Posukh: None.

    E-P02.16 Copy number variation analysis in a group of previously unsolved patients with inherited retinal dystrophies: a comparative study

    M. Rodríguez-Hidalgo1, M. Ezquerra-Inchausti1, A. Lara-López1, L. Escudero-Arrarás1, M. Galdós2, G. Garay-Aramburu3, C. Cruchaga4, C. Irigoyen1,5, J. Ruiz-Ederra1,6

    1IIS Biodonostia, San Sebastián, Spain, 2Cruces University Hospital, Bilbao, Spain, 3Araba University Hospital, Vitoria-Gasteiz, Spain, 4Washington University School of Medicine, St. Louis, MO, United States, 5Donostia University Hospital, San Sebastián, Spain, 6RETICS OFTARED, Madrid, Spain

    Introduction: Inherited retinal dystrophies (IRD) are an heterogeneous group of diseases with >250 genes involved. Despite substantial progress in mass sequencing techniques, the genetic cause of 35-45% of the cases of IRD is still unknown. Since the participation of CNVs is involved in at least 1 in 13 patients, here we present the results of analyzing CNV in a cohort of Basque patients using 2 different approaches.

    Materials and methods: 48 IRD patients and 2 positive controls were analyzed. We compared 2 hybridization arrays: Affymetrix CytoScan Xon arrays (ACX) and Agilent Custom arrays (ACA), with 123 IRD related genes.

    Results: Affymetrix CytoScan Xon array: A mean of 56 CNVs/patient, both positive control and 10 potentially disease-causing CNVs were detected. Agilent Custom array: A mean of 8 CNVs/patient, only one positive control and 6 potentially disease-causing CNVs were found.

    Conclusions: ACA are easier to analyze, since their results derive from only 123 IRD genes. Moreover, they include information from both exonic and intronic regions. In contrast, ACX delivers information of CNV throughout the whole genome, with most probes enriched on exonic regions. Therefore information from exons is more robust in ACX arrays. As a general conclusion, Affymetrix CytoScan Xon arrays have more sensitivity but less specificity than our customized Agilent CGH array.

    MRH is supported by a fellowship from Gobierno Vasco, Spain (Pre-2019-1-0325). Work supported by grants from the ISCIII and fondos FEDER (PI17/01413), from Departamento de Salud of Gobierno Vasco (2018111062 and MTVD19/BD/006) and from BEGISARE.

    M. Rodríguez-Hidalgo: None. M. Ezquerra-Inchausti: None. A. Lara-López: None. L. Escudero-Arrarás: None. M. Galdós: None. G. Garay-Aramburu: None. C. Cruchaga: None. C. Irigoyen: None. J. Ruiz-Ederra: None.

    E-P02.17 How prepare a corneal epithelium for cone-related transcriptomic profile assessment in keratoconus?

    K. Jaskiewicz1, M. Maleszka-Kurpiel2,3, M. Rydzanicz4, R. Ploski4, M. Gajecka1,5

    1Institute of Human Genetics, Poznan, Poland, 2Optegra Eye Health Care Clinic, Poznan, Poland, 3Chair of Ophthalmology and Optometry, Poznan University of Medical Sciences, Poznan, Poland, 4Department of Medical Genetics, Medical University of Warsaw, Warsaw, Poland, 5Department of Genetics and Pharmaceutical Microbiology, Poznan University of Medical Sciences, Poznan, Poland

    Introduction: Keratoconus is a multifactorial eye ectasia affecting 1 per 2000 individuals worldwide, characterized by pathological cone formation decentered from pupil axis. Because all corneal layers are involved in disease progression we aimed to establish a protocol for transcriptomic profile based on three distinct corneal epithelium regions.

    Materials and methods: The 10 corneal epithelia before the corneal cross-linking procedure were stampted to maintain correct orientation for cutting on microscope slides with light microscope’s control. As non-keratoconus control 5 myopia patients undergoing refractive error correction were included. From each corneal epithelium the central, middle, and periphery corneal region samples were proceeded based on epithelial thickness mapping and corneal tomography maps. The RNA samples were extracted using Norgen Biotek kits (Single Cell RNA Purification Kit, RNA/DNA/Protein Purification Plus Micro Kit), and RNA quality/quantity were compered (RNA 6000 Pico Kit, Agilent).

    Results: Study design included evaluation of unaffected curvature of cornea and different physiological/functional states of epithelial cells from keratoconus cone and non-cone corneal regions. After protocol establishment we obtained high quality RNA for RNA-seq libraries preparation.

    Conclusions: The corneal material proceeded in accordance with the presented protocol will allow for detailed keratoconus epithelium study involving the phenotypical and transcriptional assessments of keratoconus progression.

    Support: The National Science Centre grant no. 2018/31/B/NZ5/03280. Co-financed by the European Social Fund within the framework of the Operational Programme Knowledge Education Development, a non-competition project ‘International scholarship exchange of doctoral students and academic staff’, implemented within the framework of the Action specified in the application No. POWR.03.03.03.00-00-00-PN13/18.

    K. Jaskiewicz: None. M. Maleszka-Kurpiel: None. M. Rydzanicz: None. R. Ploski: None. M. Gajecka: None.

    E-P02.18 Beta tubulin gene mutation in association with congenital Leber herediter amaurosis syndrome

    A. Maasz1,2, R. Ripszam1,2, A. Zsigmond1,2, J. Bene1,2, A. Gyenesei2, B. Melegh1,2, K. Hadzsiev1,2

    1University of Pecs, Department of Medical Genetics, Pecs, Hungary, 2Szentagothai Research Centre, Pecs, Hungary

    Introduction: Beta-tubulin 4B isotype is one of the subunits of microtubules, which is responsible for the maintenance of microtubules stability. The beta-tubulin 4B protein is encoded by TUBB4B gene located on chromosome 9. Genetic defects of microtubules have been associated with several disorders like tubulinopathies, which show huge heterogeneity. In TUBB4B gene, only a few mutations have been identified to have implications in disorders, so far.

    Patients and methods: The authors report a Hungarian family with undiagnosed rare disorder. The family members suffer from also ophthalmologic and otologic impairments. The authors analyzed the proband and her affected children and the unaffected mother of the proband using whole genome sequencing (WGS). The authors found that all of the affected family members carry the c.1171C>T missense mutation in TUBB4B gene, which causes Arg to Cys change at 391 amino acid position. The mutation was absent in the sample of the unaffected family member. The clinical evaluation of the findings reveals that the mutation fulfills the criteria of pathogenic mutation and the clinical symptoms of the affected family members matches to Leber congenital amaurosis syndrome, which has been previously correlated to this TUBB4B mutation.

    Conclusion: Our unique findings with three affected family members carrying the TUBB4B mutation highlights the importance of next generation sequencing in the discovery of new pathogenic variants and in diagnosis of rare disorders; additionally, it will be important knowledge in gene therapy even in ophthalmology and otology. This work was supported by the grant NSRP K119540 and GINOP-2.3.2-15-2016-00039.

    A. Maasz: None. R. Ripszam: None. A. Zsigmond: None. J. Bene: None. A. Gyenesei: None. B. Melegh: None. K. Hadzsiev: None.

    E-P02.20 Mutational analysis of the most frequent genes in Romanian patients with congenital non-syndromic hearing loss

    I. Resmerita1, S. Cozma2, M. Panzaru1, E. Gorduza1, R. Popescu1, L. Radulescu2, L. Butnariu1, C. Rusu1

    1University of Medicine and Pharmacy “Grigore T. Popa” Iasi - Medical Genetics Department, Iasi, Romania, 2University of Medicine and Pharmacy “Grigore T. Popa” Iasi - ENT Department, Iasi, Romania

    Introduction: Hearing loss is the most common congenital sensory impairment worldwide, with a genetic etiology in more than 60% of the cases. It is estimated that more than 70 loci may contribute to non-syndromic deafness, the most commonly involved genes being GJB2, GJB3, GJA1, MYO6, SLC26A4, POU3F4. The knowledge on the prevalence of mutations in a certain population allows the development of adjusted screening programs.

    Materials and methods: We included in this study 144 unrelated Romanians with non-syndromic congenital severe to profound hearing loss (NSHL). All of the individuals were screened by Multiplex ligation-dependent probe amplification (MLPA) for mutations in GJB2, GJB3, GJB6, WFS1 and POU3F4 genes, and Sanger sequencing for variants in GJB2 gene.

    Results: We found 54 homozygotes or compound heterozygotes individuals (38%) and 14 carriers of different mutations on GJB2 gene. In the study group we found a total of 10 different mutations in GJB2 gene. The 35delG was the most common form of mutation that was present in 23 out of 54 (43%) mutated alleles. The next frequent types of mutation were WT313del14, IVS1 and c.71G>A. We also found 2 patients with mutations in WFS1 gene.

    Conclusions: The etiology of deafness is an additional argument, besides audiological tests, for early treatment (best choice being cochlear implant) and an essential element for the correct management of the individuals. Moreover, identification of the genetic basis of hearing loss in a child facilitates correct genetic counselling with adequate molecular testing of the parents and subsequent prenatal diagnosis.

    I. Resmerita: None. S. Cozma: None. M. Panzaru: None. E. Gorduza: None. R. Popescu: None. L. Radulescu: None. L. Butnariu: None. C. Rusu: None.

    E-P02.24 Next-generation sequencing for germline mutation analysis in patients with retinoblastoma

    D. R. Pencheva, K. Kamenarova, K. Mihova, V. Petkova, I. Dimova, M. Nacheva, V. Mitev, R. Kaneva

    Genome Diagnostics Laboratory, Molecular Medicine Center, Department of Medical Chemistry and Biochemistry, Medical Faculty, Medical University of Sofia, Sofia, Bulgaria

    Introduction: Retinoblastoma is the most common pediatric ocular tumor affecting the retina, initiated mainly by mutations in the tumor suppressor gene RB1. Both hereditary and sporadic forms of the disease are known.

    Materials and methods: In the current study we included two Bulgarian patients diagnosed with retinoblastoma. DNA was isolated from blood. Next-generation sequencing was performed on MiSeq/Illumina platform with TruSight Cancer panel including 94 cancer related genes.

    Results:We found two heterozygous probably pathogenic variants both in RB1, encoding RB transcription corepressor 1: c.2606C>T (p.Pro869Leu; rs775273085) in exon 25 and c.1960+1G>C in intron 19 of the RB1 gene.

    Conclusions:The missense variant c.2606C> T (p.Pro869Leu) in exon 25 is of low frequency in the population (one heterozygote C / T is detected in gnomAD, 1/251337). This mutation was also detected in a heterozygous condition in the mother of the patient, who was diagnosed with renal angiomyolipoma with focal hemorrhages and micro necrosis. The other variant c.1960 + 1G> C found in intron 19 is new for data bases. Single-point replacements of G>A and G>T in the same position have been shown to be pathogenic in patients with retinoblastoma. According to the program used to evaluate the effect of intron variants, replacement of c.1960 + 1G> C would affect mRNA splicing (ADA score 0.99). All of the six commonly used programs to assess the pathogenicity of genetic alterations identify the variant as potentially pathogenic.

    Funding: NSP “Young Scientists and Postdoctoral Fellows”

    D.R. Pencheva: None. K. Kamenarova: None. K. Mihova: None. V. Petkova: None. I. Dimova: None. M. Nacheva: None. V. Mitev: None. R. Kaneva: None.

    E-P02.27 The utility of whole-exome sequencing in establishing specific diagnosis in three cases with syndromic cataracts

    P. Liskova, L. Dudakova, J. Moravikova, M. Magner, T. Honzik

    First Faculty of Medicine, Prague, Czech Republic

    Introduction: Congenital and juvenile cataracts can be associated with a range of systemic signs. Herein we aim to report results of molecular genetic investigation in six probands with syndromic cataracts without a definitive clinical diagnosis.

    Materials and methods: Whole exome sequencing (WES) was performed in all index cases. Variants with minor allele frequency less than 0.005 as per gnomAD v.2 were filtered and those located in genes listed in database Cat-Map were given a priority for further evaluation. Conventional sequencing was used to confirm the presence of the variants and for segregation analysis within the families. Variant-classification was based on the American College of Medical Genetics and Genomics guidelines.

    Results: One proband carried a heterozygous variant c.3491del in COL2A1 predicted to interfere with pre-mRNA splicing. Subsequent re-evaluation of his clinical data confirmed the diagnosis of Stickler syndrome, which was also present in the mother. One proband had a de novo arising heterozygous variant c.512T>G; p.(Leu171Trp) in MYH9 allowing to make a diagnosis of MYH9-related disease. The third case had a known heterozygous change c.284G>C; p.(Gly95Ala) in RIT1 causing Noonan syndrome. His mother was subsequently found to be also mildly affected. No possibly pathogenic variant was identified in three other probands.

    Conclusions: WES allowed for providing definitive diagnosis in three probands with syndromic cataracts. Our study shows that there is a need for raising awareness among healthcare professionals regarding variable association of many syndromes with congenital or juvenile cataracts. Supported by AZV 17-30500A.

    P. Liskova: None. L. Dudakova: None. J. Moravikova: None. M. Magner: None. T. Honzik: None.

    E-P02.29 Clinical exome sequencing reveals Usher syndrome pathogenic PCDH15 and ADGRV1 variants in two pedigrees with hearing and vision loss

    K. Kamenarova1, S. Cherninkova2, K. Mihova1, F. Shakola1, V. Mitev1, R. Kaneva1

    1Molecular Medicine Center, Medical University – Sofia, Sofia, Bulgaria, 2Department of Neurology, University Hospital Alexandrovska, Medical University – Sofia, Bulgaria, Sofia, Bulgaria

    Introduction: Usher syndrome (USH) is a rare disorder causing retinitis pigmentosa (RP), and sensorineural hearing loss. Due to the phenotypic and genetic heterogeneity of this disease, the best method to screen the causative mutations is by high-throughput sequencing. By next-generation sequencing of clinical exome including known USH-causative genes, we aimed to identify the disease-causing mutation in two USH-pedigrees.

    Materials and methods: Using Illumina® platform, we identified two pathogenic variants in two USH genes (PCDH15 and ADGRV1) segregating with vision and hearing loss in two unrelated Bulgarian families.

    Results: In a USH-family, an affected woman was homozygous for a splice-site mutation in PCDH15 (c.3983+1G>T,p.?), predicted to cause splice error - a known mutation for USH type-1F. Ophthalmological examination of the patient confirmed typical RP and prompted a corrected USH type diagnosis. Patient’s unaffected parents and brother were heterozygous for the mutation. In an unrelated clinical case, two siblings with RP were homozygous for a novel nonsense mutation in ADGRV1 (c.5709G>A,p.Trp1903*), predicted to create a very premature stop codon and shortened protein. Clinical follow-up subsequently confirmed pre-existing hearing loss since early childhood in the two patients, resulting in a reassigned diagnosis of USH. Asymptomatic parents and brother were heterozygous carriers of the mutation.

    Conclusions: We have recruited two pedigrees with USH and found homozygous mutations in PCDH15 and ADGRV1. The proteins encoded by these genes are thought to interact with one another to form a network in the sensory cells of the retina and inner ear. Grant references: D01-285/17.12.2019/D-230/17.12.2019/NSF/MES and КП-06-Н33/12/ NSF/MES.

    K. Kamenarova: None. S. Cherninkova: None. K. Mihova: None. F. Shakola: None. V. Mitev: None. R. Kaneva: None.

    E-P02.30 Usher syndrome type 3 in Russian population: 6 first reported cases.

    M. E. Ivanova1,2, E. R. Lozier3, V. S. Kaimonov2, I. V. Mironova2, E. A. Pomerantseva2, F. A. Konovalov3, A. A. Isaev2

    1Oftalmic, Moscow, Russian Federation, 2Genetico, Moscow, Russian Federation, 3Clinical bioinformatics laboratory, Moscow, Russian Federation

    Introduction: Usher syndrome is one of the most frequent reasons of combined blindness and deafness. There are three types of Usher syndrome, type 3 is mild and can be clinically evaluated quite accurately. There is no known effective treatment of Usher syndrome type 3.

    Materials and methods: 120 patients with isolated and syndromic retinitis pigmentosa participated in the study under NCT03901391 clinical trial protocol. Out of 120 cases six were CLRN1 confirmed. Complete ophthalmologic, ENT, and vestibular medical tests were done for clinical characterization. WES, Sanger sequencing were provided for genetic analysis and diagnosis confirmation.

    Results: 6 patients (4 male, 2 female) aged 30.2±6.9 yrs were diagnosed with CLRN1 associated retinopathy which showed classical retinitis pigmentosa bone spicules in the peripheral retina combined with hearing loss starting from early childhood. Four patients were having mild myopia and two were having emmetropia. Four of these patients were unrelated to each other and two were sibs (brother and sister). All of the patients had c.567T>G p.Tyr189* mutation in homozygous state, which probably can denote the founder effect on the territory of Russia.

    Conclusions: There were no previouslydescribed and published Usher syndrome type 3 clinical cases in Russia confirmed with CLRN1 gene mutations. There might be attractive perspectives for the treatment strategies for such group of patients not only because CLRN1 gene has only 6 exonsand mRNA is relatively short (2,39 kb), but also because mutation is homogenous and includes only c.567T>G p.Tyr189* mutation in homozygous state. Funding: Charity fund Con-nection.

    M.E. Ivanova: None. E.R. Lozier: None. V.S. Kaimonov: None. I.V. Mironova: None. E.A. Pomerantseva: None. F.A. Konovalov: None. A.A. Isaev: None.

    E-P03 Internal Organs & Endocrinology (Lung, Kidney, Liver, Gastrointestinal)

    E-P03.01 Hyperaldosteronism in a patient with ATP1A1 deficiency

    S. Gisladottir, H. Gisladottir, J. J. Jonsson, H. T. Bjornsson

    University Hospital of Iceland, Reykjavik, Iceland

    We report a patient with episodes of hypertensive crisis and lactic acidosis from infancy. These episodes were found to be related to hyperaldosteronism and ill treatable with conventional blood pressure medication. At four months old, she was diagnosed with pulmonary hypertension and refractory seizures. She also has developmental delay compounded by multiple brain infarcts. She is treated with alpha-agonists and ACE-inhibitors and responds well. She is also receiving anticonvulsants and PDE inhibitors. WGS was performed for her in 2017 which identified a heterozygous missense variant, p.Asp897Asn, in the ATP1A1 gene (in the extracellular domain) that encodes for the Alpha-1 isoform of the Na(+)/K(+)-ATPase, which helps establish electrochemical gradient over plasma membranes. In 2018 similar variants were described in the ATP1A1 gene in three children (all in the intramembranous domain). Their phenotype has been described as a new disease called hypomagnesemia, seizures and mental retardation 2 (MIM#618314) but none of these patients have hyperaldosteronism. Our patient has demonstrated mild hypomagnesemia as well as seizures and developmental delay. Interestingly, somatic ATP1A1 disease causing variants, have been found in aldosterone-producing adenomas. Additionally in 2018, variants in the gene were found to be a novel cause of Charcot-Marie-Tooth syndrome (all in the intracellular domain), so this gene can lead to multiple phenotypes, which could differ depending on the location of the variants in the domains of the protein. We propose that her episodes of hypertensive crisis and hyperaldosteronism may be an expansion of the phenotype or a novel additional phenotype related to this gene.

    S. Gisladottir: None. H. Gisladottir: None. J.J. Jonsson: None. H.T. Bjornsson: None.

    E-P03.04 Novel variants in the AVP-NPII gene associated with neurohypophyseal diabetes insipidus

    A. Garcia1, L. Madariaga1,2,3, G. Pérez de Nanclares1, A. Vela1,3,2, I. Rica1,2, S. Gaztambide1,2,3, R. Martinez1, I. Martinez de LaPiscina1, I. Urrutia1, A. Aguayo1, O. Velasco4, L. Castaño1,2,3

    1IIS Biocruces Bizkaia, CIBERDEM, CIBERER, Barakaldo, Spain, 2Hospital Universitario Cruces, Barakaldo, Spain, 3UPV/EHU, Leioa, Spain, 4IIS Biocruces Bizkaia, Barakaldo, Spain

    Introduction: Familial neurohypophyseal diabetes insipidus is a rare disease producedby a deficiency in the secretion of antidiuretic hormone and is caused by mutations inthe AVP-NPII gene.

    Materials and methods: Clinical, biochemical and genetic characterization of a group ofpatients clinically diagnosed with Familial neurohypophyseal diabetes insipidus. TheAVP-NPII gene was screened for mutations by polymerase chain reaction followed bydirect Sanger sequencing in 15 different unrelated families from Spain.

    Results: The 15 probands presented with polyuria and polydipsia as the most importantsymptom at the time of diagnosis. In these patients, the disease was diagnosed at amedian of 6 years of age (range: 0.75 - 48 years). We observed 11 presumed pathogenicvariants in 15 families: 8 missense, 1 nonsense and 2 small deletions of 3 nucleotides. Four of the AVP-NPII variants were novel (p.(Tyr21Cys), p.(Gly45Ser), p.(Cys75Tyr),p.(Gly88Cys)).

    Conclusions: We found autosomal dominant FNDI in the 15 probands studied due tolikely pathogenic variants in the AVP-NPII gene confirming the clinical diagnosis. Fourof the AVP-NPII variants were novel.

    A. Garcia: None. L. Madariaga: None. G. Pérez de Nanclares: None. A. Vela: None. I. Rica: None. S. Gaztambide: None. R. Martinez: None. I. Martinez de LaPiscina: None. I. Urrutia: None. A. Aguayo: None. O. Velasco: None. L. Castaño: None.

    E-P03.05 The intriguing role of bitter taste receptor TAS2R38 in primary ciliary dyskinesia “PCD”

    A. Robino1, G. Girotto2, U. Ambrosetti3, G. Piatti4

    1IRCCS-Burlo Garofolo Children Hospital, Trieste, Italy, 2IRCCS-Burlo Garofolo Children Hospital-University of Trieste, Trieste, Italy, 3IRCCS Ca’ Granda, Audiology Unit-University of Milan, Milano, Italy, 4IRCCS Ca’ Granda, Bronchopneumology Unit-University of Milan, Milano, Italy

    PCD is a rare genetic disease due to malfunctioning and/or altered ultrastructure of motile cilia leading to recurrent respiratory infections of upper and lower airways. Chronic rhinosinusitis and bronchiectasis are very common in PCD patients. Recently, it has been shown the presence of taste receptors in the respiratory tract and the possible involvement of bitter taste receptor TAS2R38 gene, in susceptibility to respiratory infections and rhinosinusitis. The aim of this study is to evaluate the frequency of TAS2R38 polymorphisms in PCD patients and their possible correlations with clinical outcomes of the disease. Genetic and phenotypic data of 35 PCD patients were collected. Clinical evaluation includes: number of respiratory infections per year and pathogens; Lund McKay score; number of lung lobes involved; modified Bhalla score. As regards genetic data, 3 polymorphisms (rs1726866,rs713598,rs10246939) within TAS2R38 gene were analyzed and patients classified as PAV/PAV, PAV/AVI and AVI/AVI. A significant difference in the distribution of TAS2R38 haplotype between patients with and without neonatal respiratory distress emerged (p-value=0.01). In particular, a lower percentage of PAV/PAV individuals showed a high number of pulmonary exacerbations (≥ 2/year) (p-value=0.04) compared to those with AVI/AVI and AVI/PAV haplotypes. Moreover, no patients homozygous for PAV/PAV haplotype presented with any chronic colonization by Pseudomonas aeruginosa thus supporting the possible role of TAS2R38 in susceptibility to respiratory infections. In conclusion, here we report, for the first time, a possible association of TAS2R38 polymorphisms with PCD phenotype. A larger collection of patients is in progress and updated results will be presented and discussed.

    A. Robino: None. G. Girotto: None. U. Ambrosetti: None. G. Piatti: None.

    E-P03.06 Clinics and genetics in CF patients with large deletions

    N. Yaneva1, M. Libik2, G. Petrova3, I. Bradinova1, M. Nikolova4, M. Macek2, A. Savov1

    1National Genetic Laboratory, University Hospital of Obstetrics and Gynecology “Maichin Dom”, Sofia, Bulgaria, 2Department of Biology and Medical Genetics, Charles University-2nd Faculty of Medicine and Motol University Hospital, Prague, Czech Republic, 3Pediatric cilinic, UMHAT "Alexandrovska", Sofia; Pediatric department, Medical University of Sofia, Sofia, Bulgaria, 4Pediatric clinic, UMHAT“Sveta Marina“, Varna; Medical Univcersity Varna, Varna, Bulgaria

    Introduction: Cystic fibrosis (CF) is the most common life-shortening condition with autosomal recessive inheritance. It is associated with at least one mutation on each allele on CF transmembrane conductance regulator (CFTR). After screening for point mutations and small indel, using Sanger sequencing and NGS, in some patients the second disease causing mutation remains unidentified.

    Materials and methods: We performed MLPA analysis for detection of large deletions and duplications in CFTR gene, using P091 MLPA MRCHolland kit in a group of 44 CF patients with only one mutation.

    Results: The MLPA screening detected large deletions in eight patients (18%): deletion of exons 4-11 in one patient with R1158X mutation, deletion of exons 18-20 in three patients with F508del mutation and in one with R334W, deletion of exons 2 and 3 in two patients with F508del, two deletions of exons 2 and 13 in one patient. The last finding is novel and not described in databases. The clinical presentation of CF in all of them was with early onset (in the first year of life), meconium ileus, failure to thrive, pancreatic insufficiency, chronic obstructive lung disease and abnormal sweat test levels.

    Conclusion: We established that overall frequency of the large deletions in our patients is about 1% from all mutations that we found in CFTR gene. It must be kept in mind that >99% of all known point mutations have allele frequencies that are below 0.1%. Therefore we believe that it is suitable to use MLPA of CFTR gene for routine molecular diagnostics of CF.

    N. Yaneva: None. M. Libik: None. G. Petrova: None. I. Bradinova: None. M. Nikolova: None. M. Macek: None. A. Savov: None.

    E-P03.07 Differential molecular diagnosis of Cystic fibrosis and Shwachman-Diamond syndrom

    M. Kazaryan1,2, T. Adyan2,1, A. Polyakov2

    1RNRMU, Moscow, Russian Federation, 2Research Centre for Medical Genetics, Moscow, Russian Federation

    Cystic fibrosis (CF) and Shwachman-Diamond syndrome (SDS) are autosomal recessive disorders, associated with mutations in CFTR and SBDS genes respectively. CF and SDS have general symptom - exocrine pancreatic insufficiency. This study aims to describe the possibility of misdiagnosis in case of conditions with common symptoms, such as CF and SDS. The first cohort of 94 patients aged from 0 to 40 years with primary SDS diagnosis were investigated for the presence of 30 CFTR gene mutations that are most frequent in Russian Federation. The second cohort of 361 patients with primary CF diagnosis was analyzed for the presence of 2 common SBDS gene mutations (this sample was divided into 2 groups: 246 probands aged from 0 to 5 years and 115 probands aged from 6 to 10 years). MLPA-method was used to determine point mutations; deletion/insertion mutations were tested by multiplex AFLP-method and automated sequencing as well. We identified one heterozygous carrier of F508del mutation in the CFTR gene in SDS sample (sequencing of the entire coding region of this gene and MLPA-analysis did not reveal a second pathogenic variant in this patient). In a group of 0-5 years CF patients 4 probands were found to have both mutations in the SBDS gene and one proband have 1 heterozygous mutation. In a group of 6-10 years CF patients only 1 proband had both mutations. Our results demonstrate that patients with suspected CF and undetected mutations in the CFTR gene are necessary to differential diagnosis with a SDS.

    M. Kazaryan: None. T. Adyan: None. A. Polyakov: None.

    E-P03.08 Thyroid peroxidase (TPO) mutations in Macedonian patients with congenital hypothyroidism

    N. Zdraveska1, V. Anastasovska1, N. Schoenmakers2, A. Nicholas2, M. Kocova1

    1University Children’s Hospital Skopje, Skopje, Macedonia, The Former Yugoslav Republic of, 2University of Cambridge Metabolic Research Laboratories, Wellcome Trust-Medical Research Council Institute of Metabolic Science, Addenbrooke’s Hospital, Cambridge, United Kingdom

    Introduction: Congenital hypothyroidism (CH) due to thyroid dyshormonogenesis is a heterogenic disorder caused by impairment in any stage of the thyroid hormone biosynthesis pathway. Mutations in seven genes may be associated with thyroid dyshormonogenesis: SLC5A5 (NIS), SCL26A4 (PDS), TG, TPO, DUOX2, DUOXA2, and IYD (DHEAL1). Defects in thyroid peroxidase (TPO) gene are reported as the most frequent cause of dyshormonogenesis with permanent CH characterized with permanent total iodide organification defect.

    Methods: A comprehensive, phenotype-driven, approach was used to identify underlying mutations in Macedonian cohort of CH patients, by sequentially screening known dyshormonogenesis-associated genes. Genomic DNA was extracted from peripheral blood leukocytes, and Sanger sequencing was used to screen for TPO gene mutations in all coding exons and exon/intron boundaries amplified by PCR specific primers.

    Results: Analysis of the TPO gene revealed variants in 3 cases including 2 siblings who each harboured a heterozygous frameshift variant, p.A397Pfs*77, inherited from a euthyroid father. An unrelated case was compound heterozygous for a maternally inherited missense mutation, p.R438H, and a paternally inherited frameshift variant, p.E17Dfs*77. All 3 cases exhibited severe CH at diagnosis, with significantly elevated serum TSH values (mean: 103mU/L, range >75-159mU/L) and low fT4 values (mean<4ug/dl). Goitre was diagnosed on the neonatal thyroid ultrasound and during foetal ultrasound examination in the third case.

    Conclusion: Finding TPO gene mutations in a neonate with CH indicates that the subject will require life-long treatment with thyroid hormone and that future pregnancies should be carefully monitored for the presence of prenatal goiter.

    N. Zdraveska: None. V. Anastasovska: None. N. Schoenmakers: None. A. Nicholas: None. M. Kocova: None.

    E-P03.10 Molecular investigation of Cystic Fibrosis: CFTR mutation spectrum among Greek population

    M. Argyraki, M. Chatziapostolou, S. Vittas

    DNA - Diagnosis N Analysis Laboratory, Thessaloniki, Greece

    Introduction: Cystic Fibrosis (CF) represents the second most common congenital disorder among Greek population. Approximately 4-5% of Greek population represents asymptomatic CF mutation carriers. This in conjunction with the limited knowledge about this disease necessitates the implementation of carrier screening programs.

    Materials and methods: The study population consisted of 485 Greek individuals screened for CF mutations. We used a targeted NGS to sequence all CFTR gene coding regions, intron/exon splice sites and UTRs, combined with MLPA analysis.

    Results: Molecular analysis showed that 96 individuals (19.8%) represent CF mutation carriers, consisting of 24 individuals (4.75%) carrying typical CF-causing mutations, 38 individuals (7.52%) carrying CFTR-RD (CFTR-related disorders) mutations and 38 individuals (7.52%) carrying variants of uncertain significance (VOUS). Seven cases of complex alleles that carry two mutations were also observed, a factor that can complicate CFTR diagnosis and clinical evaluation. The most common typical mutation identified in 15 carriers was ΔF508, followed by 621+1G>T mutation occurring in 3 carriers. Likewise, R75Q mutation represents the most common CFTR-RD mutation identified (8 carriers), followed by L997F and R1162L (found in 6 and 4 carriers respectively). Lastly, c.2620-15C>G mutation was identified in 11 carriers, representing the most common VOUS mutation in the population studied.

    Discussion: Aim of the current study was to estimate the CFTR mutation spectrum and the prevalence of CF mutation carriers among Greek population. Accurate knowledge of CF mutation spectrum provides information for CF prevention programs and may prove particularly important for providing more sufficient genetic counselling to the Greek population.

    M. Argyraki: None. M. Chatziapostolou: None. S. Vittas: None.

    E-P03.13 Correlation of 10 SNP polymorphisms in modifier genes (TNF, GST, HFE) with phenotype of Slovak cystic fibrosis (CF) patients

    E. Tóthová Tarová1, A. Soltysova2, A. Ficek3, P. Celec4,5,3, H. Kayserova6, L. Kádasi3,2

    1Department of Biology, Faculty of Education, J. Selye University, Komárno, Slovakia, 2Institute of Molecular Physiology and Genetics, Slovak Academy of Sciences, Bratislava, Slovakia, 3Department of Molecular Biology, Comenius University, Bratislava, Slovakia, 4Institute of Pathological Physiology, Faculty of Medicine, Comenius University, Bratislava, Slovakia, 5Institute of Molecular Biomedicine, Faculty of Medicine, Comenius University, Bratislava, Slovakia, 6Center of Cystic Fibrosis, Department of Pediatric Pneumology, University Hospital, Bratislava, Slovakia

    Cystic fibrosis (CF) is still the most serious autosomal recessive disease in the white population despite improved treatment of CF patients. More than 2000 identified mutations have been previously described in the CFTR gene. Even in CF patients with identical CFTR genotypes, there are a large number of serious lung diseases and other symptoms. Environment and polymorphisms in other genes play a particularly important role in the phenotypic modification of disease. The main aim of our study was the correlation analysis of 10 SNP polymorphisms/variants in selected modifier genes (TNFα, GSTM, GSTP, GSTT and HFE) and subsequent correlation analysis with clinical symptoms of patients, mainly spirometry measurements of lung function. To identify these polymorphisms, we used methods such as PCR and direct sequencing. Our results show a significant association of the TNFα gene polymorphism (rs1800629) with cardiomyopathy, another polymorphism (rs361525) with hypoalbuminemia and distal obstructive syndrome, and two other polymorphisms (rs1800630, rs1799724) with bacterial infections of Pseudomonas aeruginosa. The GSTT1 gene show significant association with the nasal polyps, GSTP1 gene (rs1695) with a worse pulmonary function by vital capacity of lung (FEV1), also HFE gene polymorphism (rs1799945) with worse pulmonary function (FEV1). Our results can be used as a prognostic marker in the treatment of CF patients.

    E. Tóthová Tarová: None. A. Soltysova: None. A. Ficek: None. P. Celec: None. H. Kayserova: None. L. Kádasi: None.

    E-P03.14 The c.7G>A variant in EHHADH associated with Fanconi renotubular syndrome is also responsible for hepatic failure

    P. Rollier1,2, M. Barth1, V. Milon1, N. Gueguen1, C. Bris1, L. Damaj2, A. Ryckewaert3, S. Odent2, V. Procaccio1, A. Ziegler1, D. Bonneau1

    1Department of Biochemistry and Genetics, Angers University Hospital, Angers, France, 2Department of Clinical Genetics, Rennes University Hospital, Rennes, France, 3Department of Pediatrics, Rennes University Hospital, Rennes, France

    Introduction: EHHADH was first associated to a human disease by Klootwijk et al. in 2014 who reported that the pathogenic variant c.7G>A;p.E3K was responsible for an isolated Fanconi renotubular syndrome. This variant causes an addressing defect of this peroxisomal protein leading to its abnormal localization to mitochondria. We report a second case harbouring the same mutation in EHHADH as that previously reported who was affected with a broader phenotype including recurrent hypoglycemia and hepatic cytolysis associated to Fanconi syndrome.

    Materials and methods: Recruitment of the patient, exome sequencing and functional analyses were carried out at the Angers University Hospital.

    Results: At 4 months of age, the individual presented with hypoglycemia, ketonuria, lactic acidosis and hepatic cytolysis. Subsequently, he presented recurrent episodes of vomiting and/or diarrhea with hypoglycemia after long fasting requiring glucose infusions. Additional features included severe Fanconi tubulopathy with glucosuria, tubular proteinuria, hypouricemia, and nephrocalcinosis. Mitochondrial respiratory chain analyses performed on hepatocytes showed a decreased activity of complex I and IV, including a 70% decrease in complex IV/citrate synthase ratio which was confirmed by the decrease of the same complexes using Western blot analyses. Exome analysis evidenced the missense mutation c.7G>A;p.E3K in EHHADH. This mutation was inherited from the father who was asymptomatic at age 54.

    Conclusions: We expand the phenotypic spectrum of the c.7G>A mutation in EHHADH with the description of hepatic failure, including cytolysis and hypoglycemic episodes, associated with Fanconi tubulopathy. This disease is an autosomal dominant disorder with a great variability in expression.

    P. Rollier: None. M. Barth: None. V. Milon: None. N. Gueguen: None. C. Bris: None. L. Damaj: None. A. Ryckewaert: None. S. Odent: None. V. Procaccio: None. A. Ziegler: None. D. Bonneau: None.

    E-P03.15 Renal phenotype expansion in known syndromes using whole exome sequencing

    I. Schüle1, K. Häffner1,2, J. Kracht1, G. Ruzaike1, E. Lausch1, D. Matheisl1, R. Hentschel1, M. Pohl1, M. Schmidts1

    1Clinic for General Pediatrics, Adolescent Medicine and Neonatology, University of Freiburg, Freiburg im Breisgau, Germany, 2Clinic for Internal Medicine IV Nephrology and General Medicine, University of Freiburg, Freiburg, Germany

    Background: Patients with rare syndromes often have mutations in genes that are not covered by organ specific NGS Panels. Whole exome sequencing (WES) helps finding the underlying genetic cause of end-stage renal disease (ESRD) especially in patients with extrarenal features.

    Methods and results: We report two cases with ESRD in patients with extrarenal organ involvement. A 14 year old boy with a history of perinatal asphyxia presented with a first seizure and ESRD. In addition he showed a psychomotor developmental retardation, muscular hypotonia and facial dysmorphism. The second patient was a newborn with congenital kidney failure, cleft palate, microcephaly, hypothyroidism and also facial dysmorphism. WES revealed a heterozygous variant in the KANSL1 gene (c.1284delA:p.V428fs) in the 14 year old patient not detected in the mother (father unavailable) and a heterozygous de novo variant in the KMT2D gene (c.C8434T:p.Q2812X) in the newborn. Both variants have not been previously described in literature.

    Discussion: KANSL1 and KMT2D mutations cause Koolen-de Vries and Kabuki Syndrome. While clinical features observed in our patients fit well with those conditions, renal disease is extraordinarily severe in our cases: no ESRD has been previously reported for Koolen-de Vries Syndrome and likewise, congenital ESRD has not been described in the literature for Kabuki syndrome so far. Our findings extend the kidney phenotype in these syndromes and show the utility of WES to unravel the cause of ESRD in children that would be missed by gene panel based NGS.

    I. Schüle: None. K. Häffner: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; Greenovation Biotech Gmbh. J. Kracht: None. G. Ruzaike: None. E. Lausch: None. D. Matheisl: None. R. Hentschel: None. M. Pohl: None. M. Schmidts: None.

    E-P03.18 Juvenile nephronophthisis due to NPHP1 homozygous deletion revealed by whole exome sequencing

    G. Christopoulou1, A. Oikonomaki1, S. Samara1, S. Bournazos1, C. Melexopoulou2, J. Boletis2, P. Constantoulakis1

    1Genotypos Science Labs MSA, Athens, Greece, 2Department of Nephrology and Renal Transplantation, Laiko Hospital, Athens, Greece

    Introduction: Renal failure is a major cause of morbidity and mortality worldwide and revealing a potential genetic background is essential for the patients’ management and families’ counselling.

    Materials and methods: A 17-year-old female with tubulointerstitial nephritis was referred for whole exome sequencing (WES). WES was performed on DNA extracted from peripheral blood, using the Twist Human Exome Core-v2 kit (Twist Bioscience). Following preparations according to the manufacturer’s protocol, libraries were sequenced on an Illumina NextSeq-500 genetic analyser. Data processing, variant calling and pre-classification were conducted by SOPHiA DDM® bioinformatics pipelines. Multiplex Ligation-dependent Probe Amplification (MLPA) was performed (P387-C1, Coffalyser net, MRC-HOLLAND) to further confirm results.

    Results: No pathogenic/likely pathogenic SNVs/Indels were detected, related to the phenotype. Gene coverage analysis revealed a homozygous NPHP1 whole gene deletion, subsequently confirmed by MLPA. Deletions including at least NPHP1 are associated with Juveline nephronophthisis, which is in concordance with the phenotype. Parental DNA MLPA analyses revealed NPHP1 heterozygous deletions in both, whereas the proband’s sister was completely normal thus, substantiating inheritance and further guiding the selection of the appropriate family member for possible kidney transplantation.

    Discussion: Optimization in WES protocols allows greater confidence in calling copy number variations. By applying this approach, definite diagnosis of the nephropathy was achieved, otherwise challenging with traditional methods. Whole exome sequencing permits a large number of genes investigated, for different types of variants, establishing diagnosis and leading to accurate and timely decisions for the patient’s and families’ healthcare.

    G. Christopoulou: None. A. Oikonomaki: None. S. Samara: None. S. Bournazos: None. C. Melexopoulou: None. J. Boletis: None. P. Constantoulakis: None.

    E-P03.19 Polymorphisms of calcium metabolism genes associated with kidney stone disease in Russian population

    M. M. Litvinova1,2, T. V. Filippova1, D. V. Svetlichnaya1, S. Z. Nuralieva1, A. D. Matsvay3, K. Khafizov3

    1I.M. Sechenov First Moscow State Medical University (Sechenov University), Moscow, Russian Federation, 2The Loginov Moscow Clinical Scientific Center of Moscow Health Department, Moscow, Russian Federation, 3“Center of Strategic Planning” of the Ministry of Health of the Russian Federation, Moscow, Russian Federation

    Introduction: Kidney stone disease (KSD) is an urgent problem of modern medicine due to high prevalence and recurrence rate of the pathology. The particular scientific interest is currently focused on the genetic mechanisms of urolithiasis. The aim of this study was to investigate an association between polymorphic loci of the calcium metabolism genes and the risk of KSD development in Russian population.

    Materials and methods: Based on the analysis of scientific literature and genomic databases, the list of genes and polymorphisms associated with KSD in different countries was formed. The information was obtained from case-control studies and GWAS. Finally, we formed a genetic panel which included SNPs of VDR, CASR, CALCR, SLC34A1, CLDN14, TRPV5, TRPV6, KLOTHO, ORAI1, ALPL, RGS14, OPN, MGP, PLAU, AQP1, DGKH genes. The study group consisted of 77 patients with KSD. The control group included 76 persons without urolithiasis. Genetic analysis was carried out by next generation sequencing using the Ion S5 platform. We also studied the presence of familial cases of KSD in the observed group.

    Results: Among patients with KSD 54% had family history of urolithiasis, 44% had recurrent course of the disease. 9 SNPs in 4 genes showed statistically significant association with KSD: rs219781, rs219780, rs219779, rs219778, rs219777, rs1544410, rs731236, rs11746443, rs6486795. The odds ratio ranged from 1.2 to 2.5 depending on polymorphism.

    Conclusions: Targeted genetic panel for detecting the genetic predisposition to urolithiasis was designed and validated. Polymorphic loci of genes CLDN14, VDR, SLC34A1, and ORAI1 are associated with KSD in Russian population.

    M.M. Litvinova: None. T.V. Filippova: None. D.V. Svetlichnaya: None. S.Z. Nuralieva: None. A.D. Matsvay: None. K. Khafizov: None.

    E-P03.20 A rare presentation of NPHP3 nephronophthisis

    L. Ramos1,2, S. Fernandes1, C. S. Rosas1, A. C. Marinhas3,4, T. Luís5,4, S. Ferreira6, C. Gomes4

    1Medical Genetics Unit, Hospital Pediátrico, Centro Hospitalar e Universitário de Coimbra, Coimbra, Portugal, 2Faculty of Health Sciences, Universidade da Beira Interior, Covilhã, Portugal, 3Pediatric Unit, Hospital Pediátrico, Centro Hospitalar e Universitário de Coimbra, Coimbra, Portugal, 4Pediatric Nephrology Unit, Hospital Pediátrico, Centro Hospitalar e Universitário de Coimbra, Coimbra, Portugal, 5Pediatric Unit, Centro Hospitalar do Baixo Vouga, Aveiro, Portugal, 6Pediatric Hepatology Unit, Hospital Pediátrico, Centro Hospitalar e Universitário de Coimbra, Coimbra, Portugal

    Introduction: Nephronophthisis (NPHP) is an autosomal recessive cystic kidney disease that usually progresses to end-stage renal disease (ESRD). It is caused by mutations in genes that encode proteins involved in the function of primary cilia, basal bodies and centrosomes, resulting in renal and extrarenal manifestations. Prenatal history of oligohydramnios and kidney cysts can be present. Infantile type of NPHP develops ESRD in the first three years of age and is the most severe form. It is usually caused by mutations in NPHP2 and NPHP3 genes.

    Objective: We intend to demonstrate how difficult the genotype/phenotype correlation in NPHP is, and reinforce the use of gene panel or exome in this disease.

    Materials and methods: Report of clinical manifestations, laboratory examination and imaging data in family related foetus and child with different features of NPHP. A NGS panel for cholestasis was performed.

    Results: Previously healthy child presents pruritus and laboratory examination with renal/liver dysfunction at the age of 21 months. Ultrasound showed normal-sized kidneys with cysts and absent hepatobiliar, pancreatic or cardiac changes. The first pregnancy of the parents was complicated due to nephromegaly with microcysts and anamnios - the diagnosis of NPHP was evoked. The NGS panel identified a homozygous NPHP3 variant, c.3601G>T p.(Glu1201*), and molecular testing to her consanguineous parents is being performed.

    Conclusion: NPHP is characterized by a significant genetic and clinical heterogeneity. Gene panel or exome is the most appropriate approach when NPHP is suspected. The etiologic diagnosis is important for management and genetic counselling.

    L. Ramos: None. S. Fernandes: None. C.S. Rosas: None. A.C. Marinhas: None. T. Luís: None. S. Ferreira: None. C. Gomes: None.

    E-P03.21 A novel pathological variant in the PHOX2B gene associated with a respiratory/ Hirschsprung phenotype in a three-generation family

    I. Borg1,2, M. Pace Bardon3, N. Pace4,5

    1Department of Pathology, University of Malta, Msida, Malta, 2Medical Genetics Unit, Department of Pathology, Mater Dei Hospital, Msida, Malta, 3Department of Medicine, Mater Dei Hospital, Msida, Malta, 4Department of Anatomy, University of Malta, Msida, Malta, 5Centre for Molecular Medicine and Biobanking, University of Malta, Msida, Malta

    Introduction: Mutations in the PHOX2B gene cause congenital central hypoventilation syndrome (CCHS), a rare autonomic nervous system dysfunction disorder characterised by a decreased ventilatory response to hypercapnia. Affected subjects require lifelong ventilatory support, and develop hypoventilation during the non-REM phase of sleep where autonomic control of breathing predominates. CCHS may be isolated or associated with disorders characterised by defective migration/differentiation of neural crest derivatives, including aganglionic megacolon or milder gastrointestinal phenotypes, such as constipation. Most cases of CCHS are de-novo, caused by heterozygosity for polyalanine repeat expansion mutations (PARMs) in exon 3. The remaining 10% of cases are due to heterozygous non-PARM missense, nonsense or frameshift mutations.

    Methodology: We describe a three-generation Maltese-Caucasian family with a variable CCHS/Hirschsprung phenotype, characterised by chronic constipation, three siblings with Hirschsprung disease necessitating surgery and chronic hypoxia requiring non-invasive ventilation.

    Results: Bidirectional sequencing of PHOX2B revealed a novel heterozygous c.241+2delT splice variant that segregates with the CCHS/Hirschsprung phenotype in the family. The deletion lies in the donor splice site of exon 1 and has not been reported in literature or genomic databases. Bioinformatic analysis predicts that the mutation will result in skipping of exon 1 and the formation of a non-functional protein product. The mutation is pathogenic according to ACMG, PVS1, PM2 and PP1 criteria.

    Conclusion: This report expands the mutational spectrum of PHOX2B. It is significant as no splice-site mutations have been previously reported for PHOX2B, and highlights the variability in clinical expression and disease severity of non-PARM mutations.

    I. Borg: None. M. Pace Bardon: None. N. Pace: None.

    E-P03.22 GeNepher: building a data- and biobank for (suspected) hereditary renal disease

    L. R. Claus1, F. Boulogne2, M. R. Lilien1, M. B. Rookmaaker1, A. van der Zwaag1, T. Q. Nguyen1, M. C. Verhaar1, N. V. A. M. Knoers2, P. Deelen1,2, L. Franke2, M. H. de Borst2, A. M. van Eerde1

    1University Medical Center Utrecht, Utrecht, Netherlands, 2University Medical Center Groningen, Groningen, Netherlands

    Introduction: A substantial part of patients with renal disease has an undiscovered monogenic cause. The timely awareness of a potential genetic etiology in kidney disease patients has profound implications for diagnosis and subsequent care pathways, for family members (e.g. in presymptomatic testing and family donation) and for options regarding establishing a family.

    Methods: We will set-up the GeNepher Data- and Biobank. Dutch patients with known and suspected hereditary renal disease are eligible for inclusion. Informed consent will cover use of available medical data, use of available DNA/sequencing data and in selected cases consent for additional blood sampling, skin biopsy or urine collection.

    The GeNepher Data- and Biobank will be used to:

    1. 1.

      Answer questions regarding etiology. In unsolved cases we will perform add-on analyses to identify new candidate genes for renal disease. In order to optimally identify new candidates, and to gain new insights, we are developing a kidney specific gene network using kidney derived RNA-sequencing data. Ultimately we will perform functional studies to validate plausible candidates. In GeNepher there is an infrastructure for return of relevant findings.

    2. 2.

      Study modifiers of progressive renal disease like NPHP1-nephronophtisis.

    3. 3.

      Contact patients for opportunities in treatment development or when diagnose specific trials are started or treatment is approved.

    Results: Inclusions will start in Q2 of 2020.

    Conclusions: The GeNepher Data- and Biobank will improve diagnosis of renal disease by identifying genetic causes, provide insight into pathophysiology and contribute to development of new therapies.

    Grant references: Dutch Kidney Foundation, Kolff Postdoc Senior Grant

    L.R. Claus: None. F. Boulogne: None. M.R. Lilien: None. M.B. Rookmaaker: None. A. van der Zwaag: None. T.Q. Nguyen: None. M.C. Verhaar: None. N.V.A.M. Knoers: None. P. Deelen: None. L. Franke: None. M.H. de Borst: None. A.M. van Eerde: None.

    E-P03.23 Founder effect of SLC2A9 mutation p.(T125M) in Spanish families with hereditary renal hipouricemia type 2

    E. Córdoba-Lanús1,2, A. Perdomo-Ramírez1, G. Mura-Escorche1,3, S. Carinelli1, E. Ramos-Trujillo1, F. Claverie-Martín1

    1Unidad de Investigación, Hospital Universitario Nuestra Señora de Candelaria, Santa Cruz de Tenerife, Spain, 2IUETSPC, Universidad de La Laguna, Santa Cruz de Tenerife, Spain, 3Universidad de La Laguna, Santa Cruz de Tenerife, Spain

    Introduction: Renal hypouricemia (RHUC) is a rare inherited disorder characterized by impaired urate reabsorption in the proximal tubule. Some patients may present severe complications such as exercise-induced acute renal failure and nephrolithiasis. RHUC is caused by inactivating mutations in the SLC22A12 (RHUC type 1) or SLC2A9 (RHUC type 2) genes, which encode urate transporters URAT1 and GLUT9, respectively. Recently, we found that mutation c.374C>T, p.(T125M) is recurrent in Spanish families with RHUC2. Therefore, we hypothesized that this might be due to a founder effect.

    Methods: Thirteen new patients with RHUC were analyzed by sequencing the SLC22A12 and SLC2A9 coding exons. To determine whether patients with the p.(T125M) mutation had a common p.(T125M)-linked haplotype a SNPs-haplotype analysis was performed. A total of nine patients from apparently unrelated families were included in this analysis. Six informative SNPs were analyzed by PCR amplification from genomic DNA and direct sequencing.

    Results: Seven patients carried SLC22A12 mutation p.(T467M), and six presented the recurrent SLC2A9 mutation p.(T125M). Alleles carrying the p.(T125M) mutation shared a common SNP haplotype. Every patient harboring this mutation in homozygous state had a common haplotype (0.7 frequency), G-A-C-T-G-T-C-T (mutant allele in bold). While the haplotype G-G-C-C-G-T-C was the most frequent between controls (0.42).

    Conclusions: Mutation p.(T125M) is the most common variant in Spanish patients with RHUC2. Haplotype analysis confirmed that p.(T125M) is a founder mutation. This study was supported grant PI17/00153 co-financed by the ISCIII-Subdirección General de Evaluación y Fomento de la Investigación and the ERDF “Another way to build Europe”.

    E. Córdoba-Lanús: None. A. Perdomo-Ramírez: None. G. Mura-Escorche: None. S. Carinelli: None. E. Ramos-Trujillo: None. F. Claverie-Martín: None.

    E-P03.25 Molecular study of Wilson disease in a Spanish cohort

    M. Antolin1, I. Paramanov1, P. Fernandez1, L. Iranzo1, D. Martinez1, E. García-Arumí1,2, E. Tizzano1

    1Department of Clinical and Molecular Genetics and Medicine Genetics Group, VHIR, University Hospital Vall d’Hebron, Barcelona, Spain, 2CIBERER, Centro de Investigación Biomédica en Red de Enfermedades Raras, ISCIII, Madrid, Spain

    Introduction: Wilson disease (WD) is a disorder caused by biallelic pathogenic variants in ATP7B gene, resulting in abnormal copper metabolism and deposition, leading to a combination of hepatic, neurologic, and psychiatric features. Diagnosis is confirmed by molecular analysis of ATP7B gene.

    Materials and methods: 34 patients with WD were studied using two long range PCR (exon 2-9; exon 10-21 ATP7B gene). Fragmentation, indexing, library preparation (NEBNext Ultra DNA library prep kit) and sequencing in a MiSeq platform (Illumina) were performed. Exon 1 was analysed by Sanger sequencing.

    Results: Genetic diagnosis was achieved in 18 WD patients whereas only one pathogenic variant was found in 5. Familiar studies have allowed the identification of 2 WD patients before clinical manifestations. 86% of the variants were described as pathogenic whereas 14% were not described previously. A prevalent ATP7B allelic variant, p.(Met645Arg), was found in 5 patients (28%), in trans with other allelic variants. The splicing mutation c.1708-1G>A was found in 3 patients (17%) whereas the c.1708-1G>C was found in one (6%), all in homozygous state. The most prevalent pathogenic variant in Europe p.(His1069Gln) was found in heterozygosis in 2 patients, representing only the 4,4 % of pathogenic alleles in our cohort.

    Conclusions: The most common allelic variant among our WD patients was p.(Met645Arg) followed by the splicing variant c.1708-1G>A. Familiar genetic study of WD by NGS allows the molecular diagnosis of asymptomatic patients and prevent disease.

    M. Antolin: None. I. Paramanov: None. P. Fernandez: None. L. Iranzo: None. D. Martinez: None. E. García-Arumí: None. E. Tizzano: None.

    E-P04 Skeletal, Connetive Tissue, Ectodermal and Skin Disorders

    E-P04.02 The first missense mutation in CSTA gene causes Acral Peeling Skin Syndrome in a Turkish family, Review of the literature

    A. C. Ceylan1, S. Emre2, G. G. Ceylan1

    1Yildirim Beyazit University Medical School Department of Medical Genetics, Ankara, Turkey, 2Yildirim Beyazit University Medical School Department of Dermatology, Ankara, Turkey

    Introduction: Acral Peeling Skin Syndrome (APSS) is a rare, autosomal recessive genodermatosis. The disease is characterized by superficial peeling of the cornified epidermal layer. Skin fragility often affects hands and feet. It is most commonly caused by mutations in the TGM5 (*603805). CSTA (*184600) rarely causes APSS. We intend to invest if there is a new mutation in genes related with APSS.

    Materials and methods: Two siblings were presented us because of chronic and superficial itchy skin lesions. After the dermatological examinations, clinical exome solutionwas performed for the molecular diagnosis of one of the patients. Sanger sequencing was performed for the other patient to find if there is the same mutation.

    Results: A novel homozygote missense mutation was found in CSTA gene in both of the siblings. This variant fulfills PM1, PM2, PP3 and PP4, and should therefore be regarded as a likely pathogenic according to the joint consensus recommendation of the ACMG and AMP.

    Conclusion: Peeling skin syndromes appears to be heterogeneous clinically and genetically. Inhere, we report sixth family with a novel homozygote missense CSTA mutation and clinical findings. It is shown that different type of CSTA mutations can also cause APSS unlike previously reported cases, and will contribute to better illumination of the phenotype regarding with the literature review.

    A.C. Ceylan: None. S. Emre: None. G.G. Ceylan: None.

    E-P04.03 Molecular genetic investigation of ACE inhibitor induced angioedema

    C. Mathey1, A. F. Forstner1,2, C. Maj3, O. Borisov3, E. R. Rassmussen4, A. Bygum5,6, C. von Buchwald4, M. Wadelius7, P. Hallberg7, M. Karawajczyk8, N. Eriksson7,9, B. Wedi10, D. Wieczorek10, P. M. Amann11, H. Löffler11, L. Koch12, C. Schöffl12, N. Evertz13, J. Greve14, G. Wurpts15, S. Moebus16, P. M. Krawitz3, J. Stingl17, B. Sachs*15,18, M. M. Nöthen*1, * equally shared

    1Institute of Human Genetics, University of Bonn, School of Medicine & University Hospital Bonn, Bonn, Germany, 2Center for Human Genetics, University of Marburg, Marburg, Germany, 3Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn, Bonn, Germany, 4Department of Otorhinolaryngology - Head and Neck Surgery and Audiology, University Hospital of Copenhagen, Rigshospitalet F-2071, Copenhagen, Denmark, 5Department of Clinical Genetics, Odense University Hospital, Odense, Denmark, 6Research Unit of Dermato-Venerology, Clinical Institute, University of Southern Denmark, Odense, Denmark, 7Department of Medical Sciences, Clinical Pharmacology and Science for Life Laboratory, Uppsala University, Uppsala, Sweden, 8Department of Medical Sciences, Clinical Chemistry, Uppsala University, Uppsala, Sweden, 9Uppsala Clinical Research Center, Uppsala, Sweden, 10Department of Dermatology and Allergy, Comprehensive Allergy Center, Hannover Medical School, Hannover, Germany, 11Department of Dermatology, SLK Hospital Heilbronn, Heilbronn, Germany, 12Department of Dermatology and Venerology, Medical University of Graz, Graz, Austria, 13Clinic and Polyclinic for Dermatology and Allergology, University Hospital Bonn, Bonn, Germany, 14Department of Otorhinolaryngology, Head and Neck Surgery, Ulm University Medical Center, Ulm, Germany, 15Department of Dermatology and Allergology, Aachen Comprehensive Allergy Center, University Hospital of RWTH Aachen, Aachen, Germany, 16Centre of Urban Epidemiology, Institute of Medical Informatics, Biometry, and Epidemiology, University of Essen, Essen, Germany, 17Institute for Clinical Pharmacology, University Hospital of RWTH Aachen, Aachen, Germany, 18Federal Institute for Drugs and Medical Devices, Research Division, Bonn, Germany

    Angioedema are known adverse drug reactions of ACE inhibitors (ACEi) that can become a potentially life-threatening event. Results of previous research suggest that susceptibility to ACEi induced angioedema (ACEi AE) is dependent on a genetic predisposition and non-genetic risk factors. However, as the biological mechanisms contributing to these angioedema are still largely unknown, further research is needed. The aim of the present study was to investigate common and rare genetic variation in ACEi AE patients. In a targeted sequencing approach, we investigated the occurrence rate of known pathogenic mutations associated with monogenic forms of angioedema in 69 German and 68 Danish patients with ACEi AE. All samples were sequenced on an Illumina NextSeq platform using single molecule molecular inversion probes. In addition, all samples were genotyped on the Illumina Infinium Global Screening Array to identify common genetic variants contributing to angioedema risk under ACEi. Analysis of the sequencing data revealed no known pathogenic mutations in genes associated with the monogenic forms of angioedema. However, we identified 19 other rare (MAF≤0.05), non-synonymous variants for which a contribution to ACEi AE risk cannot be excluded. Quality control and imputation of the array data is currently ongoing. Furthermore, we are currently applying the above investigation strategies to an independent Swedish sample (n=77). Follow-up of the variants identified by targeted sequencing in larger patient samples as well as subsequent biostatistics/-informatics analyses of the GWAS data will help to gain further insights into the underlying molecular mechanisms of ACEi AE.

    C. Mathey: None. A.F. Forstner: None. C. Maj: None. O. Borisov: None. E.R. Rassmussen: None. A. Bygum: None. C. von Buchwald: None. M. Wadelius: None. P. Hallberg: None. M. Karawajczyk: None. N. Eriksson: None. B. Wedi: None. D. Wieczorek: None. P.M. Amann: None. H. Löffler: None. L. Koch: None. C. Schöffl: None. N. Evertz: None. J. Greve: None. G. Wurpts: None. S. Moebus: None. P.M. Krawitz: None. J. Stingl: None. B. Sachs*: None. M.M. Nöthen*: None.

    E-P04.04 ACTN3 rs1815739 polymorphism is associated with anterior cruciate ligament (ACL) rupture in physically active people from Italian, Japanese, Polish and Russian cohorts

    V. Pushkarev1,2,3, N. Kikuchi4, H. Kumagai5, N. Kamiya6, E. Miyamoto-Mikami7, N. Fuku7, C. Calò8, M. Massidda8, D. Dyatlov9, E. Bykov10, P. Cieszczyk11

    1Medical Genetic Centre “Progen”, Moscow, Russian Federation, 2Moscow Center of Advanced Sport Technologies, Moscow, Russian Federation, 3Genetic laboratory, Ural State University of Physical Culture, Chelyabinsk, Russian Federation, 4Department of Training Science, Nippon Sport Science University, Tokyo, Japan, 5Graduate School of Health and Sports Science, Juntendo University, Chiba, Japan and Reseach fellow of Japanese Society for the Promotion of Science, Tokyo, Japan, 6Faculty of Budo and Sport Studies, Tenri University, Nara, Japan, 7Graduate School of Health and Sports Science, Juntendo University, Chiba, Japan, 8Department of Environmental and Life Science, University of Cagliary, Calgary, Italy, 9Department of the Theory of Physical Culture and Biomechanics, Ural State University of Physical Culture, Chelyabinsk, Russian Federation, 10Department of sports medicine and physical rehabilitation, Ural state university of physical culture, Chelyabinsk, Russian Federation, 11Department of Physical Education, Gdansk University of Physical Education and Sport, Gdansk, Poland

    ACL rupture is one of severe multifactorial injuries. The ACTN3 rs1815739 polymorphism affect muscle structure and metabolism and it has been associated with muscle injuries. Resistance to fatigue and muscle stiffness are considered risk factors for ACL injury. The aim of our study was to determine the influence of ACTN3 rs1815739 on ACL rupture in Italian, Japanese, Polish and Russian population samples. A total of 1706 subjects (n=596 ACL rupture patients (cases); n=1113 controls) from Italy (n=52 cases; n=81 controls), Japan (n=74 cases; n=395 controls), Poland (n=237 cases; n=230 controls) and Russia (n=233 cases; n=407 controls) participated in the study. DNA samples were genotyped by TaqMan. R packages were used for statistical analysis. The genotype distributions of all control groups were in HWE. Since the Italian, Polish and Russian samples had similar genotype distributions (all p>0.05) they were pooled together (European cases and controls).

    Genotypes distribution (% and counts) in European and Japanese case and controls groups
     RRRXXX
    European cases (n=522)0,370 (193)0,500 (261)0,130 (68)
    European controls (n=718)0,372 (267)0,450 (323)0,178 (128)
    Japanese cases (n=74)0,270 (20)0,527 (39)0,203 (15)
    Japanese controls (n=395)0,220 (87)0,463 (183)0,316 (125)

    Significant differences in ACTN3 rs1815739 genotype frequencies were found between cases and controls in the European sample (Fisher’s Exact Test, p=0,048). The XX genotype was underrepresented in the cases (odds ratio (OR)=0.69; 95% confidence interval (CI), 0.50-0.95, P=0.021) in comparison with controls. The same trend has been showed between cases and controls in the Japanese population (OR = 0.55; 95% CI, 0.30-1.006, P = 0.05). The XX ACTN3 rs1815739 seems to protect against ACL rupture in three European and Japanese cohorts.

    V. Pushkarev: None. N. Kikuchi: None. H. Kumagai: None. N. Kamiya: None. E. Miyamoto-Mikami: None. N. Fuku: None. C. Calò: None. M. Massidda: None. D. Dyatlov: None. E. Bykov: None. P. Cieszczyk: None.

    E-P04.05 Congenital contractural arachnodactyly syndrome in Polish family with c.4216T/c variant in FBN2 gene.

    M. A. Malarska, H. Moczulska, K. Antosik, P. Jakiel, P. M. Pachniak, M. Borowiec

    Department of Clinical Genetics, Lodz, Poland

    The congenital contractural arachnodactyly (CCA, Beals syndrome, OMIM: 121050) is an autosomal dominant condition including contractures, crumpled ears, arachnodactyly, dolichostenomelia, scoliosis and pectus deformities. The congenital contractural arachnodactyly has overlapping features with the Marfan syndrome. Both syndromes result from mutations in genes from the fibrillin family, FBN1 and FBN2 respectively. We identified the c.4216T>C variant in the FBN2 gene in a Polish family with the congenital contractural arachnodactyly. The variation in phenotypic expression was high in the family. In some subjects there was only an arachnodactyly, but in others there were many features like severe kyphoscoliosis with dolichostenomelia, arachnodactyly, camptodactyly, talipes equinovarus and ureteropelvic junction obstruction. We found for the first time a hydronephrosis in the congenital contractural arachnodactyly syndrome. There were no crupled ear in the analysed family. The c.4216T>C variant had been previously found in a Chinese family with modest family variation in phenotypic expression. Our observation confirms the relationship between c.4216T>C variant in the FBN2 gene and the congenital contractural arachnodactyly.

    M.A. Malarska: None. H. Moczulska: None. K. Antosik: None. P. Jakiel: None. P.M. Pachniak: None. M. Borowiec: None.

    E-P04.06 ISSAID and EMQN best practice guidelines for gene panel based diagnosis of autoinflammatory diseases

    Y. Shinar1, I. Ceccherini2, D. Rowczenio3, I. Aksentijevich4, J. Arostegui5,6, E. Ben-Chétrit7, G. Boursier8, M. Gattorno9, H. Hayrapetyan10, H. Ida11, N. Kanazawa12, H. J. Lachmann3, A. Mensa-Vilaro5, R. Nishikomori11, C. Oberkanins13, L. Obici14, O. Ohara15, S. Ozen16, T. Sarkisian17, K. Sheils18, N. Wolstenholme18, E. Zonneveld-Huijssoon19, I. Touitou20, M. E. van Gijn19

    1Sheba Medical Center, Ramat Gan, Israel, 2IRCCS Istituto Giannina Gaslini, Genova, Italy, 3UCL Medical School, London, United Kingdom, 4National Human Genome Research Institute, Bethesda, MD, United States, 5Hospital Clínic, Barcelona, Spain, 6Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Barcelona, Spain, 7Hadassah-Hebrew University Medical Center, Jerusalem, Israel, 8CHU Montpellier, Univ Montpellier, Montpellier, France, 9IRCCS G. Gaslini, Genova, Italy, 10Center of Medical Genetics and Primary Health Care, Yerevan State Medical University, Yerevan, Armenia, 11Kurume University School of Medicine, Kurume, Japan, 12Wakayama Medical University, Wakayama, Japan, 13ViennaLab Diagnostics, Vienna, Austria, 14Fondazione IRCCS Policlinico San Matteo, Pavia, Italy, 15Kazusa DNA Research Institute, Kisarazu, Japan, 16Hacettepe University, Ankara, Turkey, 17Center of Medical Genetics and Primary health Care, Yerevan State Medical University, Yerevan, Armenia, 18European Molecular Quality Network (EMQN), Manchester Centre for Genomic Medicine, St Mary’s Hospital, Manchester, United Kingdom, 19University of Groningen, University Medical Center Groningen, Groningen, Netherlands, 20INSERM, Montpellier, France

    Introduction: A growing number of monogenic autoinflammatory diseases (AIDs) has been identified since 1997. Their clinical diagnosis remains a challenge in face of overlapping inflammatory symptoms. The previous guidelines for genetic testing of AIDs were limited to Sanger based diagnosis of four prototypic recurrent fevers (MEFV, MVK, TNFRSF1A, and NLRP3 genes). Revised guidelines employing next generation sequencing (NGS) are needed to improve diagnosis and precision of AIDs treatment.

    Methods: Based on a survey regarding gene scope and available methodology in AIDs laboratories (Rowczenio et al, 2019), and on annotation of AIDs gene variants by experts’ consensus (van Gijn et al, 2018; Infevers data base), a draft of recommendations was written by European Molecular Genetics Quality Network members. The recommendations were discussed by a panel of experts of the International Society for Systemic AIDs (ISSAID) during a consensus meeting.

    Results: Four additional disease genes are recommended for the core screen of auto-inflammatory diseases (ADA2, NOD2, PSTPIP1, and TNFAIP3). The initial screen, either a single gene or panel screen is oriented by the clinical autoinflammatory suspicion. In overt cases complementary methods to identify large deletions or insertions (i.e. copy number variation) or search for somatic mosaicism are recommended. A genotype table based on the 5-category variant pathogenicity classification with distinction between rare/novel or common variants of unknown significance, and consideration of dose effect, provides the clinical significance of prototypic genotypes per gene and disease.

    Conclusions: These guidelines will improve the practice of AIDs diagnosis provided by the medical community. E-Rare-3 grant 9003037603.

    Y. Shinar: None. I. Ceccherini: None. D. Rowczenio: None. I. Aksentijevich: None. J. Arostegui: None. E. Ben-Chétrit: None. G. Boursier: None. M. Gattorno: None. H. Hayrapetyan: None. H. Ida: None. N. Kanazawa: None. H.J. Lachmann: None. A. Mensa-Vilaro: None. R. Nishikomori: None. C. Oberkanins: None. L. Obici: None. O. Ohara: None. S. Ozen: None. T. Sarkisian: None. K. Sheils: None. N. Wolstenholme: None. E. Zonneveld-Huijssoon: None. I. Touitou: None. M.E. van Gijn: None.

    E-P04.08 TGDS pathogenic variants cause Catel-Manzke syndrome without Manzke dysostosis

    F. Boschann1, K. Stuurman2, C. de Bruin3, M. van Slegtenhorst2, H. van Duyvenvoorde4, S. Kant2,4, N. Ehmke1

    1Charité-Universitaetsmedizin Berlin, Berlin, Germany, 2Department of Clinical Genetics, Erasmus MC, University Medical Center Rotterdam, Rotterdam, Netherlands, 3Department of Pediatric Endocrinology, Leiden Uni, Rotterdam, Netherlands, 4Department of Clinical Genetics, Leiden University Medical Center, Leiden, Netherlands

    Introduction: Catel-Manzke syndrome, also known as micrognathia-digital-syndrome, is characterized by the combination of the two cardinal features Pierre-Robin sequence (with or without cleft palate) and bilateral hyperphalangism. Hyperphalangism is caused by an accessory ossification center in the second metacarpo-phalangeal joint leading to radial deviation and ulnar clinodactyly of the index fingers. Individuals without one of the two major hallmarks or with additional hand malformations have been described as atypical or Catel-Manzke-like syndrome. Biallelic pathogenic variants in TGDS have been described in nine individuals including one fetus with Catel-Manzke syndrome.

    Material and methods: We performed trio exome sequencing in two individuals who presented with disproportionate short stature, micrognathia as well as mild bilateral radial deviation and ulnar clinodactyly of the index fingers, but without radiological signs of hyperphalangism.

    Results: We found known pathogenic variants in TGDS in both individuals. The two individuals described here are the first with confirmed TGDS pathogenic variants who present with almost normal hand radiographs and therefore do not show one of the clinical hallmarks of Catel-Manzke syndrome. In addition, disproportionate short stature has not been described as a feature of Catel-Manzke syndrome.

    Conclusion: Our findings extend the phenotypic spectrum of Catel-Manzke syndrome. TGDS-associated Catel-Manzke syndrome should be considered in individuals with mild ulnar clinodactyly and radial deviation of the index fingers even without radiological evidence of hyperphalangism.

    F. Boschann: None. K. Stuurman: None. C. de Bruin: None. M. van Slegtenhorst: None. H. van Duyvenvoorde: None. S. Kant: None. N. Ehmke: None.

    E-P04.09 A novel pathogenic variant in the CLDN10 gene associated with HELIX syndrome

    M. C. Martínez-Romero1,2,3, M. Barreda-Sánchez1,3, M. E. Pérez-Tomás1, M. J. Ballesta-Martínez1,2,3, V. López-González1,4,2, M. J. Sánchez-Soler1,2,3, A. T. Serrano-Antón1,2,4, L. Rodríguez-Peña1, M. E. Hernández1, T. Martínez-Menchón1,4, P. Sánchez-Pedreño1,4, G. Glover1,2, P. Carbonell1,2, V. Cabello-Chaves5, Grupo de Investigación Español de Displasias Ectodérmicas, E. Guillén-Navarro1,2,4

    1Sección de Genética Molecular (Centro de Bioquímica y Genética Clínica), Sección de Genética Médica (Servicio de Pediatría), Servicio de Medicina Interna y Servicio de Dermatología. Hospital Clínico Universitario Virgen de la Arrixaca. Instituto Murcia, Murcia, Spain, 2CIBERER, Centro de Investigación Biomédica en Red de Enfermedades Raras, Instituto de Salud Carlos III, Madrid, Spain, 3Cátedra de Genética Médica. UCAM- Universidad Católica de Murcia, Murcia, Spain, 4Departamentos de Pediatría y Dermatología. Facultad de Medicina. UMU-Universidad de Murcia, Murcia, Spain, 5Servicio de Nefrología. Hospital Universitario Virgen del Rocío, Sevilla, Spain

    Introduction: HELIX syndrome (OMIM#617671) is an autosomal recessive genetic disorder, described in 2017, characterized by hypohidrosis, electrolyte imbalance, lacrimal glands dysfunction, ichthyosis, and xerostomia; and associated with pathogenic variants in CLDN10 gene that encodes a member of claudins proteins (integral membrane components of tight junction). So far, only 4 families have been reported.

    Materials and methods: Subjects. Two Spanish adult brothers (41/38 years old) born to consanguineous parents presenting with a long history of hypohidrosis, dry skin, alacrimia and xerostomia, diagnosed as ectodermal dysplasia (ED). Complementary exams showed renal loss of NaCl with secondary hyperaldosteronism, hypercalcemia, hypermagnesemia and hypokalemia. Genetic analysis. CLDN10 gene was designed with Primer3 software for all coding exons. Sanger sequencing was performed using BigDye terminator (Life-Technologies), analysed in ABI3130 Genetic Analyser (Applied-Biosystems) and aligned with human reference genome GRCh37/hg19; the identified variant was segregated in progenitors.

    Results: The sequence analysis revealed a frameshift genetic variant in CLDN10 (NM_006984.4): c.322_329del8/p.Gly108fs, in exon 2, in homozygosity in both affected brothers and in heterozygosity in parents. This variant, not previously described, was found in a highly conserved region by in silico prediction software, being categorized as pathogenic.

    Conclusions: 1. A new CLDN10A pathogenic variant associated to HELIX syndrome in the first Spanish affected family is described, supporting the implication of this gene in this rare disorder.2. Clinical manifestations such as lacrimal dysfunction, xerostomia and electrolyte imbalance in suspected ED without specific molecular diagnosis are the clue for HELIX syndrome.

    This project has been funded by ISCIII-Madrid-Spain-FEDER (PI/14/01259 and PI/17/00796) and AADE.

    M.C. Martínez-Romero: None. M. Barreda-Sánchez: None. M.E. Pérez-Tomás: None. M.J. Ballesta-Martínez: None. V. López-González: None. M.J. Sánchez-Soler: None. A.T. Serrano-Antón: None. L. Rodríguez-Peña: None. M.E. Hernández: None. T. Martínez-Menchón: None. P. Sánchez-Pedreño: None. G. Glover: None. P. Carbonell: None. V. Cabello-Chaves: None. E. Guillén-Navarro: None.

    E-P04.10 Identification a novel mutation of LTBP4 gene in a patient with congenital cutis laxa: a case report

    M. Mazaheri1,2, M. yavari3, R. Mirjalili2, A. Razavi3

    1Shahid Sadoughi University of Medical Sciences, Yazd, Iran, Islamic Republic of, 2Mother and Newborn Health Research Center Shahid Sadoughi University of Medical Sciences, Yazd, IRAN., Yazd, Iran, Islamic Republic of, 3Dr. Mazaheri’s Medical Genetics lab Yazd, IRAN., Yazd, Iran, Islamic Republic of

    Normal 0 false false false EN-US X-NONE FA /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Cutis laxa is a rare disorder characterized by degenerative changes in elastic fibres. Congenital cutis laxa is more common than acquired cutis laxa. The recessively inherited form is severe and more frequent. Cutis laxa affects all races and both the sexes equally. LTBP4, an extracellular protein that is closely related to fibrillins, consists of epidermal growth factor-like domains interspersed with four 8-cys domains (including a hybrid domain). The third 8-cys domain covalently binds the small latent TGFβ1 complex. A proline -rich hinge region provides exibility to the protein. The N-terminus of LTBP4 binds to the microibrillar structures. A 4-month-old full term normally delivered neonate was referred with complaints of respiratory distress from his birth. Physical examination revealed laxity of the skin and heart problem and swelling around the eyes. Length, weight, and head circumference percentiles at birth were 55cm, 4100 gr and 36m respectively. whole- exome sequencing test was done for the patient. The results showed a novel homozygous mutation (c.533-1G>A) in exon 6 of the LTBP4 gene. After this observation we perform the Sanger sequencing for his parents. As a result, his parents have a heterozygous mutation in the same gene and same location. This finding can be useful in genetic counseling of cutis laxa in this family.

    M. Mazaheri: None. M. yavari: None. R. Mirjalili: None. A. Razavi: None.

    E-P04.11 Analysis of xenobiotics biotransformation and DNA repair genes as factors of etiology and pathogenesisin children with congenital spine deformities

    S. Khalchitsky1, M. Sogoyan1, S. Vissarionov1, A. Dmitriev2

    1The Turner Scientific Research Institute for Children`s Orthopedics, Saint-Petersburg, Russian Federation, 2Institute of Experimental Medicine, Saint-Petersburg, Russian Federation

    Introduction: Spine congenital curvatures formed as a result of anomalies in the development of vertebral bodies leads to severe and rigid deformities of the spinal column in the adolescent age and are often accompanied by irreversible neurologic disorders. There for genetic markers study of the congenital malformations is an important and urgent task.

    Materials and methods: The study of 200 children with congenital spine deformities (CSD) and 96 healthy children without pathology of the spine was carried out. Molecular diagnostics was carried out by analysis of multiple polymorphic regions in the genes of detoxification and DNA repair. Genotyping of the gene polymorphism was performed using polymerase chain reaction.

    Results: The polymorphisms of the genes CYP1A2, GSTM1, GSTT1, GSTP1, NAT2, XRCC1, XRCC3 and their frequency distribution among patients with CSD and control group were investigated. Significant differences in the distribution of genotypes compared with the control group were found in the polymorphic regions of the genes CYP1A2, GSTM1, GSTT1, NAT2, XRCC3. However, in the GSTP1 and XRCC1 genes, no significant differences between the CSD patients and the control group was observed.

    Conclusions: All patients with congenital spine deformities had significant changes in some candidate genes alleles. It was found that the number of minor alleles in the genes under investigation correlate with the severity of congenital deformity and the variability of vertebral anomalies. It was determined that in children with combined defects in the spine development, there is a greater number of mutations compared to children with isolated vertebral anomalies.

    S. Khalchitsky: None. M. Sogoyan: None. S. Vissarionov: None. A. Dmitriev: None.

    E-P04.12 Another family with compound heterozygosity for variants in MYH3

    A. P. Vasconcelos1, F. Ayala2, I. Alonso3,4, M. Leão1

    1Department of Medical Genetics, Centro Hospitalar Universitário São João, Porto, Portugal, 2Department of Medical Genetics, Universidade Estadual de Campinas, Campinas, Brazil, 3IBMC - Institute for Molecular and Cell Biology, i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Porto, Portugal, 4Genetyca-ICM, Instituto de Estudos Celulares e Moleculares, Porto, Portugal

    Contractures, pterygia, and variable skeletal fusions syndrome 1B (CPSKF1B) (OMIM #618469) is an autosomal recessive disorder, characterized by contractures of proximal and distal joints, multiple pterygia involving the neck, elbows, fingers, and/or knees, and variable vertebral, carpal and tarsal fusions, firstly described by Cameron-Christie et al. All those patients, displaying remarkable phenotypic variability, were compound heterozygous for variants in the MYH3 gene (Cameron-Christie et al., 2018). We describe an 11 years-old male patient, born from non-consanguineous parents, with no relevant family history, whose phenotype was consistent with CPSKF1B, including arthrogryposis of the hips, knees and elbows, multiple pterygia, severe scoliosis and vertebral fusions at cervical, dorsal, lumbar and lumbosacral levels. At the age of 9 there was no radiological evidence of carpal synostosis. Additionally, he has triangular shaped face, low-set ears, bilateral down slanted palpebral fissures, ptosis, and micrognatia. Genetic analysis identified three heterozygous variants in MYH3 [NM_002470.3: c.5072del,p.(Ala1691Valfs*52) in exon 35; c.749G>A,p.(Arg250Gln) and c.787G>T,p.(Asp263Tyr) in the same allele in exon 9]. Genetic testing of his parents identified the first of these variants in the mother and the others in the father, suggesting an autosomal recessive pattern of inheritance. Our patient presents several dysmorphic features not previously reported by Cameron-Christie et al. References:CAMERON-CHRISTIE, S. R., WELLS, C. F., SIMON, M., WESSELS, M., TANG, C. Z., WEI, W., TAKEI, R., AARTS-TESSELAAR, C., SANDARADURA, S. & SILLENCE, D. O. 2018. Recessive Spondylocarpotarsal synostosis syndrome due to compound heterozygosity for variants in MYH3. The American Journal of Human Genetics, 102, 1115-1125.

    A.P. Vasconcelos: None. F. Ayala: None. I. Alonso: None. M. Leão: None.

    E-P04.13 Case report: cellular interference highlights an unusual X-linked mode of inheritance and seemingly genetic paradox in craniofrontonasal dysplasia

    J. Ronez, S. Morlot, B. Schlegelberger, H. Wallaschek

    Department of Human Genetics, Hannover Medical School, Hannover, Germany

    Introduction: craniofrontonasal dysplasia is a rare form of frontonasal dysplasia caused by mutations in the EFNB1 gene on the X chromosome. EFNB1 encodes for ephrin-B1, a transmembrane ligand of the EphB receptor with crucial roles in cell migration and pattern formation during skeletal development. The phenotype is more pronounced in females, who characteristically present with frontonasal dysplasia and coronar craniosynostosis, while the manifestation in males is usually milder, often only characterized by hypertelorism.

    Case report: We, here, present an 11-week-old girl who presented with dysmorphic facies. Leading characteristics were plagiocephaly, hypertelorism, a cleft palate, slanted eyes, dysplastic ears and a broad nasal bridge. Molecular genetic analyses of the girl revealed a pathogenic de novo nonsense variant in the EFNB1 gene, which triggers nonsense mediated decay.

    Background: Females with a heterozygous mutation in the EFNB1 gene usually display a more severe phenotype than hemizygous males. The embryonal X-inactivation leads to a heterogenic population of cells either expressing the mutated or the wildtype allele, disrupting the correct formation of boundaries within the frontal bone precursors during embryogenesis. Hemizygous males display a homogenous cell population, since no functional ephrin-B1 can be produced at all, in which case other ephrin-B family members are likely to compensate by assuming ephrin-B1 function.

    Conclusion: Due to cellular interference, craniofrontonasal dysplasia does not follow a classic Mendelian mode of inheritance. Our case report is a good example for this mechanism and highlights the need to be aware of such unusual modes of inheritance in genetic counselling.

    J. Ronez: None. S. Morlot: None. B. Schlegelberger: None. H. Wallaschek: None.

    E-P04.15 Heterozygous 7q32.3-q35 deletion causes syndromic craniosynostosis

    E. Bukowska-Olech1, D. Simon2, D. Larysz3, A. Jamsheer1,2

    1Department of Medical Genetics, Poznan University of Medical Sciences, Poznan, Poland, 2Centers for Medical Genetics GENESIS, Poznan, Poland, 3Department of Radiotherapy, The Maria Skłodowska Curie Memorial Cancer Centre and Institute of Oncology, Gliwice Branch, Gliwice, Poland, Gliwice, Poland

    Background: The most commonly recognisable syndromes with craniosynostosis (CS) are regarded as monogenic disorders and result from different pathogenic variants affecting genes, that encode fibroblast growth factor receptors (FGFRs) such as FGFR1, FGFR2, and FGFR3. However, a couple of studies have also pointed to copy number variations (CNVs) as molecular causes of syndromic CS.

    Materials and methods: The female patient with psychomotor delay, intellectual disability and multiple CS and her healthy parents were subjected to standard karyotyping analysis. Next, we have implemented array comparative genomic hybridisation (array CGH) for the proband (SurePrint G3 Human CGH Microarray 4×180; Agilent Technologies), followed by microarray-based genes expression profiling (one-color SurePrint G3 Unrestricted GE 8x60K microarray; Agilent Technologies).

    Results: Karyotyping analysis revealed a heterozygous deletion on chromosome 7 (der7). Furthermore, with the use of array CGH, we have shown, that the aberration was 12.782 Mb in size and mapped to locus 7q32.3-q35 (HG19 – chr7:131521826-144304164). The CNV encompassed 143 genes including the BRAF, that encodes B-Raf. B-raf belongs to one of the molecules involved in RAS/MAPK pathway.

    Conclusion: Our finding supports the contribution of CNVs to syndromic CS development. We also pointed to the existing interaction between RAS and FGFs signaling cascades and conclude that dysregulation of those intracellular pathways may give rise to CS. Finally, we strongly suggest screening of RAS-associated genes in patients with Noonan-like syndrome and skull abnormalities. This work was supported by the grant from the Polish National Science Centre, Poland UMO-2016/23/N/NZ5/02577 to Ewelina Bukowska-Olech.

    E. Bukowska-Olech: None. D. Simon: None. D. Larysz: None. A. Jamsheer: None.

    E-P04.16 Genetic risk factors for hip dysplasia

    K. K. Jacobsen1, L. B. Laborie2,3, H. Kristensen4,5, A. Schäfer4, T. Gundersen6,7, T. Zayats8,9, K. Rosendahl10,11

    1Department of Orthopedic Surgery, Helse Førde, Førde, Norway, 2Department of Radiology, Helse Bergen, Bergen, Norway, 3Helse Vest, Bergen, Norway, 4Department of Pediatrics, Helse Førde, Førde, Norway, 5Department of Clinical Science, Universtity of Bergen, Bergen, Norway, 6Department of Orthopedic Surgery, Helse Bergen, Bergen, Norway, 7Department of Clinical Medicine, University of Bergen, Bergen, Norway, 8Massachusetts General Hospital, Boston, MA, United States, 9Stanley Center for Psychiatric Research, Harvard/MIT, Boston, MA, United States, 10Department of Radiology, University Hospital of North Norway, Tromsø, Norway, 11Department of Clinical Medicine, University of Tromsø, Tromsø, Norway

    Introduction: Developmental dysplasia of the hip (DDH) is a congenital condition affecting 2-3% of all infants (1). DDH increases the risk of osteoarthritis and is the cause of 30% of all total hip arthroplasties in adults < 40 years of age (2). We aim to explore the genetic background of DDH in order to improve diagnosis and personaliz treatment.

    Materials and method: We conducted a structured PubMed-search and added selected studies from our archives. A total of 66 papers were included for detailed review. In addition, we are conducting a heritability analysis in the Norwegian Twin Registry using Falconer’s method.

    Results: The results of the heritability analyses will be presented at the conference. Similar studies have found a heritability of ~80%. The literature review revealed that the majority of published papers on the genetics of DDH were mostly underpowered for detection of any association. One large genome wide association study has been published, establishing GDF5 as a plausible risk factor. This study found a single nucleotide polymorphism-based heritability of 55%, however GDF5 only explains ~1.5% (3).

    Conclusion: DDH is known to be congenital and heritable, with family occurrence of DDH already included as a risk factor in most screening programs. Despite this, high quality genetic research is scarce, and no genetic risk factors have been soundly established, prompting the need for more research.

    (1) Rosendahl et al, 1996, Pediatric Radiology (2) Engesæter et al, 2011, Acta Orthopaedica (3) Hatzikotoulas et al, 2018, Communications Biology

    Grants: Helse Vest (F-12550-D11544)

    K.K. Jacobsen: None. L.B. Laborie: None. H. Kristensen: None. A. Schäfer: None. T. Gundersen: None. T. Zayats: None. K. Rosendahl: None.

    E-P04.17 Ectodermal Dysplasia Type 4: Phenotype-Genotype Correlation

    A. Ozaydin1, G. Gencebay2, A. Kalayci Yigin1, M. T. Alay1, M. Seven1

    1Department of Medical Genetics, Cerrahpasa Medical Faculty, Istanbul University-Cerrahpasa, Istanbul, Turkey, 2Department of Skin and Venereal Diseases, Cerrahpasa Medical Faculty, Istanbul University-Cerrahpasa, Istanbul, Turkey

    Introduction: Ectodermal dysplasia is a rare hereditary disease that is characterized by elliptical nodules located on the hair shaft. Fragile hair fibers are found in the temporal and occipital region, resulting in alopecia. Patients are usually normal at birth, but the hair becomes fragile in the first few months of life. In severe cases, eyebrows, eyelashes, and other body hairs may also be affected. The disease can be isolated to the scalp, and may be accompanied by tooth and nail disorders. Ectodermal dysplasia is generally caused by mutations in KRT81, KRT83, KRT85 and KRT86 genes.

    Clinical Findings and Method: In the physical examination of mother and her three children; localized alopecia, brittle hair-body hair and nail dystrophy were detected and ectodermal dysplasia was considered. DNA was isolated from peripheral blood samples of mother and her children. Due to the pre-diagnosis of ectodermal dysplasia clinical exom analysis was performed in the KRT gene family.

    Result: As a result of the analysis, the change of c.G565A (p.D189N) in exon 2 of KRT85 gene in mother and her children was detected as heterozygous and confirmed by Sanger sequencing. This change was evaluated according to the American College of Medical Genetics criteria and compared with genetic databases.

    Conclusion: As a result of the evaluation, it is considered as a variant of unknown clinical significance (VUS) and as a pathological variant in silico databases.

    A. Ozaydin: None. G. Gencebay: None. A. Kalayci Yigin: None. M.T. Alay: None. M. Seven: None.

    E-P04.18 A case of Classical and concomitant Periodontal Ehlers-Danlos syndrome

    F. Stock1, M. R. Hanisch2, S. Lechner3, S. Biskup3, A. Bohring1

    1Institut für Humangenetik, Universitätsklinikum Münster, Münster, Germany, 2Klinik für Mund-, Kiefer- und Gesichtschirurgie, Universitätsklinikum Münster, Münster, Germany, 3Praxis für Humangenetik Tübingen, Tübingen, Germany

    Ehlers-Danlos syndrome (EDS) is a generic term for a clinically and genetically heterogeneous group of connective tissue disorders. According to the clinical picture and underlying genetic mutation 13 subtypes are distinguished. We saw our proband as a five year old girl with severe periodontitis and premature loss of several teeth. Moreover she displayed a short stature, joint hypermobility, chronic pain, recurrent luxation of knee caps, flat feet, a soft and hyperelastic skin with multiple subcutaneous papules, easy bruising, and pretibial hyperpigmentation. Due to those signs and symptoms EDS was suspected and genetic testing brought about. NGS analysis of 44 connective tissue-related genes revealed a pathogenic frameshift mutation in COL5A1, confirming the diagnosis Classical EDS. This diagnosis was consistent with the proband’s joint and skin related phenotype, yet did not explain her severe dental phenotype. As the dental status was highly suggestive of periodontal EDS, analysis of the underlying genes C1R and C1S was performed. The detection of a pathogenic missense mutation in C1R confirmed the additional diagnosis periodontal EDS. Analysis of the parents showed the COL5A1 mutation being maternally inherited whereas the C1R mutation occured de novo. Our patient’s mother experienced many signs of Classical EDS already in her childhood, yet this diagnosis was never suspected in her before it was confirmed in her daughter. To our knowledge, this is the first reported case of Classical and Periodontal Ehlers-Danlos Syndrome in one single person.

    F. Stock: None. M.R. Hanisch: None. S. Lechner: None. S. Biskup: None. A. Bohring: None.

    E-P04.19 Role of TANGO1 gene in hypermobile type of Ehlers-Danlos syndrome

    A. Junkiert-Czarnecka, M. Pilarska-Deltow, A. Bak, M. Heise, O. Haus

    Department of Clinical Genetics Nicolaus Copernicus University, Bydgoszcz, Poland

    Introduction: Hypermobile Ehlers-Danlos syndrome (hEDS) is a non-inflammatory, autosomal connective tissue disorder. It is perhaps the most common hereditary connective tissue disorder with a prevalence estimate at about 1/5000. hEDS unlike other types of EDS, has no known genetic etiology. One of disfunctions in hEDS patients’ cells is impaired transport of extracellular matrix proteins from cells to intercellular space. Protein taking part in this process is TANGO1 encoded by TANGO1 gene. The aim of study is a sequencing analysis of TANGO1 gene and also the evaluation of the potential role of detected variants in these gene on their role in the etiology of the hypermobile type of Ehlers-Danlos syndrome.

    Methods: The study was carried out in a group of 100 patients with hypermobile type of Ehlers-Danlos syndrome. Control group consisted of 100 persons from general population. Sequencing analysis of gene TANGO1 was performed using Sanger sequencing technique. Results Among 100 hEDS patients in two c.1099A>T (p.Thr367Ser) variant and in next three patients c.2637C>A (p.Asp879Glu) variant were detected. All patients were not mutation carriers of other connective tissue protein coding genes (previous study). According to ACMG guideline variants were evaluated as VUS.

    Conclusion: This study is the next small step in the recognition and understanding of the complex picture of hEDS. Analysis of genes encoding of ECM protein carrier may be a new approach to evaluate genetic background of hypermobile type of Ehlers-Danlos syndrome. This investigation was financed by grant of National Science Centre Poland (2018/29/N/NZ5/00345).

    A. Junkiert-Czarnecka: None. M. Pilarska-Deltow: None. A. Bak: None. M. Heise: None. O. Haus: None.

    E-P04.20 Skeletal dysplasia in the era of genomic testing: first experience of a single genetic outpatient clinic from Serbia

    M. Mijovic1, J. Ruml Stojanovic1, A. Miletic1, B. Bosankic1, H. Janeski1, B. Peterlin2, A. Maver2, G. Cuturilo1,3

    1University Children’s Hospital, Department of Clinical Genetics, Belgrade, Serbia, 2Clinical Institute of Medical Genetics, University Medical Centre Ljubljana, Ljubljana, Slovenia, 3Faculty of Medicine, University of Belgrade, Belgrade, Serbia

    Introduction: Skeletal dysplasia are very heterogeneous group of genetic disorders, for which in most cases genomic testing (NGS technology) is the first-choice method in genetic testing. We want to present our diagnostic rate, distribution of frequencies between subgroups from classification of skeletal dysplasia and we try to give an answer about impact of diagnosis.

    Materials and methods: We present our results for pediatric patients with different skeletal dysplasia who were first assessed in genetic outpatient clinic at Department of Clinical Genetics, University Children’s Hospital in Belgrade and referred for diagnostic whole exome sequencing (WES), from 2015 to 2019. WES was performed for all 51 patients.

    Results: Causative gene variants were identified in 38 patients (74.5%, n=38/51). We have diagnosed patient(s) with Otopalatodigital Spectrum Disorder, Dyggve-Melchior-Clausen syndrome, Immuno-osseus dysplasia Schimke type, Acromesomelic dysplasia, Spondyloepimetaphyseal displasia with joint laxity type 2, Osteogenesis imperfecta, Osteopetrosis autosomal recessive type 1, Hypochondroplasia, Mucolypidosis type IV, Mucopolisaccharidosis type IIIA, Craniofrontonasal dysplasia, Oculo-dento-digital dysplasia, Crouzon syndrome, Craniosynostosis type 3, Short sature - brachydactyly - intellectual developmental disabilities - seizures syndrome, 3MC syndrome, Trichorhinophalangeal syndrome and other rare skeletal disorders. In seven cases we performed prenatal diagnosis.

    Conclusion: To what extent early genomic diagnosis prevents additional unnecessary diagnostics and the opportunity for anticipatory guidance-related management in patients with skeletal dysplasia? We tried to answer this question based on the first experiences in our single genetic outpatient clinic. This study represent the pilot study with an aim to establish the multidisciplinary skeletal dysplasia Center.

    M. Mijovic: None. J. Ruml Stojanovic: None. A. Miletic: None. B. Bosankic: None. H. Janeski: None. B. Peterlin: None. A. Maver: None. G. Cuturilo: None.

    E-P04.21 Identification of rare mutation in ext 2 gene among patients with multiple hereditary exostoses

    A. Yakovleva, A. Danilova, M. Savvina, D. Petukhova, A. Sukhomyasova, N. Maksimova

    North-Eastern Federal University, Yakutsk, Russian Federation

    Multiple hereditary exostoses (MHE) is an autosomal dominant hereditary disorder and the prevalence in various populations ranges is estimated from 1-2 per 100 thousand people or 1 in 7000 orthopedic patients. According to data obtained from the “register of hereditary and congenital pathology of the republic of Sakha (Yakutia)” 80 patients and their relatives from different ethnic groups were registered. Genetic analysis was conducted for 65 patients with MHE and their relatives from 30 unrelated families. Next-generation sequencing (NGS) and Sanger sequencing methods were used. The EXT2 gene from a patient with MHE was sequenced using NGS method. The analysis revealed nonsense mutation c.751>T (p.Gln251*) in exon 5 of EXT2 gene in heterozygous condition and it also were confirmed in the rest 79 patients and their relatives by the Sanger’s sequencing method. This mutation was found and confirmed in 16 patients from four families with MHE. Thus, for the first time in the Republic of Sakha (Yakutia), a molecular genetic study of the EXT2 gene was performed in patients with MHE and their relatives. A rare nonsense mutation c.751C> T (NM_001178083) was detected in exon 5 of the EXT2 gene, which leads to the replacement of the coding codon with a stop codon at the 251 position of the protein (p.Gln251 *, NP_001171554). In the future, the diagnostic of this mutation can be included in the program of genetic testing for medical and genetic counseling. The research is supported by the project FSRG-2020-0014 “Genomic of Arctic: epidemiology, hereditary and pathology”

    A. Yakovleva: None. A. Danilova: None. M. Savvina: None. D. Petukhova: None. A. Sukhomyasova: None. N. Maksimova: None.

    E-P04.22 Mosaicism in the PHEX gene. Is it more common than we thought?

    J. Fortuño1, M. Oliva1, I. Royo1, M. Flores1, A. Torrents1, F. Martínez2, N. Pérez2, C. Camprubí1

    1Reference Laboratory, L’Hospitalet de Llobregat, Spain, 2Hospital Universitario Nuestra Señora de Candelaria, Santa Cruz de Tenerife, Spain

    Introduction: Familial X-linked hypophosphatemic rickets (XLHR) is defined as a group of disorders characterized by rickets with bone deformities, short stature, dental anomalies, hypophosphatemia and increased activity of serum alkaline phosphatases. According to the bibliography, pathogenic variants in the PHEX gene are the most common cause of XLHR and only a few cases of mosaicism have been described worldwide. We present two unrelated Canary Islands (Spain) family cases referred with XLHR clinical suspicion in whom mosaic variants have been identified.

    Materials and methods: Genomic DNA was isolated from EDTA blood using a standard protocol. Next Generation Sequencing (NGS) was used to analyse PHEX gene in the probands. Sanger sequencing was used to perform the study in the mother’s proband.

    Results: In one family, a nonsense pathogenic variant (p.Gln394Ter) was found in mosaicism in the proband. In the other family, the proband was hemizygous for a missense variant of uncertain significance (VUS) (p.Ala267Glu). The family analysis reveals that his unaffected mother was mosaic.

    Conclusions: To our knowledge, the identified cases are the first families with mosaic variants in PHEX gene reported in Spain. In the genetic counselling context, the “recurrence” of mosaicism in PHEX gene, emphasize to consider unaffected males as possible mosaic carriers. The advantage of performing PHEX gene analysis by NGS is noteworthy: it allows detection of mosaic variants with high sensibility and reliability, as well as it enables discarding aneuploidy, for example a possible Klinefelter karyotype.

    J. Fortuño: None. M. Oliva: None. I. Royo: None. M. Flores: None. A. Torrents: None. F. Martínez: None. N. Pérez: None. C. Camprubí: None.

    E-P04.23 Agenesis of corpus callosum - a new phenotypic aspect in fibrodysplasia ossificans progressiva?

    N. Meier, N. Knoll, S. Kleiner, M. Ritthaler, E. Wohlleber, J. Kohlhase

    SYNLAB MVZ Humangenetik Freiburg GmbH, Freiburg, Germany

    Introduction: Mutations in ACVR1 cause fibrodysplasia ossificans progressiva (FOP). The classical clinical feature of FOP is progressive heterotopic ossification, but affected individuals often display first toe and thumb malformations. We report on a one year old patient with motor development delay, corpus callosum agenesis, bilateral hand deformities, hypospadias and bilateral agenesis of the first toes. Smith-Lemli-Opitz syndrome had been suspected as the cause for limb malformations and hypospadias, and the child was referred to genetics in order to rule out or to confirm this diagnosis.

    Material and Methods: normal results for 7-dehydrocholesterol levels made Smith-Lemli-Opitz syndrome unlikely, and we suspected a submicroscopic chromosomal anomaly or an unknown syndrome as the underlying cause. We performed karyotyping and CGH, which revealed normal results, followed by whole exome sequencing (WES).

    Results: WES detected a heterozygous de novo variant in ACVR1: c.1067G>A, p.G356D. A literature search showed that patients with absent first toes and mild brain abnormalities were previously reported in FOP, but agenesis of the corpus callosum had not yet been observed. Furthermore, hypospadias was reported once in an atypical case of FOP.

    Conclusions: The combination of first toe anomalies, especially agenesis of first toes, in combination with hypospadias and brain malformations may be the clinical presentation of FOP before the characteristic heterotopic ossifications appear. Agenesis of corpus callosum may be part of the phenotypic spectrum of FOP. The diagnosis of FOP prior to the first heterotopic ossification can lead to an improved clinical management to prevent early heterotopic ossifications in the child.

    N. Meier: None. N. Knoll: None. S. Kleiner: None. M. Ritthaler: None. E. Wohlleber: None. J. Kohlhase: None.

    E-P04.24 GDF5 clinical and molecular spectrum: expanding current knowledge on genotype-phenotype correlations

    D. Guadagnolo1, M. Genovesi1, E. Marchionni1, S. Bernardo1, A. Giovannetti2, N. Panzironi1, A. Traversa2, F. Di Palma1, G. Mastromoro1, P. Palumbo3, M. Carella3, T. Mazza4, V. Caputo1, A. Pizzuti1

    1Department of Experimental Medicine, Sapienza University of Rome, Italy, Rome, Italy, 2Laboratory of Clinical Genomics, Fondazione IRCCS Casa Sollievo della Sofferenza, San Giovanni Rotondo, Italy, 3Laboratory of Medical Genetics, Fondazione IRCCS Casa Sollievo della Sofferenza, Rome, Italy, 4Laboratory of Bioinformatics, Fondazione IRCCS Casa Sollievo della Sofferenza, San Giovanni Rotondo, Italy

    Introduction: Brachydactyly is a bone development abnormality presenting with variable phenotype and different transmission patterns. Mutations in GDF5 (growth/differentiation factor 5, MIM: 601146) gene account for a significant amount of cases. A 3-generation family showing isolated brachydactyly was studied. The proband and his grandfather showed features of C and A1 brachydactyly types, his mother showed only subtle signs.

    Materials and methods: Whole Exome Sequencing (WES) was performed on the two affected individuals. An in-depth analysis of GDF5 genotype-phenotype correlations was performed through literature reviewing and retrieving information from several databases to elucidate GDF5 related molecular pathogenic mechanisms.

    Results: WES analysis disclosed a known pathogenic variant in GDF5 (NM_000557.4:c.157dupC), segregating with the phenotype. The frameshift variant was previously associated with Brachydactyly type C in heterozygosis and the severe Grebe chondrodysplasia in homozygosis. We extended and updated the spectrum of GDF5 genotype-phenotype correlations. In total, fifty pathogenic mutations were associated with nine clinical phenotypes and autosomal dominant and recessive transmissions even for the same phenotype. Presentations range from severe defects in limb morphogenesis to conditions with redundant ossification. We propose that this clinical gradient can be linked to a continuum of GDF5-activity variation, with variable loss of GDF5-activity underlying bone development defects, and gain-of-function mutations causing disorders with excessive bone formation.

    Conclusions: Our in-depth analysis on GDF5 pathogenicity mechanisms furtherly supports that mutation and zygosity backgrounds resulting in the same level of GDF5 activity may lead to similar phenotypes. This information can aid in interpreting new variants and promote appropriate genetic counselling.

    D. Guadagnolo: None. M. Genovesi: None. E. Marchionni: None. S. Bernardo: None. A. Giovannetti: None. N. Panzironi: None. A. Traversa: None. F. Di Palma: None. G. Mastromoro: None. P. Palumbo: None. M. Carella: None. T. Mazza: None. V. Caputo: None. A. Pizzuti: None.

    E-P04.25 Identification and characterization of a GLMN splice site variant in a three-generation-family with glomuvenous malformations

    D. Skowronek1, M. Hebebrand2, R. Erber3, A. Agaimy3, C. Zweier2, U. Felbor1, M. Rath1

    1Department of Human Genetics, University Medicine Greifswald, and Interfaculty Institute of Genetics and Functional Genomics, University of Greifswald, Greifswald, Germany, 2Institute of Human Genetics, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany, 3Institute of Pathology, University Hospital Erlangen, Comprehensive Cancer Center Erlangen-EMN, Friedrich-Alexander University Erlangen-Nürnberg (FAU), Erlangen, Germany

    Introduction: Glomuvenous malformations (GVMs) are painful vascular lesions with distended venous lumina that are surrounded by multiple layers of smooth-muscle-like glomus cells. Familial GVMs (OMIM: 138000) are inherited in an autosomal dominant manner and associated with loss-of-function germline variants in the GLMN gene.

    Material and Methods: We here describe the natural history of GVM disease in a three-generation family and report on the identification and characterization of a GLMN splice site mutation by NGS gene panel sequencing and transcript analysis.

    Results: At first clinical examination, the 16-year-old male index patient presented multiple, sharply defined bluish papules on various locations. His 35-year-old mother had approximately ten papules clustering on her back and his 7-year-old maternal half-sister presented with two bluish papules on her neck. The index patient’s maternal aunt and grandfather were also reported to have one or two bluish spots each. Using NGS gene panel sequencing, we identified the heterozygous splice site variant c.1299+1G>A in the GLMN gene of the index case which had not been reported in the literature before. Heterozygosity for the substitution at the donor splice site of exon 14 was also shown for the index patient’s mother and maternal half-sister. A GLMN transcript analysis finally verified that this variant causes out-of-frame skipping of exon 14. Following the latest ACMG guidelines for variant interpretation, it was classified as pathogenic for autosomal dominant GVM.

    Conclusion: The three-generation-family reported here is a testimony for the variable expressivity of GVMs, best explained by Knudson’s two-hit model.

    D. Skowronek: None. M. Hebebrand: None. R. Erber: None. A. Agaimy: None. C. Zweier: None. U. Felbor: None. M. Rath: None.

    E-P04.26 Identification of novel candidate genes for the hypermobile type of Ehlers-Danlos Syndrome

    T. I. Kadurina1, L. R. Lonishin2, E. A. Serebryakova1,3, L. N. Abbakumova4, A. S. Glotov3

    1North-Western State Medical University named after I.I. Mechnikov, St. Petersburg, Russian Federation, 2Peter the Great St. Petersburg Polytechnic University, St. Petersburg, Russian Federation, 3D.O. Ott Research Institute of Obstetrics, Gynecology and Reproductology, St. Petersburg, Russian Federation, 4Saint-Petersburg State Pediatric Medical University, Russia, St. Petersburg, Russian Federation

    Introduction: There has been valuable progress in the use of different molecular diagnostic technologies to clarify the classification of the hypermobile type of Ehlers-Danlos Syndrome (hEDS). Diagnosis of hEDS is only based on clinical criteria, due to the absence of an identified gene and a protein, thus the main objective was to identify possible molecular genetic causes of hEDS development.

    Materials and methods: For research, genomic DNA samples of unrelated patients with hEDS were used (9 females and 23 males). In all cases, the diagnosis was established by international recommendations for 2017 EDS. Whole-exome sequencing was performed on a HiSeq2500. Assessment of the pathogenicity of the identified variants was based on the recommendations of ACMG and Sherloc on the interpretation of data obtained by the next-generation sequencing method.

    Results: As a result of the pathogenicity assessment, 7 pathogenic and 5 probably pathogenic variants were identified in the encoding regions of the ABCA4, ABCC9, CBS, CCDC8, FIG4, GJB2, HGD, KRT14, LMNA, MEFV, PROM1, RYR1, SLC26A2 and USH2A genes in the heterozygous state. Also, 15 genes were selected with variants of unknown clinical significance based on data on protein expression and high specificity of physical interactions among themselves that may be involved in the development of hEDS.

    Conclusions: Considering the results of the study, we cannot exclude that the genes we identified may have a pathogenic effect, forming the hEDS phenotype. The research was partly supported by project 558-2019-0012 (№АААА-А19-119021290033-1) of FSBSI «D.O. Ott Research Institute of Obstetrics, Gynaecology and Reproductology».

    T.I. Kadurina: None. L.R. Lonishin: None. E.A. Serebryakova: None. L.N. Abbakumova: None. A.S. Glotov: None.

    E-P04.27 Genotype-phenotype correlations in hereditary multiple exostoses

    I. Akalin1, K. Kurosawa2, B. Yeter3, E. Akbas4, G. Nishimura5, W. Wuyts6, N. H. Elcioglu3

    1Istanbul Medeniyet University, Faculty of Medicine, Department of Medical Genetics, Istanbul, Turkey, 2Kanagawa Children’s Medical Center, Department of Medical Genetics, Yokohoma, Japan, 3Marmara University, Faculty of Medicine, Department of Pediatric Genetics, Istanbul, Turkey, 4Istanbul Medeniyet University, Faculty of Medicine, Istanbul, Turkey, 5Center for Intractable Diseases, Saitama Medical University Hospital, Saitama, Japan, 6Department of Respiratory Diseases, University Hospitals Leuven, Leuven, Belgium

    Hereditary Multiple Exostoses (HME) is a complex hereditary musculoskeletal disorder diagnosed at either pediatric or adult age. HME is characterized by progressive exophytic osseous projections that form next to the growth plates of many skeletal elements, including long bones, ribs and vertebrae. In addition to pain and functional problems particular forehand deformities are main complaints of the patients in the clinics that the treatment is restricted to surgical excision of the lesions. The main complication is development of osteochondromas. Mutations in EXT1 or EXT2 genes that encode glycosyltransferases are responsible for the disease and represented locus heterogeneity. Nonetheless, genotype-phenotype interventions are still important we presented 20 HME cases among 9 families and discussed genotype-phenotype correlations. This project has been founded by The Scientific And Technological Research Council Of Turkey (TUBITAK; Project #217S675)

    I. Akalin: None. K. Kurosawa: None. B. Yeter: None. E. Akbas: None. G. Nishimura: None. W. Wuyts: None. N.H. Elcioglu: None.

    E-P04.28 Recurrent bone pain - more than tumors and inflammation

    M. M. Khelifa1, S. V. Hardenberg1, B. Auber1, B. Schlegelberger1, S. Mukodzi2, J. Wiens2, A. K. Bergmann1

    1Medizinische Hochschule Hannover, Hannover, Germany, 2Klinikum Wolfsburg, Wolfsburg, Germany

    Hyperostosis-hyperphosphatemia syndrome (HHS) and hyperphosphatemic familial tumoral calcinosis (HFTC) are the clinical manifestations of a rare autosomal recessive disease caused by the inactivation of the fibroblast growth factor 23 (FGF23), Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) or Klotho genes, which in turn leads to an elevated blood phosphate level resulting mainly from an excessive proximal renal tubular phosphate reabsorption. We report the case of a 5-year-old female of healthy non-consanguineous parents of German and Italian descent. She initially presented with recurrent lower leg pain. Bone biopsy was inconclusive, as well as infectious work-up. Imaging identified a diaphyseal sclerosis and hyperostosis of the ribs. Hyperphosphatemia was observed. Thus, panel diagnostics of the genes FGF23, GALNT3 and KL was performed. Two heterozygous variants in GALNT3 (NM_004482.3) were identified, one previously undescribed missense variant c.782G>A p.(Arg261Gln), classified as a variant of uncertain significance. Protein-modeling of this variant suggested the disruption of GALNT3 activity, leading to an increased inactivation of the phosphaturic hormone FGF23 causing HHS/HFTC. The second variant c.803dupC p.(Thr269Asnfs*3) was previously described in a HHS/HFTC patient and classified as likely pathogenic (ACMG guidelines). In HHS/HFTC, no genotype-phenotype correlation was described so far, and suggested treatment regimes are heterogeneous. Thus, in addition to the detailed case, we present an overview of genotype-phenotype correlation and a collection of follow-up descriptions of disease courses on patients reported before 2015. In conclusion, we aim to raise awareness of HHS/HFTC as a syndrome presenting primary with bone pain and radiographic changes.

    M.M. Khelifa: None. S.V. Hardenberg: None. B. Auber: None. B. Schlegelberger: None. S. Mukodzi: None. J. Wiens: None. A.K. Bergmann: None.

    EN-P04.29 Clinical and genealogical characteristics of hereditary forms of ichthyosis in the Republic of Sakha (Yakutia)

    V. M. Sofronova, A. L. Sukhomyasova, N. R. Maksimova

    North-Eastern Federal University, Yakutsk, Russian Federation

    Introduction: Hereditary ichthyosis is common name for many dry and scaly skin disorders ranging in frequency from common to very rare. Clinical genealogical analysis of hereditary forms of ichthyosis (from 1989 to 2018) are conducted in the Republic of Sakha (Yakutia), Russia.

    Materials and methods: Data was collected from the genetic history of patients of the “Republican Genetic Register of Hereditary and Congenital Pathology of the Republic of Sakha (Yakutia)” of the Medical Genetics Center of the Republican hospital №1 “National center of medicine”.

    Results: The number of patients with ichthyosis is 126 patients (104 families) according to the genetic register of Yakutia according to date of 2018. The frequency of ichthyosis was about 1/7675, prevalence is 13,0 to 100 000. Gender: 94 men (74.6%), 32 women (25.4%). Ethnicity: Yakut - 109 (86.5%), Russian - 17 (13.5%). In four families affected patients of both genders and in ten cases only males. All patients had dryness, peeling of the skin. In some cases, more severe symptoms were noted in the form of pityriasis peeling, follicular keratosis. The manifestation varied from birth to adolescence.

    Conclusions: It is difficult to establish the type of inheritance and further medical and genetic counseling because of genetic heterogeneity and the similarity of the clinical features of ichthyosis. Thus, there is a strong need in a highly specific diagnostic method and in-depth research study for precise diagnosis, treatment and prevention of these diseases. Project: FSRG-2020-0014 “Genomics of Arctics: epidemiology, hereditary and pathology”

    V.M. Sofronova: None. A.L. Sukhomyasova: None. N.R. Maksimova: None.

    E-P04.31 Jeune Syndrome with a novel DYNC2H1 mutation

    N. H. Elcioglu1, B. Yeter1, J. Y. Xue2, Z. Wang2, L. Guo2, G. Nishimura3, S. Ikegawa2

    1Department of Pediatric Genetics, Marmara University Medical School, Istanbul, Turkey, 2Laboratory of Bone and Joint Diseases, Center for Integrative Medical Sciences, RIKEN, Tokyo, Japan, 3Center for Intractable Diseases, Saitama Medical University Hospital, Saitama, Japan

    Jeune Asphyxiating Thoracic Dystrophy(OMIM%208500,ATD, Short-rib thoracic dysplasia with or without polydactyly) is an autosomal recessive skeletal dysplasia characterized by short stature and pulmonary hypoplasia secondary to the small thoracic cage. Polydactyly, glomerular sclerosis, biliary dysgenesis, hirshprung disease, retinal dysplasia and cardiac defects are the other findings. Here, we will a male patient who was diagnosed as Jeune syndrome at the age of 3 month-old. He was born to a 28 years old G3P3L3 mother by ceserean section with a birth weight of 2685 g at 36 weeks of gestation. His birth length was 44.5 cm, head circumference was 35 cm. He was hospitalized in a newborn intensive care unit for 3 months due to respiratory distress. Except that the parents were far blood related there was no particular familial history. In his last follow-up at the age of 4.5 years, his measurements were weight:14kg(-1.9 sds), height:97cm(-2.4 sds), HC:50cm(10-25p). The patient had a narrow thorax and pectus carinatum. On the radiographs, horizontal and short ribs, hypoplastic iliac wings and horizontal acetabulum were detected. Mild sleep apnea was defined in polysomnography. A novel homozygous missense mutation c.G6439T in the DYNC2H1 gene was detected on exome sequencing for the etiologicall cause. Jeune syndrome is a genetically heterogeneous disease nearly forty genes have been identified and defined as ciliopathy. There may be slight to moderate short stature although respiratory difficulties eventuate in all survivors. Moreover, laboratory evaluation of urine/blood, abdominal US, spirometry and ophtalmological exam should be recommended for renal, hepatic and eye involvement

    N.H. Elcioglu: None. B. Yeter: None. J.Y. Xue: None. Z. Wang: None. L. Guo: None. G. Nishimura: None. S. Ikegawa: None.

    E-P04.33 Severe osteoporosis in Larsen syndrome: genetic and bone morphological investigations - a case report

    T. M. Juul1,2, C. Ejersted3, L. Folkestad2,3, K. Brusgaard1,2, S. Hansen4,5, C. M. Andreasen6, L. K. Thomsen6, J. S. Thomsen7, T. L. Andersen2,7,8, A. L. Frederiksen1,2,9

    1Dept. of Clinical Genetics, Odense University Hospital, Odense, Denmark, 2Dept. of Clinical Research, Faculty of Health, University of Southern Denmark, Odense, Denmark, 3Dept. of Endocrinology M, Odense University Hospital, Odense, Denmark, 4Dept. of Medicine, Hospital of South West, Esbjerg, Denmark, 5Dept. of Regional Health Research, University of Southern Denmark, Odense, Denmark, 6Clinical Cell Biology, Dept. of Pathology, Odense University Hospital, Odense, Denmark, 7Dept. of Biomedicine, Aarhus University, Aarhus, Denmark, 8Dept. of Forensic Medicine, Aarhus University Hospital, Aarhus, Denmark, 9Dept. of Clinical Genetics, Aalborg University Hospital, Aalborg, Denmark

    Introduction: Larsen syndrome is a genetic condition characterized by facial dysmorphology and skeletal deformities. The syndrome has a dominant inheritance and is caused by heterozygous pathogenic variants in the Filamin B encoding gene (FLNB). FLNB is an essential cytoskeletal protein which is thought to play a key role in bone morphogenesis. However, the skeletal phenotype of Larsen syndrome has not yet been characterized in details.

    Materials and methods: A case-study. Two Caucasian women (mother and daughter; age 63 and 33 years) with Larsen syndrome carrying a novel FLNB c.688G>T, p.(Val230Phe) variant were included. A bone morphologic evaluation was performed including DXA-scanning and high-resolution peripheral quantitative tomography (HR-pQCT scan) evaluating their bone microstructure. Furthermore, an iliac crest bone biopsy from the mother was evaluated by µCT.

    Results: Both women showed signs of severe osteoporosis. The HR-pQCT scan showed a low estimated bone strength and volume density as well as decreased trabecular number compared to data from a population-based group of Danish women. The µCT analysis of the bone biopsy showed similar trabecular changes. The porosity of the cortical bone was found to be normal or decreased in both the HR-pQCT and the µCT analysis.

    Conclusions: Our findings include an early onset of severe osteoporosis, which is likely due to structural changes in the trabecular bone compartment. On the other hand, the cortical bone compartment shows no osteoporotic characteristics. This highlights that the investigated FLNB variant may have a very different effect on the trabecular and cortical compartments.

    T.M. Juul: None. C. Ejersted: None. L. Folkestad: None. K. Brusgaard: None. S. Hansen: None. C.M. Andreasen: None. L.K. Thomsen: None. J.S. Thomsen: None. T.L. Andersen: None. A.L. Frederiksen: None.

    E-P04.35 Maffucci syndrome-like manifestations deciphered as a compound heterozygote of Gronblad-Strandberg syndrome by exome sequencing.

    A. Ikonomidis1, E. Oikonomidou2, A. Malamidou2, A. Arampatzi2, N. Peroulis2, K. Krapis3, T. Konstantoula3, P. Katsiafiloudis3, A. Papadogoulas3, M. Hatzimichail3, T. Zafeiridis3, E. Neou3, D. Papadopoulos3, P. Papamichalis3, S. Karagiannis3, A. Komnos3, K. Karakousis3, A. Xefteris2

    1Eurogenetica Thessalias, Larissa, Greece, 2Eurogenetica, Thessaloniki, Greece, 3Koutlimpanio General Hospital of Larissa, Larissa, Greece

    Introduction: Exome sequencing is a state of the art technique that may clarify the genotype of complex overlapping phenotypes. We present a case of a female with a typical clinical phenotype of Maffucci syndrome which was finally deciphered as a compound heterozygote of Gronblad-Strandberg syndrome.

    Materials and methods: A 20-year-old female suspected of Maffucci syndrome presented multiple cartilage deformities as well as hemangiomas and lymphangiomas disseminated along her body. Clinical exome sequencing was performed on the DNA extracted from patient’s blood, using Sophia Genetics’ Clinical Exome Solution v2. Following preparations according to the manufacturer’s protocol, DNA libraries were sequenced on an Illumina NextSeq-500 genetic analyser. Data processing, variant calling and pre-classification were conducted by SOPHiA DDM® bioinformatics pipelines.

    Results: The patient carried wild-type isocitrate dehydrogenase 1 (IDH1) and isocitrate dehydrogenase 2 (IDH2) alleles related to Maffucci syndrome. Instead, she was found to be a compound heterozygote for ATP-binding-cassette-subfamily-C-member-6 gene (ABCC6) related to pseudoxanthoma elasticum or Gronblad-Strandberg syndrome. In particular, she carried the pathogenic c.1652T>C (Phe551Ser) mutation and the c.2836C>A (Leu946Ile) mutation which is of debatable pathogenicity.

    Conclusions: Exome sequencing revealed a compound heterozygote with Gronblad-Strandberg syndrome initially suspected to present a case of Maffucci syndrome. Pseudoxanthoma elasticum leads to mineralization of skin, eye, cardiovascular and gastrointestinal systems and commonly present with papules in the skin and/or with angioid streaks of the retina. Thus, in a great extent, the clinical manifestations are in discordance with the underlying genotype which suggests a novel phenotypic manifestation of Gronblad-Strandberg syndrome.

    A. Ikonomidis: None. E. Oikonomidou: None. A. Malamidou: None. A. Arampatzi: None. N. Peroulis: None. K. Krapis: None. T. Konstantoula: None. P. Katsiafiloudis: None. A. Papadogoulas: None. M. Hatzimichail: None. T. Zafeiridis: None. E. Neou: None. D. Papadopoulos: None. P. Papamichalis: None. S. Karagiannis: None. A. Komnos: None. K. Karakousis: None. A. Xefteris: None.

    E-P04.36 A case report of somatic mosaicism for a FBN1 nonsense variant

    A. Schaffer1, L. Huang1, O. Jarinova1, S. Hewson2, R. Aul2, J. McGowan-Jordan1, A. Smith1, L. Bronicki1

    1Department of Genetics, Children’s Hospital of Eastern Ontario, Ottawa, ON, Canada, 2Department of Genetics, Hospital for Sick Children, Toronto, ON, Canada

    Marfan syndrome (MS) is an autosomal dominant disorder caused by mutations in the fibrillin-1 gene (FBN1). It is a connective tissue disorder characterized by a combination of cardiovascular, musculoskeletal, ophthalmic and pulmonary manifestations. The wide clinical variability of this disorder can make its recognition difficult. Diagnosis is usually established based on the defined clinical criteria of the Ghent-2 nosology. Approximately 1800 pathogenic or likely pathogenic variants have been identified in FBN1, the majority of which are specific to a single family, and 25% occurring de novo. Somatic and/or germline mosaicism have been reported in rare cases.

    Here we describe an asymptomatic 50-year-old female who presented for genetic counselling after her two daughters, from different partners, were both diagnosed with MS. A known pathogenic variant, c.1693C>T, p.Arg565* in FBN1 (NM_000138.4), was confirmed in both affected half-siblings. However, targeted Sanger sequencing for this variant was negative in the mother. Repeat testing via Next-Generation-Sequencing (NGS) of FBN1 was offered to the patient.

    NGS analysis of FBN1 revealed the presence of the variant in 9% of the sequencing reads. This is well below the allele frequency expected for a heterozygous germline variant (~50%). Based on the family history, this variant was reported at a mosaic level of 9%.

    These results are consistent with somatic and germline mosaicism in this patient. The recurrence risk for any future offspring is now known to be up to 50%. Additionally, she has been referred to Cardiology and Genetics to assess for any clinical manifestations of MS in herself.

    A. Schaffer: None. L. Huang: None. O. Jarinova: None. S. Hewson: None. R. Aul: None. J. McGowan-Jordan: None. A. Smith: None. L. Bronicki: None.

    E-P04.37 Next Generation Sequencing in Marfan syndrome: rare genetic variants improve genotype phenotype correlation

    N. Marinakis, C. Sofocleous, E. Tsoutsou, D. Veltra, M. Sviggou, J. Traeger-Synodinos, E. Fryssira

    National & Kapodistrian University of Athens, Athens, Greece

    Introduction: Marfan syndrome (MFS) is an autosomal dominant disorder of connective tissue with a prevalence of 1 per 5000 individuals. MFS is characterized by early aortic thoracic dilatations/aneurysms, defects of the skeletal and ocular systems, tall stature, arachnodactyly, pectus excavatum, joint hypermobility and ectopia lentis. Mutations in the Fibrillin-1 gene (FBN1) are the most common cause of MFS. Nevertheless, mutations in other genes (e.g. TGFBR1, FLNA, COL5A1, SLC2A10, ADAMTSL4, CBS, SMAD3, TGFB2, MED12, FBN2, PLOD1, BMPR2 etc.) have also been associated with MFS. New technologies, such as Next Generation Sequencing, contribute to the identification of known and novel mutations in these genes.

    Materials and methods: Clinical information and peripheral blood samples were collected from 25 patients with Marfan or Marfan-like phenotype and heart defects. DNA extraction and Whole Exome Sequencing (WES), analysing approximately 19.000 genes dispersed throughout the genome-were applied.

    Results: WES analysis revealed positive results in 17 patients, accomplishing a diagnostic yield of 68%. Causative alterations included 14 known and novel pathogenic variants in the FBN1 gene, 1 in the FBN2 gene, 1 in the BMPR2 gene and 1 in the SLC2A10 gene.

    Conclusion: WES can support definitive diagnosis in patients with Marfan or Marfan-like phenotypes, contributing to precise prognosis, systematic monitoring, and when appropriate, identification of other family members. NGS supports marked improvement in diagnostic-yield for numerous inherited disorders including Marfan Syndrome, especially in the case of non FBN1 variants. The study was carried out as part of the Erasmus+ project:N-GeneS

    N. Marinakis: None. C. Sofocleous: None. E. Tsoutsou: None. D. Veltra: None. M. Sviggou: None. J. Traeger-Synodinos: None. E. Fryssira: None.

    E-P04.39 A novel pathogenic variant in the CHRNG gene linked to Escobar variant of multiple pterygium syndrome

    H. Kathom1, D. Avdjieva-Tzavella1, T. Delchev1, S. Atemin2,3, T. Todorov3, A. Maver4, B. Peterlin4, V. Mitev2, A. Todorova2,3

    1University paediatric hospital "prof. Ivan Mitev", Sofia, Bulgaria, 2Department of Medical Chemistry and Biochemistry, Medical University Sofia, Sofia, Bulgaria, 3Genetic Medico-Diagnostic Laboratory “Genica”, Sofia, Bulgaria, 4Clinical Institute of Medical Genetics, UMC Ljubljana, Ljubljana, Slovenia

    Introduction: Multiple pterygium syndromes (MPS) comprise a group of multiple congenital anomaly disorders characterized by webbing (pterygia) of the neck, elbows, and/or knees and joint contractures (arthrogryposis)a. The multiple pterygium syndromes are phenotypically and genetically heterogeneous but are traditionally divided into prenatally lethal and nonlethal (Escobar) types. In this report we present a case of Escobar type MPS with novel pathogenic variant in CHRNG.

    Materials and methods: We present a 25 months old girl from fifth pregnancy with complications. She was born small for gestational age with dysmorphic facial features, skeletal abnormalities, arthrogryposis, and hypoplastic labia majora, without typical webbing.

    Results: WES analysis was conducted after negative findings in karyotype, MLPA screening for microdeletions, subtelomeric deletions and duplications, urinary GAGs, NGS for congenital arthrogryposes. Two pathogenic variants were identified in the CHRNG gene, c.241C>T previously reported in homozygous state in patient with a similar clinical picture, and c.1143G>A which has not been previously described.

    Conclusions: Polimalformative syndromes including skeletal defects, and joint contractures, even without the typical webbing, should be tested for Escobar variants of MPS, because standard arthrogryposis gene panels can miss the diagnosis.

    H. Kathom: None. D. Avdjieva-Tzavella: None. T. Delchev: None. S. Atemin: None. T. Todorov: None. A. Maver: None. B. Peterlin: None. V. Mitev: None. A. Todorova: None.

    E-P04.40 Compound heterozygous variant in NBAS as a case of bone fragility by the type of osteogenesis imperfecta

    D. A. Petukhova1, E. Gurinova2, A. Sukhomyasova1,2, N. Maksimova1

    1Research Laboratory “Molecular Medicine and Human Genetics”, Medical Institute, M. K. Ammosov North-Eastern Federal University, Yakutsk, Russian Federation, 2Medical Genetic Center, Republican Hospital №1 – «National Medical Center», Yakutsk, Russian Federation

    Introduction: Biallelic mutations in the NBAS gene have been reported to cause three different clinical signs: short stature with optic nerve atrophy and Pelger-Huët anomaly (SOPH) syndrome, infantile liver failure syndrome 2 (ILFS2) and a combined severe phenotype including both SOPH and ILFS2 features.

    Material and Methods: Here, we describe a case of a 6-year-old Yakut girl who presented with clinical signs of SOPH syndrome, acute liver failure (ALF) and bone fragility by the type of osteogenesis imperfecta (OI). Targeted panel sequencing for 494 genes of connective tissue diseases was performed on our patient. To predict the protein-damaging effects of the suspected pathogenic variations in NBAS, three different software programs were used: Polyphen-2, SIFT, MutationTaster.

    Results: The molecular genetic study revealed the known heterozygous variant c.5741G>A (p.Arg1914His) in 45 exon of NBAS. Also, in 23 exon of NBAS was identified a previously unreported missense heterozygous variant c.2535G>T (p.Trp845Cys). Mutation affect evolutionarily conserved amino acid residues and predicted to be highly damaging.

    Conclusion: Timely health care of patients with such a set of clinical spectrum of SOPH syndrome, ALF and bone fragility can contribute to establishment coordinated multispecialty management of the patient focusing on the health problems issues through childhood.

    Grant: The study is supported by the Ministry Education and Science of Russian Federation (Project No. FSRG-2020-0014 “Genomics of Arctic: epidemiology, hereditary and pathology”).

    D.A. Petukhova: None. E. Gurinova: None. A. Sukhomyasova: None. N. Maksimova: None.

    E-P04.43 Nonsyndromic orofacial clefts - Identifying putative causative genes by CNV analysis of whole exome sequencing data

    S. Hölzel1, N. Ishorst1, C. Greve1, F. Degenhardt1, D. Drichel2, C. Maj3, M. Nothnagel2, J. Y. Hehir-Kwa4, J. A. Veltman4,5, T. Kruse6, H. Reutter1,7, S. Nowak1, C. Carels8,9, I. van Rooij10, K. U. Ludwig1, E. Mangold1

    1Institute of Human Genetics, University of Bonn, School of Medicine and University Hospital Bonn, Bonn, Germany, 2Cologne Center for Genomics, University of Cologne, Cologne, Germany, 3Institute for Genomic Statistics and Bioinformatics, University of Bonn, School of Medicine and University Hospital Bonn, Bonn, Germany, 4Department of Human Genetics, Donders Institute, Radboud University Medical Center, Nijmegen, Netherlands, 5Institute of Genetic Medicine, Newcastle University, Newcastle-upon-Tyne, United Kingdom, 6Department of Orthodontics, University of Cologne, Cologne, Germany, 7Department of Neonatology, Children’s Hospital, University of Bonn, Bonn, Germany, 8Department of Human Genetics, KU Leuven, Leuven, Belgium, 9Orthodontics, University Hospitals KU Leuven, Leuven, Belgium, 10Department for Health Evidence, Radboud Institute for Health Sciences, Radboud university medical center, Nijmegen, Netherlands

    Nonsyndromic cleft lip with/without palate (nsCL/P) and cleft palate only (nsCPO) are frequent congenital malformations with high heritability estimates. Common risk loci explain only some of their heritability. Rare, highly penetrant copy number variations (CNVs) encompassing possible clefting susceptibility genes might partially explain the missing heritability. Aim of this study was to identify such genes by detecting de novo CNVs from whole-exome sequencing (WES) trio data. CNVs were called from WES data of 50 nsCL/P and 43 nsCPO Central European patient/parent trios using XHMM, CoNIFER and EXCAVATOR2. Defining XHMM as primary algorithm we established a filtering pipeline considering sample wide frequency, de novo status, calling intersection (CoNIFER and/or EXCAVATOR2), annotation to RefSeq-genes, overlap with regions of segmental duplications and population frequency. CNVs were validated using qPCR. Three interesting de novo CNVs were identified: A 86kb deletion on Chr8 in an nsCL/P patient, a 16Mb deletion on Chr1 in an nsCPO patient, and an 877kb duplication on Chr2 in an nsCPO patient. Interesting candidate genes at these loci are LHX8, DLX1 and DLX2, all suggested to contribute to craniofacial development: Targeted mutations of Lhx8 in mice lead to an isolated cleft palate. In embryonic mice Dlx1 and Dlx2 are expressed in both the maxillary and the mandibular component of the first pharyngeal arches, and Dlx1/2-/- mutant mice exhibit a cleft palate. Our results indicate that rare highly penetrant CNVs can contribute nsCL/P and nsCPO risk. To achieve more evidence for our findings, replication studies in larger patient/control cohorts are essential.

    S. Hölzel: None. N. Ishorst: None. C. Greve: None. F. Degenhardt: None. D. Drichel: None. C. Maj: None. M. Nothnagel: None. J.Y. Hehir-Kwa: None. J.A. Veltman: None. T. Kruse: None. H. Reutter: None. S. Nowak: None. C. Carels: None. I. van Rooij: None. K.U. Ludwig: None. E. Mangold: None.

    E-P04.44 Glis3 expression in working model murine osteoarthritis

    E. Rothzerg

    University of Western Australia, Perth, Australia

    Osteoarthritis (OA) is characterised by cartilage degradation, hypertrophy and inflammation. Chondrocytes are the only cells normally found in cartilage, producing and maintaining the cartilaginous matrix. Chondrocyte hypertrophy is an essential process required for endochondral ossification in mammals and it is also plays a role in the development of OA. Furthermore, genetic factors have been found to be strong determinants of OA and are likely to operate via chondrocyte function. I previously identified some novel candidate murine genes with a potential role in OA pathophysiology. However, one of the candidate genes, Glis3, has showed a potential by expressed in hypertrophic chondrocytes in OA knee joints obtained from the collaborative cross mouse model, using immunohistochemistry. In conclusion, this study has implicated several molecular mechanism in the pathogenesis of cartilage degeneration, thus improving our understanding of OA and offering potential molecular targets for novel therapeutic approaches.

    E. Rothzerg: None.

    E-P04.47 A novel homozygous SLURP1 variant in a boy with Mal de Meleda born to non-consanguineous parents

    S. B. Gram1,2, J. Blechingberg3, K. Brusgaard1,2, A. Bygum4,2, L. B. Ousager1,2

    1Department of Clinical Genetics, Odense University Hospital, Odense, Denmark, 2Department of Clinical Research, University of Southern Denmark, Odense, Denmark, 3Department of Clinical Genetics, Aarhus University Hospital, Aarhus, Denmark, 4Department of Dermatology and Allergy Centre, Odense University Hospital, Odense, Denmark

    Introduction: Mal de Meleda (MDM) is an autosomal recessive disorder characterized by transgredient hyperkeratosis and erythema of palms and soles with well-demarcated borders. There might also be symptoms as hyperhidrosis, macerations and malodour due to secondary bacterial infections. Associated perioral erythema, brachydactyly, scaly plaques on elbows and knees as well as nail dystrophy has also been described. The disease presents early in childhood and has a progressive cause. MDM is associated with variants in SLURP1. The HGMD database includes 23 different variants in SLURP1 related to MDM or palmoplantar keratoderma.

    Material & methods: A 4-year-old boy presented with an approximately two-year history of erythema, scaling and diffuse, yellowish, transgredient keratoderma of palms and soles. He had associated interdigital macerations, dystrophia of several nails and recurrent fungal and bacterial infections. He was born as the second child of non-consanguineous parents and there was no family history of similar skin disease. The parents were from families living in different regions of Denmark. Genetic testing was performed using a next-generation sequencing-based gene panel targeting 28 genes related to palmoplantar keratoderma.

    Results: A homozygous nonsense variant was identified in SLURP1 (c.259del, p.(Ala87Profs*4)). The variant, predicted to result in a premature stop codon, has not previously been reported. A more distal frameshift variant has, however, been reported as disease-causing supporting interpretation of the variant as likely pathogenic. The parents were heterozygous for the variant.

    Conclusion: We identified a novel homozygous variant in SLURP1 in a Caucasian boy with MDM, who was born to non-consanguineous parents.

    S.B. Gram: None. J. Blechingberg: None. K. Brusgaard: None. A. Bygum: None. L.B. Ousager: None.

    E-P04.49 Molecular genetic diagnostic in skeletal disorders - a Western Romanian delineation

    I. E. Jurca- Simina1,2, A. Chirita-Emandi1,2, N. Andreescu1,2, C. L. Șerban1,3, C. Zimbru1, M. Puiu1,2

    1Center of Genomic Medicine in Victor Babes University of Medicine and Pharmacy, Timisoara, Romania, 2Department of Medical Genetics, Louis Turcanu Emergency Hospital for Children, Timișoara, Romania, 3Functional Sciences Department, University of Medicine and Pharmacy Victor Babes, Timișoara, Romania

    Introduction: Genetic skeletal disorders(GSD) represent a heterogeneous and large group, widening the more the sequencing technology thrives. We aim to contribute by describing the regional Romanian cohort of patients with GSD and their molecular features.

    Methods: The clinical workup was performed for each affected individual. NGS was performed using the Illumina TruSight One (4813 genes) and TruSight Cardio (174 genes) Sequencing Panels on MiSeq Illumina platform, as by amplicon-based approach, but also PCR and Sanger were used.

    Results and discussions: 110 patients with GSD phenotypic component addressed the Genetics department (July 2015–December 2019). 54.55% had confirmed diagnosis, while 30.9% were tested negative for the suspected disorder and 14.55% were not tested. 10% were found with variants of uncertain significance, needing further testing. According to the Mortier’s et al. 2019 revision of nosology and classification of GSD, we have found the following categories of disorders: 25% of patients with overgrowth syndromes with skeletal involvement (Marfan, Loeys-Dietz, Congenital contractural arachnodactyly), 10% with lysosomal storage diseases with skeletal involvement (Mucopolysaccharidosis), 5% with Limb hypoplasia–reduction defects group (Fanconi anemia and Cornelia de Lange), 4% with Osteogenesis imperfecta and decreased bone density, 2% with Brachydactylies with extraskeletal manifestations (Coffin Siris) and unique patients in other several disorders like Spondyloperipheral dysplasia, Atelosteogenesis type 3, Chondroectodermal dysplasia, Asphyxiating thoracic dysplasia, etc.

    Conclusion: Skeletal disorders are rare entities needing proficient clinical and imagistic workup to reach diagnosis. We provide our Center’s diagnostic yields in GSD together with particularities and discussions on our cohort of patients.

    I.E. Jurca- Simina: D. Speakers Bureau/Honoraria (speakers bureau, symposia, and expert witness); Modest; Sanofi. Other; Modest; Sanofi, Takeda. A. Chirita-Emandi: Other; Modest; Sanofi, Takeda. N. Andreescu: Other; Modest; Sanofi, Takeda. C.L. Șerban: None. C. Zimbru: None. M. Puiu: Other; Modest; Sanofi, Takeda.

    E-P04.50 A case report of a patient diagnosed with two skeletal dysplasias: osteogenesis imperfecta and pseudoachondroplasia

    L. Kievisiene1, M. Sukys1, R. Traberg1, R. Simonaityte2, V. Asmoniene1

    1Department of Genetics and Molecular Medicine, Lithuanian University of Health Sciences, Kaunas, Lithuania, 2Department of Pediatric Surgery, Lithuanian University of Health Sciences, Kaunas, Lithuania

    We present a case report of a 7 years old boy, the only child born to a man with osteogenesis imperfecta (OI) and a woman suspected to have pseudoachondroplasia, later on confirmed to have COMP gene pathogenic heterozygous variant (c.1393G>C, p.Gly465Arg). Since birth, patient had seven spontaneous fractures, predominantly in the lower limbs. At the age of seven the patient exhibited disproportionately short-limb short stature with height measured 96 cm; <3rd percentile. The patient had brachydactyly and ligamentous laxity with deformity of the lower limbs. He also had characteristic radiological changes of pseudoachondroplasia: short tubular bones with widened and deformed metaphyses and vertebral anomalies. Dual energy x-ray absorptiometry detected osteoporosis. Next generation sequencing was performed for the patient, OI genes and COMP gene known familial variant were analysed. It confirmed the same pathogenic variant of COMP gene and in COL1A2 gene two heterozygous variants were found (c.2317C>T, p.Pro773Ser and c.2329_2331delCGT, p.Arg777del). The former was considered to be variant of uncertain significance because in silico predictors assessed it as benign, while the latter was assigned to be likely pathogenic because computational predictors assessed it as pathogenic. None of these variants were described in population databases. Both of COL1A2 variants were found in father’s COL1A2 gene, meaning that they locate in the same allele. It remains unclear if these variants are disease-causing since neither of fathers’ family members were affected with OI. Therefore, further sequencing of father’s first-degree family members will be performed to confirm if these variants are truly de novo.

    L. Kievisiene: None. M. Sukys: None. R. Traberg: None. R. Simonaityte: None. V. Asmoniene: None.

    E-P04.51 Further clinical and molecular delineation of spondylocostal dysostosis type 3

    S. L. Schuhmann1, H. Koller2, H. Sticht3, C. Kraus1, M. Krumbiegel1, S. Uebe1, A. Ekici1, A. Reis1, C. T. Thiel1

    1Institute of Human Genetics, Friedrich-Alexander-Universität Erlangen-Nürnberg FAU, Erlangen, Germany, 2Klinikum rechts der Isar, Technische Universität München, Munich, Germany, 3Institute of Biochemistry, Friedrich-Alexander-Universität Erlangen-Nürnberg FAU, Erlangen, Germany

    Spondylocostal dysostosis (SCDO) is a heterogeneous group of rare spine disorders defined by multiple vertebral segmentation defects and rib anomalies. Patients present with shortened trunk in proportion to height and significant scoliosis. Seven subtypes of SCDO have been identified based on deleterious variants in one affected gene each (DLL3, MESP2, LFNG, HES7, TBX6, RIPPLY2, DMRT2), of mostly autosomal recessive inheritance. Most subtypes include only few cases, like SCDO3 (LFNG) where only two affected individuals are reported to date with a total of three variants.

    In a large study on genetic causes of skeletal dysplasia we recognized a 17-year-old individual from healthy consanguineous parents with severe vertebral segmentation defects, rib and further non skeletal anomalies including solitary pelvic kidney, uterine dysgenesis, absence epilepsy and inner ear deafness. Performing WES we identified a homozygous missense variant c.59C>T, p.(Thr20Ile) in LFNG, neither previously described in SCDO3 patients, nor listed in genetic databases. Both parents were heterozygous. The variant is predicted to destabilize a hydrogen bond leading to an impairment of protein function, likewise previously described variants inactivating the protein with altered Notch signaling.

    While the two previously reported cases had isolated skeletal anomalies the here reported individual presented with various additional symptoms. As no other variants were identified neither in the exome nor in CMA we hypothesize that the phenotypic spectrum of this syndrome can be much broader, perhaps depending on the localization and nature of the affected variant, although we cannot exclude a blended phenotype due to an undetected additional variant.

    S.L. Schuhmann: None. H. Koller: None. H. Sticht: None. C. Kraus: None. M. Krumbiegel: None. S. Uebe: None. A. Ekici: None. A. Reis: None. C.T. Thiel: None.

    E-P04.52 First reported case of Steel syndrome in the European population: a novel homozygous mutation in COL27A1

    E. Kritioti1,2,3, A. Theodosiou1, N. Nicolaou2, A. Alexandrou1, I. Papaevripidou1, E. Efstathiou4, V. Christophidou-Anastasiadou5, C. Sismani1,3, G. A. Tanteles2

    1Cytogenetics and Genomics Department, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, 2Clinical Genetics Department, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, 3The Cyprus School of Molecular Medicine, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, 4Pediatric Department, Larnaca General Hospital, Larnaca, Cyprus, 5Clinical Genetics Department, Archbishop Makarios III Medical Centre, Nicosia, Cyprus

    Steel syndrome is an autosomal recessive disorder that primarily affects the skeletal system causing a variety of manifestations. Sixteen individuals with Steel syndrome, mainly Puerto Ricans (11/16), were previously reported to carry bi-allelic mutations in the COL27A1 gene. Here, we present the first patient with Steel syndrome in Europe and the sixth non-Puerto Rican carrying a novel homozygous mutation in COL27A1. The patient is a 4-year-old boy born to non-consanguineous healthy parents, with dysmorphic facial features, absent hip ossification centres, external rotation of both feet, relatively short stature, mild skin syndactyly, short mid phalanges and bilateral sensorineural hearing loss. Whole exome sequencing (WES) revealed a novel homozygous missense variant [chr9.hg:19:g.116982108G>A; c.2409G>A; p.(Gly802Glu)] in COL27A1 (NM_032888.4). The homozygous mutation was confirmed by Sanger sequencing in the proband and carrier status was confirmed in both parents and his unaffected sibling. According to online and in-house minor allele frequency (MAF) databases, this is the first COL27A1 mutation reported in the European population. Additional screening of healthy Greek-Cypriot individuals was thus performed, which did not reveal any additional carriers in the population for the variant in question.

    E. Kritioti: None. A. Theodosiou: None. N. Nicolaou: None. A. Alexandrou: None. I. Papaevripidou: None. E. Efstathiou: None. V. Christophidou-Anastasiadou: None. C. Sismani: None. G.A. Tanteles: None.

    E-P04.53 Platyspondylic dysplasia, Torrance type resembling achondrogenesis type 1A

    M. van den Born1, M. Joosten1, P. Schut1, J. Cornette1, A. van der Hout2, G. Mortier3

    1Erasmus MC, Rotterdam, Netherlands, 2University Medical Centre Groningen, Groningen, Netherlands, 3University of Antwerp, Antwerp, Belgium

    To diagnose a specific lethal skeletal dysplasia purely based on ultrasound data can be quite challenging in a prenatal setting. However, molecular testing of fetal DNA in combination with radiographic evaluation and autopsy post-delivery usually allows the clinician to come up with a specific diagnosis. We report a case of platyspondylic lethal skeletal dysplasia, Torrance type (PLSD-T) that was initially diagnosed as achondrogenesis type 1A. Advanced ultrasound at 20 weeks of gestation showed, in addition to generalized edema, shortened and curved long bones with a thoracic–AC ratio of 0.68. At 29 weeks of gestation a male neonate was born who died directly after birth. Achondrogenesis type 1A was initially suggested based on the ultrasound abnormalities and clinical examination postnatally. Radiographs showed skeletal abnormalities reminiscent of achondrogenesis type 1A: severe micromelia with flared and cupped metaphyses, relatively large head, short ilia and delayed vertebrae ossification. All genes (TRIP11, SLC26A2 and COL2A1) causing the different forms of achondrogenesis (IA;IB;II) were sequenced. In TRIP11, only heterozygosity for a class 3 variant was identified and no variant could be identified on the other allele. However, a class 4 variant p.(lle1 389dup), in COL2A1 was identified in the portion coding for the C-propeptide of type II collagen. This finding led to the diagnosis of PLSD-Torrance type. This case demonstrates the phenotypical overlap between achondrogenesis type 1A and Torrance dysplasia.

    M. van den Born: None. M. Joosten: None. P. Schut: None. J. Cornette: None. A. van der Hout: None. G. Mortier: None.

    E-P04.55 Novel variant in the EZH2 gene causing Weaver syndrome

    E. M. Vaiteniene1, L. Cimbalistiene1,2, G. Zukauskaite1, A. Utkus1

    1Department of Human and Medical Genetics, Institute of Biomedical Sciences, Faculty of Medicine, Vilnius University, Vilnius, Lithuania, 2Centre for Medical Genetics, Vilnius University Hospital Santaros Klinikos, Vilnius, Lithuania

    Background: Overgrowth syndromes frequently share overlapping manifestations and are difficult to diagnose based on clinical features. Accurate diagnosis is important for prognosis and correct tumour surveillance program and can be achieved with next-generation sequencing.

    Results: A 4-year-old girl presenting with excessive growth of prenatal onset, advanced bone age, macrocephaly, development delay, intellectual disability, generalized seizures and peculiar face was referred to our clinic. She was a third child in a healthy non-consanguineous family, born prematurely at 36 weeks gestation with birth weight 3100 g and height 58 cm. Her karyotype revealed interstitial inversion 46,XX, inv(X)(p22;q28) which was inherited from her healthy mother. No pathogenic variants were observed in the NSD1 gene. At the age of 22 years, her height is 195 cm, weight 140 kg; limited shoulder, elbow and wrist movement, kyphosis, hypertrophic soft tissue around knees were observed besides previously mentioned features. Her IQ score is 40. Next-generation sequencing for known overgrowth conditions revealed a novel missense heterozygous EZH2 mutation c.373G>A (NM_004456.4:c.[373G>A];[373=], NP_004447.2:p.(Glu125Lys) within exon 5. Based on 11 in silico tools of pathogenicity prediction detected variant was characterized as pathogenic. In addition to the typical findings of Weaver syndrome, our patient has polythelia, atrial septal defect and lumbar spinal stenosis.

    Conclusion: An increasing number of diagnoses with next-generation sequencing helps to gather more phenotypic information, improve management and surveillance of overgrowth syndromes. This example also highlights the importance of periodic case reviews for patients not diagnosed on initial testing as more information becomes available in the medical literature.

    E.M. Vaiteniene: None. L. Cimbalistiene: None. G. Zukauskaite: None. A. Utkus: None.

    E-P04.56 Novel pathogenic variant in EBP gene is associated to X-linked dominant chondrodysplasia punctata in a female fetus.

    M. N. Laço1,2,3, M. Branco4, M. Joosten5, P. DeKoninck6, E. Galhano4, F. Ramos1,4

    1Medical Genetics Unit, Hospital Pediátrico, Centro Hospitalar e Universitário de Coimbra, Coimbra, Portugal, 2Faculty of Medicine, University of Coimbra, Coimbra, Portugal, 3Faculty of Health Sciences, University of Beira Interior, Covilhã, Portugal, 4Prenatal Diagnosis Center, Maternidade Bissaya Barreto, Centro Hospitalar e Universitário de Coimbra, Coimbra, Portugal, 5Department of Clinical Genetics, Erasmus MC, University Medical Center Rotterdam, Rotterdam, Netherlands, 6Department of Obstetrics and Gynaecology, Erasmus MC, University Medical Center Rotterdam, Rotterdam, Netherlands

    Introduction: X-linked dominant chondrodysplasia punctata (CDPX2) is an inherited condition present almost exclusively in females, characterized by skeletal dysplasia, skin defects and congenital cataracts and caused byheterozygous pathogenic variants in the EBP gene. Prenatal ultrasound diagnosis has been reported in some cases after detection of asymmetric shortening of the long bones with cartilage stippling, representing foci of calcification, usually in the second trimester of pregnancy.

    Materials and methods: A female fetus was diagnosed with asymmetric bilateral short long bones and stippling of the proximal epiphyses of the humerus by prenatal ultrasound examination at 21weeks of gestation. Absence of nasal bones was also observed previously at 13weeks. Amniocentesis was performed for molecular analysis through array CGH and a 531 genes NGS panel for skeletal dysplasia. The pregnancy was terminated at 23weeks of gestation. Fetal gross examination, postnatal X-rays and steroid chromatography in amniotic liquid were performed to assist in the diagnosis.

    Results: The NGS skeletal dysplasia panel identified a de novo heterozygous missense variant c.388G>A p.(Gly130Arg), in the EBP gene. This variant was not reported in the literature nor in gnomAD or other databases and in silico analysis predicts it as likely pathogenic.

    Conclusions: To our knowledge this is a novel EBP pathogenic variant, albeit missense variants changing the same Gly130 have been previously associated to CDPX2. CDPX2 should be a diagnosis to bear in mind when short fetal long bones and stippling are present in second trimester of pregnancy.

    M.N. Laço: None. M. Branco: None. M. Joosten: None. P. DeKoninck: None. E. Galhano: None. F. Ramos: None.

    E-P05 Cardiovascular Disorders

    E-P05.01 A new missense variant in ABCA1 gene, p.Ala2058Gly, in a myocardial infarction patient.

    R. Pan-Lizcano1, L. Nunez1, P. Pinon2, X. Flores2, G. Aldama2, R. Calvino2, N. Blanco-Menendez1, N. Vazquez-Gonzalez3, J. M. Vazquez-Rodriguez3, M. Hermida-Prieto1

    1Cardiology Research Group. Instituto de Investigación Biomédica de A Coruña (INIBIC)-CHUAC-UDC, A Coruña, Spain, 2Department of Cardiology, Complexo Hospitalario Universitario A Coruna (CHUAC)-INIBIC, A Coruña, Spain, A Coruña, Spain, 3Department of Cardiology, Complexo Hospitalario Universitario de A Coruña (CHUAC)-CIBERCV, Instituto de Investigación Biomédica de A Coruña (INIBIC), Universidad de A Coruña (UDC), A Coruña, Spain

    Background: Acute myocardial infarction (AMI) is a complex multifactorial and polygenic disorder that leads the causes of death in Western societies. However, the understanding of the genetic contribution to ischemic heart diseases is very limited. It has been suggested that variants in genes related to pathways involved in atherothrombosis could increase the risk of development cardiac events.

    Methods: Genetic variants in 24 genes which encoded proteins related to pathways involved in atherothrombosis were analyzed by next generation sequencing in 24 patients with AMI. Mutation found was confirmed by Sanger sequencing. Visualization of the mutation using pdb viewer and in silico prediction of the effects produced by the mutation (Mutation Tester, SNAP2, SIFT2, Polyphen, PhD-SNP) were performed.

    Results: In one patient, p.Ala2058Gly was identified in ABCA1 gene that encodes the ATP-binding cassette transporter 1, which is crucial in the initial step of high-density lipoprotein (HDL) formation and in reverse cholesterol transport. All the in silico tools used suggested a pathological role of this variant.

    Conclusion: Our results are in concordance with previously reports that associated different variants in ABCA1 gene with an increased risk of coronary artery disease and ischemic heart disease. Thus, mutations in ABCA1 gene could have a role in the development of AMI. Funding Acknowledgements: This work was supported by a grant from Instituto de Salud Carlos III (PI18/01737) and a non-conditional grant from Abbott Vascular.

    R. Pan-Lizcano: None. L. Nunez: None. P. Pinon: None. X. Flores: None. G. Aldama: None. R. Calvino: None. N. Blanco-Menendez: None. N. Vazquez-Gonzalez: None. J.M. Vazquez-Rodriguez: None. M. Hermida-Prieto: None.

    E-P05.02 VUS or non VUS in ACTA2?

    E. Micaglio1, S. Benedetti2, S. Marelli3, A. G. Pini3, R. Cotugno1, M. M. Monasky1, G. Ciconte1, P. Carrera2, C. Pappone1

    1Arrhythmology and Clinical Electrophysiology, IRCCS Policlinico San Donato, San Donato Milanese, Italy, 2Laboratory of Clinical Molecular Biology and Cytogenetics, IRCCS Ospedale San Raffaele, Milan, Italy, 3Cardiovascular Genetics, IRCCS Policlinico San Donato, San Donato Milanese, Italy

    Many ACTA2 missense variants are associated with aortic dissection but their role is still controversial. We describe a 53 year old male proband with a history of sudden death (maternal grandmother) and thoracic aortic aneurysm in the father. The proband bicycled regularly and experienced aborted cardiac arrest at the age of 52 during a normal daylight activity. ECG showed transient ischemic patterns with increased troponin-T values. A CT scan demonstrated a type A aortic dissection (AD) not involving coronary arteries, surgically corrected without complications. During the follow up, occasional seizures were observed, successfully treated with Levetiracetam. Ajmaline challenge test resulted negative, no arterial tortuosity neither signs of intracranial vessel involvement have been demonstrated by Angio MRI. The proband was studied with NGS including panels for Brugada syndrome, LQTS and AD genes. Only the c.1004C>T (p.Pro335Leu) heterozygous missense variant in the ACTA2 gene was found. Proband’s only daughter is asymptomatic, negative at clinical evaluation and does not carry the paternal variant. No other relatives are available to date. The c.1004C>T (p.Pro335Leu) in the ACTA2 gene is predicted to be “pathogenic” by several bioinformatics tools, but to date its clinical significance is still uncertain. This case suggests the importance to consider clinical history in VUS evaluation for specific conditions. Further studies are required to clarify the role of ACTA2 missense variants in type A aortic dissections.

    E. Micaglio: None. S. Benedetti: None. S. Marelli: None. A.G. Pini: None. R. Cotugno: None. M.M. Monasky: None. G. Ciconte: None. P. Carrera: None. C. Pappone: None.

    E-P05.03 Molecular diagnosis of primary hypoalphalipoproteinemia disease by Next Generation Sequencing

    E. Sevilla, C. Rodríguez Jiménez, J. Sanguino, A. Carazo, V. Fernández-Montaño, I. Rueda-Arenas, F. Arrieta, S. Rodríguez-Nóvoa

    INGEMM, Madrid, Spain

    Introduction: Hypoalphalipoproteinemia primary 2 (# 618463), is generally an autosomal recessive disorder associated with extremely low levels of apoA-I and HDL-C in serum and, in most of the patients, premature atherosclerotic cardiovascular disease, xanthomas and corneal opacities1. Currently, 30 families have been described. This disease is caused by pathogenic variants in APOA1 gene (MIM 107680) that code for the Apolipoprotein A-I (apoA-I), the major structural component of HDL. Herein we report a case of a male with suspicious of hypoalphalipoproteinemia.

    Materials and methods: A 58-year-old woman with xanthomas, corneal clouding and familial history of isquemic cardiopathy, was remitted to our service for genetic testing. The patient had extremely low levels of apoA-I (<16.0 mg/dL) and HDL-C (6 mg/dL) in serum. Genes involved in cholesterol metabolism were analyzed by Next Generation Sequence (NGS) using a customized panel of 411 genes related with metabolic diseases.

    Results: The frameshift mutation APOA1_NM_000039.2:c.85dupC;p.(Gln29Profs*29) was found in homozygosis in the patient resulting a truncated apoA-I. In silico analysis showed damaging and conservation for this variant. Sanger sequencing confirmed the variant found in APOA1.

    Conclusions: This variant c.85dupC;p.(Gln29Profs*29) has been previously described as a cause of ApoA1 deficiency2. ApoA-I deficiency is generally associated with markedly increased risk of atherosclerotic cardiovascular disease. However, in this study we identified a homozygous frameshift mutation of the APOA1 gene as the molecular basis of apoA-I deficiency in a 58-year-old woman without isquemic cardiopathy. A familiar study would be required for a better understanding of this rare disease-causing mutation.

    E. Sevilla: None. C. Rodríguez Jiménez: None. J. Sanguino: None. A. Carazo: None. V. Fernández-Montaño: None. I. Rueda-Arenas: None. F. Arrieta: None. S. Rodríguez-Nóvoa: None.

    E-P05.04 Study functional in APOB in HepG2 from patient with Familial Hypercholesterolemia.

    C. Rodriguez Jimenez1, D. Gómez-Coronado2, J. Sanguino1, E. Sevilla1, A. Carazo1, N. Gallego-Onís1, V. Gómez del Pozo1, F. Arrieta1, S. Rodríguez-Nóvoa1

    1INGEMM, Madrid, Spain, 2Hospital Ramón y Cajal, Madrid, Spain

    Introduction: Familial defective apoB100 (FCHL2, # 144010) is a genetic disorder of LDL metabolism characterized by hypercholesterolemia and premature atherosclerosis. FCHL is caused by heterozygous mutation in the APOB gene. APOB is the ligand for the LDLreceptor and there are some essential residues that are decisive for the APOB-LDL receptor affinity1.

    Materials and methods: A 56-year-old man with raised levels of LDL-c in serum, with family history and premature coronary artery disease. The DNA sample from patient was analysed by NGS using a customized panel METABOL-v2 of 411 genes. LDL isolated from patient and the control were incubated with HepG2 cells. Uptake and binding were measured by flow cytometry in order to determine the impact of APOB variant.

    Results: A variant of unknown significance (VUS) was found in APOB_exon26_ NM_000384.2:c.11401T>A;p.(Ser3801Thr) in silico study showed damaging and conservation. However the LDL isolated of patient had the same impact in uptake and binding in LDLR of HepG2 cells that the LDL isolated of control.

    Conclusions: This variant had conflict in the interpretation of results in ClinVar has been classified as benign and as VUS. It is well known that exon 26 is critical in folding of APOB protein also, in silico analysis reflected impact in the variant. The functional characterization of variant in APOB has allowed us to classify it as benign avoiding the “uncertain significance”.

    References

    1- Miserez, A.R. and Keller, U. (1995) Differences in the phenotypic characteristics of subjects with familial defective apolipoprotein B-100 and familial-hypercholesterolemia. Arterioscler. Thromb. Vasc. Biol,

    C. Rodriguez Jimenez: None. D. Gómez-Coronado: None. J. Sanguino: None. E. Sevilla: None. A. Carazo: None. N. Gallego-Onís: None. V. Gómez del Pozo: None. F. Arrieta: None. S. Rodríguez-Nóvoa: None.

    E-P05.05 Phenotype-genotype correlation in Russian patients with arrhythmogenic right ventricular cardiomyopathy

    A. Shestak1, A. Bukaeva1, O. Blagova2, Y. Lutokhina2, M. Polyak1, S. Dzemeshkevich1, E. Zaklyazminskaya1

    1Petrovsky National Research Center of Surgery, Moscow, Russian Federation, 2The Department of Cardiology of the V.N. Vinogradov Faculty therapeutic clinic, I.M. Sechenov First Moscow State Medical University, Moscow, Russian Federation

    Arrhythmogenic right ventricular cardiomyopathy (ARVС) is an inherited disease leading to fibro-fatty replacement of right ventricle and sudden cardiac death. Identification of mutation(s) in causative genes is one of the major diagnostic criteria of ARVC. Methods: Clinical, instrumental examination, medical and genetic counseling were performed for 70 ARVC probands (mean age 41,9 y.o.). Screening of 16 genes was performed by high-throughput semiconductor sequencing combined with Sanger sequencing. Potential role of genetic variants was evaluated according to ACMG criteria. Mutational spectrum of desmosomal and non-desmosomal genes in ARVC probands was studied in comparison with control group of 46 DCM probands. Results: Definite, borderline or possible ARVC diagnosis based on the Task Force Criteria of 2010 was established for 70 probands. Some patients in our cohort had signs of dilated/restrictive cardiomyopathy (N=17), LVNC (N=10), BrS patterns (N=4). Likely pathogenic genetic variants and VUCSes were identified in 46% of ARVC probands in desmosomal (PKP2, DSG2, DSP, DSC2, JUP) and non-desmosomal (LMNA, SCN5A, MYH7, MYBPC3, TTN, FLNC, LDB3) genes. Mutational spectrum of genes in ARVC probands with a predominance of variants in desmosomal genes (64%) was different from one in the DCM control group. Genetic variants in non-desmosomal genes prevailed in patients with ARVC overlapping phenotypes. Conclusion: Likely pathogenic genetic variants and VUCSes were identified in 46% of ARVC probands. Identification of mutations in desmosomal and non-desmosomal genes in addition to the deep phenotyping results allowed us to study the genetic heterogeneity of ARVC. This work was supported by Russian Science Foundation grant №16-15-10421.

    A. Shestak: None. A. Bukaeva: None. O. Blagova: None. Y. Lutokhina: None. M. Polyak: None. S. Dzemeshkevich: None. E. Zaklyazminskaya: None.

    E-P05.06 Testing the association between ACE ID and MTHFR C667T gene polymorphisms and arterial hypertension in the Caucasian population

    C. Barbarosie1, R. Nica2, O. Aparcioaie1, A. Duca1, P. Apostol3, O. Alexiu-Toma1, I. Radu1, R. Sionel1, M. Toma2, D. Cimponeriu1, S. Nica4

    1Faculty of Biology, University of Bucharest, Bucharest, Romania, 2Central Military University Emergency Hospital "Dr. Carol Davila", Bucharest, Romania, 3Genetic Expert Center, Sante Clinic, Bucharest, Romania, Bucharest, Romania, 4Bucharest Emergency University Hospital, Bucharest, Romania

    Introduction: Genetic polymorphisms of various genes play a significant role in the predisposition for arterial hypertension (AH). The relation between several genes and AH have been investigated in different populations but results were inconsistent and inconclusive. The aim of this study was to evaluate whether polymorphisms in two candidate genes are associated with AH in Romania’s adult Caucasian population.

    Materials and methods: We analysed data from 1660 unrelated Romanian Caucasian subjects (835 with AH and 825 normotensive). The average age of the hypertensive patients and controls were 54.66±4.30 and 47.73±4.05, respectively. The ACE ID and MTHFR C677T polymorphisms were genotyped using PCR based methods. Statistical tests were conducted with StatsDirect. The significance of the differences in observed frequencies of polymorphisms was assessed by chi-squared test (p<0.05). The distribution of the genotypes in all lots respects Hardy Weinberg equilibrium condition.

    Results: Significant associations were detected between HA and the ACE DD (OR=1.44, p=0.0007) and MTHFR TT (OR=1.46, p=0.0009). The ACE D allele was associated with earlier onset of AH in patients with AH (p=0.00005). ACE DD (OR=1.88, p=0.0006), ACE D (OR=1.92, p<0.0001), and MTHFR TT (OR=2.28, p<0.0001) were significantly associated with AH among subjects whose parents also have AH. Smoking subjects with MTHFR TT genotype (OR=1.68, p=0.0004) and those heterozygous (OR=1.46, p=0.0002) or homozygous (OR=1.62, p=0.0005) for ACE D presented higher risk for AH. ACE DD and alcohol consumption predispose to AH (OR=5.6, p=0.0004).

    Conclusions: This study suggests that ACE and MTHFR genes are associated with AH in the studied population.

    C. Barbarosie: None. R. Nica: None. O. Aparcioaie: None. A. Duca: None. P. Apostol: None. O. Alexiu-Toma: None. I. Radu: None. R. Sionel: None. M. Toma: None. D. Cimponeriu: None. S. Nica: None.

    E-P05.08 A novel EMD mutation in patient with dilated cardiomyopathy

    L. Piherova1, P. Melenovska1, V. Baresova1, J. Sovova1, D. Musalkova1, J. Sikora1, H. Hartmannova1, K. Hodanova1, T. Schimerova2, M. Kubanek2, S. Kmoch1

    1RURD, Prague 2, Czech Republic, 2IKEM, Prague 4, Czech Republic

    Emery-Dreifus muscular dystrophy is an inherited degenerative myopathy. One of the earliest manifestation of this disorders are muscle contractures causing joint deformities. Almost all patients with Emery-Dreifuss muscular dystrophy develop abnormalities in heart rhythm, such as atrial fibrillation, bradycardia, syncope, heart failure or an increased risk of sudden death. Among Emery-Dreifuss X-linked myopathy belongs degenerative myopathy caused by mutation in EMD gene. Emerin is a member of the nuclear lamina-associated protein family and with other proteins takes part in membrane anchorage to the cytoskeleton. Emerin is a serine-rich protein and composed of three domains: nucleoplasmic domain, transmembrane domain and short lumenal domain. More than 100 mutations are known in EMD gene but only one in lumenal domain. We present a patient diagnosed with Emery-Dreifuss muscular dystrophy and dilated cardiomyopathy caused by new EMD gene mutation at the luminal domain and its biological consequences. LM201509 NCLG, AZV 15-27682A, SVV-260367, NV19-08-00122

    L. Piherova: None. P. Melenovska: None. V. Baresova: None. J. Sovova: None. D. Musalkova: None. J. Sikora: None. H. Hartmannova: None. K. Hodanova: None. T. Schimerova: None. M. Kubanek: None. S. Kmoch: None.

    E-P05.10 The influence of the circadian genes CLOCK and ARNTL on myocardial infarction

    I. Škrlec1, J. Milić2, R. Steiner3,2

    1Hystology, Genetics, Cellular and Molecular Biology Laboratory, Faculty of Dental Medicine and Health, Josip Juraj Strossmayer University of Osijek, Osijek, Croatia, 2Faculty of Medicine Osijek, Josip Juraj Strossmayer University of Osijek, Osijek, Croatia, 3Clinical Department of Cardiovascular Diseases and Intensive Care, Clinic for Internal Medicine, University Hospital Osijek, Osijek, Croatia

    Introduction: The circadian rhythm regulates various physiological mechanisms, and its disruption can promote many disorders. Many cardiovascular events show morning circadian preferences, such as myocardial infarction (MI), dissection of aortic aneurysms, and stroke. Disturbance of endogenous circadian rhythms enhances the chance of MI, showing that circadian clock genes could have a crucial function in the onset of the disease. It was hypothesized that the polymorphisms of one nucleotide (SNP) in two circadian rhythm genes (CLOCK and ARNTL) could be associated with MI.

    Materials and methods: This case-control study was performed on 1057 participants. The sample included 431 patients (243 males, 188 females) of Croatian origin with non-fatal acute myocardial infarction and 626 participants in the control group without MI. Three SNPs were analyzed in CLOCK (rs13124436, rs6811520, and rs11932595), and three in the ARNTL gene (rs12363415, rs4757144, and rs3789327).

    Results: Statistically significant differences, estimated by the chi-square test, were found in the distribution of alleles and genotypes between MI and no-MI groups of the CLOCK (rs6811520 and rs13124436) and ARNTL (rs3789327 and rs12363415) genes. Some of the tested SNPs were associated with cardiovascular risk factors in MI patients.

    Conclusion: According to the results of the present study, the polymorphisms in the CLOCK and ARNTL genes could be related to MI. Polymorphisms in those clock genes might be an additional risk factor for myocardial infarction. Grant no. FDMZ-2019-IP8

    I. Škrlec: None. J. Milić: None. R. Steiner: None.

    E-P05.12 Genetic components of congenital heart defects in children

    V. Galagan1,2, A. Dorokhina2,1, M. Tsyhankova1, S. Kulbalaieva1, Y. Dudierina2, V. Samilyk2

    1National children’s specialized hospital «OKHMATDYT» of Ministry of Health of Ukraine, The Center of Medical Genetics, Kyiv, Ukraine, 2O.O. Bogomolets’ National Medical University, Kyiv, Ukraine

    Introduction: Among congenital malformations in children the greatest number is taken by defects of the cardiovascular system. According to Ukrainian and foreign researchers, congenital heart defects (CHD) occur at an average frequency of 59-60 per 10000 newborns. The purpose of this study was to determine the frequency of CHD in newborns and genetic components of this pathology in Kyiv.

    Materials and methods: The following methods were used in this work: clinical-genealogical, cytogenetic including cytomolecular (FISH), biochemical (TMS) and conventional clinical and instrumental methods.

    Results: The frequency of isolated CHD in newborns was determined based on medical-genetic counseling (MGC) practice at the Specialized Center of Medical Genetics in Kyiv. In 2018 the frequency was 90 per 10000 live births, in 2019- 93 per 10000. All cases were confirmed by cardiologist-ultrasound-diagnostics at specialized cardiac centers and maternity hospitals. During the study period (2018-2019) the weighted percentage of an isolated CHD was 53% among all congenital malformations in live births in Kyiv. Analysis of genetic components including syndromes of various forms of the CHD (2018-2019), first discovered during MGC, showed that the causes of the CHD were due to chromosomal pathology- 52%, isolated forms- 24%, genetic pathology- 13%, undifferentiated multiple malformations- 11%.

    Conclusions: Every child with a validated form of the CHD should pass the MGC and screening at a specialized genetic institution to eliminate syndromal forms, calculate various genetic risks for the family and prevent them. The mean frequency of isolated CHD in newborns is 92 per 10000 in Kyiv.

    V. Galagan: None. A. Dorokhina: None. M. Tsyhankova: None. S. Kulbalaieva: None. Y. Dudierina: None. V. Samilyk: None.

    E-P05.15 Genomic markers in the determination of long-term risk in patients with stable angina undergoing coronary bypass surgery

    A. Ponasenko, M. Sinitsky, A. Tsepokina, M. Asanov, O. Barbarash

    Research Institute for Complex Issues of Cardiovascular Diseases, Kemerovo, Russian Federation

    Introduction: Cardiovascular mortality in Russian Federation is 57%. It is known that genetic polymorphism play the key role in cardiovascular diseases development. The aim of this research was to determine the most important polymorphic variants of genes involved in five pathogenetic ways of coronary artery atherosclerosis among people from large industrial region.

    Materials and methods: 78 polymorphic variants of 41 genes involved in inflammation, lipid metabolism, endothelial function, blood coagulation and innate immune response were analyzed in 260 coronary artery disease patients with stable angina and 300 healthy donors (control) resident in Kemerovo Region using PCR method.

    Results: It was discovered that coronary artery disease patients from Kemerovo Region are characterized by the difference in genotype frequencies compared to overall European population. Genes of inflammation and endothelial function (NOS3 rs1799983, EDN rs5370 and CRP rs3093077) more contribute to coronary artery disease in resident of large industrial region. Polymorphism in genes of innate immune response (TLR1 rs5743551, IL1F9 rs17659543) and coagulation factor II (rs1799963) can play protective role. APOB, TLR1 and TREM1 associated with increased mortality from cardiovascular diseases; and SELPLG – with high risk of acute cerebrovascular accident development. Genes of lipid and calcium metabolism have no significant contribution in coronary atherosclerosis. This study was supported by basic research project of Research Institute for Complex Issues of Cardiovascular Diseases №0546-2015-0012.

    1. A.

      Ponasenko: None. M. Sinitsky: None. A. Tsepokina: None. M. Asanov: None. O. Barbarash: None.

    E-P05.16 Functional gene analysis indicates shared heritability of coronary heart disease and Alzheimer’s disease

    M. B. Ganev1, D. Serbezov1, L. Balabanski1,2, R. Vazharova2,3, S. Karachanak-Yankova1,4, O. Antonova1, D. Nikolova1, M. Mihaylova1, R. Staneva1, V. Spasova1, V. Damyanova1, D. Nesheva1, Z. Hammoudeh1, S. Hadjidekova1, S. Mehrabian5, M. Petrova5, L. Traykov5, D. Toncheva1,2

    1Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, 2Gynecology and assisted reproduction hospital “Malinov”, Sofia, Bulgaria, 3Department of Biology, Medical genetics and Microbiology, Faculty of Medicine, Sofia University “St. Kliment Ohridski”, Sofia, Bulgaria, 4Department of Genetics, Faculty of Biology, Sofia University “St. Kliment Ohridski”, Sofia, Bulgaria, 5Depatment of Neurology, UH “Alexandrovska”, Medical University of Sofia, Sofia, Bulgaria

    Introduction: Clinical and epidemiological studies have demonstrated a link between Alzheimer’s disease (AD) and high levels of blood lipids such as cholesterol, a common feature of coronary heart disease (CHD), yet the biological mechanisms remain unknown.

    Materials & Methods: Whole-exome sequencing was performed on two DNA pools set up of Alzheimer patients (n=70) and healthy individuals (n=100), respectively. After reads quality filtering, 143,493 genetic variants detected in both pools were annotated. A list of variants associated with CHD was compiled using the publicly available ENSEMBL database (n=1479). We surveyed the pool data for presence of CHD associated variants and selected those present in both pools.

    Results: Of the 92 CHD associated variants detected in our pool data, 24 variants in 22 genes were estimated to have significantly higher frequency in AD patients compared to the healthy individuals (FDR<0.05). Functional analysis was performed on the 22 genes using ToppGene platform. Results indicate lipid metabolism and lipoprotein transport associated pathways to be most significantly overrepresented in AD patients compared to controls.

    Conclusion: The analysis of CHD associated variants in AD patients and healthy controls suggests shared heritability in genes involved in overrepresented lipid pathways.

    Acknowledgment:

    KP-06-N33/5 from 13.12.2019 - National Science Fund of Bulgaria.

    DN 03/7 from 18.12.2016 - National Science Fund of Bulgaria.

    M.B. Ganev: None. D. Serbezov: None. L. Balabanski: None. R. Vazharova: None. S. Karachanak-Yankova: None. O. Antonova: None. D. Nikolova: None. M. Mihaylova: None. R. Staneva: None. V. Spasova: None. V. Damyanova: None. D. Nesheva: None. Z. Hammoudeh: None. S. Hadjidekova: None. S. Mehrabian: None. M. Petrova: None. L. Traykov: None. D. Toncheva: None.

    E-P05.18 A DNA repair pathway polymorphism in angiographically proven coronary artery patients of southern Iran

    M. Bijanzadeh, S. Seyedian, F. Ahmadi, S. Hosseini

    Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, Ahvaz, Iran, Islamic Republic of

    Introduction: Coronary artery disease (CAD) is among the most common causes of death and is based on the interaction between environmental risk factors and predisposing genes. X-ray repair cross-complementing group 1 (XRCC1), a DNA repair protein involved in single-strand breaks (SSBs) and base excision repair (BER) pathways, was reported to be responsible for the efficient repair of single strand breaks and damaged bases in DNA. Arg399Gln (rs25487) is one of the common XRCC1 polymorphisms that might be associated with increased risk for CAD.

    Materials and methods: A case-control study was performed to investigate the relation between this polymorphism and the CAD development. 290 patients and 216 controls were screened for the mentioned SNP by Restriction Fragment Length Polymorphisms (RFLP) method.

    Results: The frequency of the GA genotype of XRCC1 Arg399Gln was significantly higher in CAD patients than in controls (p=0.002, OR: 1.21, 95% CI (1.06-1.37)) and also dominant mode (AA + GA) genotype of XRCC1 Arg399Gln had a 1.851-fold increased risk for CAD (p=0.005).

    Conclusion: Our findings demonstrated that Arg399Gln polymorphism of XRCC1 has a significant relationship and a probable predisposing role in CAD. Our results support the role of DNA damages and the malfunctions of DNA repair system in CAD patients. Introducing of this candidate gene along with other related genetic variants can help the development of early diagnosis and effective interventional strategies that are safe, necessary and individualized for CAD patients. This study (project no. CVRC-9714) was granted by research affairs of Ahvaz Jundishapur University of medical sciences.

    M. Bijanzadeh: None. S. Seyedian: None. F. Ahmadi: None. S. Hosseini: None.

    E-P05.20 The FLNC gene in myopathies and cardiomyopathies

    E. Vanhoutte1, J. Verdonschot1, G. Claes1, A. Helderman-van den Enden1, J. Hoeijmakers1, D. Hellebrekers1, A. de Haan1, I. Christiaans2,3, R. Lekanne-Deprez2, E. van Craenenbroeck4, H. Boen4, B. Loeys4, Y. Hoedemakers3,5, C. Marcelis5, M. Kempers5, E. Brusse6, J. van Waning6, A. Baas7, D. Dooijes8, F. Asselbergs7, D. Barge-Schaapveld9, P. Koopman10, A. van den Wijngaard1, S. Heymans1,11,12, I. Krapels1, H. Brunner1,5

    1Maastricht University Medical Center, Maastricht, Netherlands, 2Amsterdam University Medical Center, Amsterdam, Netherlands, 3University Medical Centre Groningen, Groningen, Netherlands, 4Antwerp University Hospital, Antwerp, Belgium, 5Radboud University Medical Centre, Nijmegen, Netherlands, 6Erasmus MC University Medical Centre, Rotterdam, Netherlands, 7University Medical Center Utrecht, Utrecht, Netherlands, 8University Medical Center Utrecht, Maastricht, Netherlands, 9Leiden University Medical Center, Leiden, Netherlands, 10Heart Center Hasselt, Hasselt, Belgium, 11KU Leuven, Leuven, Belgium, 12The Netherlands Heart Institute, Nl-HI, Utrecht, Netherlands

    Filamin C (FLNC) variants are associated with cardiac and muscular phenotypes. Originally, FLNC variants were described in myofibrillar myopathy (MFM) patients. Later, high-throughput screening in cardiomyopathy cohorts determined a prominent role for FLNC in isolated hypertrophic and dilated cardiomyopathies (HCM and DCM). FLNC variants are now among the more prevalent causes of genetic DCM. FLNC-associated DCM is associated with a malignant clinical course and a high risk of sudden cardiac death. The clinical spectrum of FLNC suggests different pathomechanisms related to variant types and their location in the gene. Proper functioning of FLNC is crucial for structural integrity and cell signaling of the sarcomere. The secondary protein structure of FLNC is critical to ensure this function. Truncating variants with subsequent haploinsufficiency are associated with DCM and cardiac arrhythmias. Interference with the dimerization and folding of the protein leads to aggregate formation detrimental for muscle function, as found in HCM and MFM. Variants associated with HCM are predominantly missense variants which cluster in the ROD2 domain. This domain is important for binding to the sarcomere and ensure proper cell signaling. We here review FLNC genotype-phenotype correlations based on available evidence.

    E. Vanhoutte: None. J. Verdonschot: None. G. Claes: None. A. Helderman-van den Enden: None. J. Hoeijmakers: None. D. Hellebrekers: None. A. de Haan: None. I. Christiaans: None. R. Lekanne-Deprez: None. E. van Craenenbroeck: None. H. Boen: None. B. Loeys: None. Y. Hoedemakers: None. C. Marcelis: None. M. Kempers: None. E. Brusse: None. J. van Waning: None. A. Baas: None. D. Dooijes: None. F. Asselbergs: None. D. Barge-Schaapveld: None. P. Koopman: None. A. van den Wijngaard: None. S. Heymans: None. I. Krapels: None. H. Brunner: None.

    E-P05.21 From genomics data to multiscale simulation - portable pipeline for extracting cardiomyophaty specific parameters

    N. Ilic Raicevic, L. Lenhardt Ackovic, V. Kovacevic, S. Stojanovic, J. Randjelovic, M. Mattioni, A. S. Yavuz, M. Lazarevic, T. Borovski

    Seven Bridges Inc, Boston, MA, United States

    Introduction: Hypertrophic and dilated cardiomyopathy are the most common inherited cardiovascular diseases which lead to increased mortality and morbidity if not diagnosed in early stages. Design and development of new drugs and therapies which would prevent initiation and progression of familial cardiomyopathies is achievable today due to improved simulation methods and genomic data availability. The goal of this study was to establish a portable pipeline for annotating variants associated with familial cardiomyopathy and to determine induced changes at protein level. The outputs combined with the clinical data could then be used for simulation of structure and function of the heart.

    Materials and methods: Analyzing steps encompass variant calling, variant annotation with best fitting tool using apposite databases, and final refinement of the variants. The workflow consists of BWA-GATK best practices, Ensembl Variant Effect Predictor and bix2mus (custom-made tool). In this study, 100 samples of individuals with diagnosed cardiomyopathy are processed giving a statistically powerful dataset. The workflow was written in the CWL.

    Results: The composed workflow produced a subset of annotated variants that are cardiomyopathy specific. Selected annotated variants were further enriched with custom parameters which can be used as inputs for the MUSICO heart function simulation.

    Conclusions: The developed workflow for discovery and annotation of variants associated with analyzed forms of inherited cardiomyopathy is operating system-independent, runnable on cloud or locally, ensuring portability, reproducibility and reliability. This workflow provides an innovative way to infer simulation parameters starting from genomics data.

    This research was funded by the EU project SILICOFCM.

    N. Ilic Raicevic: None. L. Lenhardt Ackovic: None. V. Kovacevic: None. S. Stojanovic: None. J. Randjelovic: None. M. Mattioni: None. A.S. Yavuz: None. M. Lazarevic: None. T. Borovski: None.

    E-P05.23 A newly detected variant in the MYBPC3 gene in a patient with hypertrophic cardiomyopathy

    S. Josifovska1, R. Vazharova2,3, L. Balabanski2, M. Malinov2, S. Panov1, M. Ganev4, D. Toncheva4

    1Faculty of Natural Sciences and Mathematics, SS Cyril and Methodius University, Skopje, Macedonia, The Former Yugoslav Republic of, 2Genome Centre, GARH Malinov, Sofia, Bulgaria, 3Department of Biology, Medical Genetics and Microbiology, Faculty of Medicine, Sofia University St. Kliment Ohridski, Sofia, Bulgaria, 4Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria

    Introduction: Hypertrophic cardiomyopathy (HCM) is a kind of cardiomyopathy, a cardiac dysfunction due to diseases of the myocardium (WHO,1995). HMC causes partial enlargement of the myocardium.

    Materials and methods: We report on middle aged patient with familial history and developed HCM. Exome sequencing was performed on the patient’s extracted DNA, followed by a targeted analysis of genes from the “Cardio” gene panel. Results were validated by Sanger sequencing.

    Results: The analysis resulted in detection of a heterozygous, probably pathogenic variant in the MYBPC3 gene (NM_000256.3: c.2965delG; NP_000247.2:p.Glu989Serfs*3). This variant has not been previously reported in individuals with HCM. The MYBPC3 encodes for the Cardiac myosin-binding protein C. The MYBPC3 has a structural role as it is located in striated muscle sarcomere A-bands and binds myosin heavy chain in thick filaments and titin in elastic filaments causing muscle contraction. Pathogenic variants in the MYBPC3 gene account for approximately 15% of cases of familial HCM. The deletion that we detected leads to a frameshift resulting in an amino acid substitution of glutamic acid to serine at codon 989. Furthermore, due to the new reading frame, a stop codon can be detected 3 codons downstream, likely affecting the protein function because of a possible truncated protein form. The inheritance is autosomal dominant. No other known pathological or probably pathological variants associated to HCM were found.

    Conclusions: The genetic causes underlining HMC are complex and identifying novel variants may contribute to better distinction of this dysfunction and assessment of the risk of familial predisposition.

    S. Josifovska: None. R. Vazharova: None. L. Balabanski: None. M. Malinov: None. S. Panov: None. M. Ganev: None. D. Toncheva: None.

    E-P05.25 Genetic structure of hypertrophic cardiomyopathy in Russia

    E. V. Filatova1, N. S. Krylova2, I. N. Vlasov1, M. S. Maslova2, N. Poteshkina2, P. A. Slominsky1, M. I. Shadrina1

    1Institute of Molecular Genetics RAS, Moscow, Russian Federation, 2Pirogov Russian National Research Medical University, Moscow, Russian Federation

    Introduction: Hypertrophic cardiomyopathy (HCM) is the most common heritable cardiovascular disease, classically defined as the presence of idiopathic left ventricular hypertrophy. HCM is predominantly a single gene disorder with an autosomal dominant pattern of inheritance. However, pathogenic alleles are not identified in at least 25% of patients with HCM. Moreover, the whole spectrum of genes and mutations that contribute to the development of this disorder in Russian population has not been fully described. Therefore, the aim of our study was to identify genetic variants associated with the HCM in patients from Russia.

    Materials and methods: The study cohort included 99 unrelated patients with HCM. We performed targeted exome sequencing and a subsequent bioinformatic analysis using the various algorithms for prediction of the potential pathogenicity of variants, as well as the ClinVar database.

    Results: The frequency of pathogenic and potentially pathogenetically significant variants in the main HCM-related genes was 18% in our patients with this disorder. We also identified 22 potentially pathogenetically significant variants, including novel ones, in other HCM genes and 52 potentially pathogenetic variants in other 35 genes with known associations to 17 different inherited cardiac conditions.

    Conclusion: Thereby the prevalence of individual pathogenic variants in HCM-related genes in Russian population is very low. Therefore, it is necessary to continue the search for new genes and genetic variants associated with the development of HCM. This work was supported by the Russian Foundation for Basic Research (grants no. 19-015-00343, 18-015-00322) and the Russian Science Foundation (grants no. 20-15-00293).

    E.V. Filatova: None. N.S. Krylova: None. I.N. Vlasov: None. M.S. Maslova: None. N. Poteshkina: None. P.A. Slominsky: None. M.I. Shadrina: None.

    E-P05.27 Variants in KCNJ11 and SCN10A associated to ventricular fibrillation during acute myocardial infarction.

    L. Nuñez1, R. Pan-Lizcano1, P. Piñon2, X. Flores2, G. Aldama2, R. Calviño2, N. Vázquez-González3, J. M. Vazquez-Rodriguez3, M. Hermida-Prieto1

    1Cardiology Research Group. Instituto de Investigación Biomédica de A Coruña (INIBIC)-CHUAC-UDC, A Coruna, Spain, 2Department of Cardiology, Complexo Hospitalario Universitario A Coruna (CHUAC)-INIBIC, A Coruna, Spain, 3Department of Cardiology, Complexo Hospitalario Universitario de A Coruña (CHUAC)-CIBERCV, Instituto de Investigación Biomédica de A Coruña (INIBIC), Universidad de A Coruña (UDC), A Coruna, Spain

    Background:Sudden death (SD) due to ventricular fibrillation (VF) during acute myocardial infarction (AMI) is one of the leading causes of death in Western societies. It has been suggested that the risk of SD due to VF in AMI is the result of the interaction between genetic factors and environmental factors. Moreover, it has been proposed that variants in genes related to cardiac excitability, mainly SCN5A, could play an important role in VF during AMI.

    Methods:Genetic variants in 36 genes encoded proteins related to pathways involved in atherothrombosis were analyzed by next generation sequencing in 12 patients with FV during AMI. Mutations found were confirmed by Sanger sequencing. Visualization of the mutation using pdb and in silico prediction of the effects produced by the mutation (Mutation Tester, SNAP2, SIFT2, Polyphen, PhD-SNP) were performed.

    Results:In one patient, p.Trp83Ser was identified in KCNJ11 gene that encodes a forming KATP channel subunit, whereas in another patient p.Thr738Pro in SCN10A, encoding the forming subunit of the sodium channel, were identified. In both variants, more than four in silico tools suggested deleterious function of the protein.

    Conclusion:Mutations in gene encoded forming channels subunits, as KCNJ11 and SCN10A, could have a role in the development of FV during AMI. Thus, it is essential to use an ambitious strategy, including all genes related to cardiac excitability, to clarify the pathophysiological basis of ventricular fibrillation in acute myocardial infarction.

    Funding Acknowledgements:This work was supported by a grant from Instituto de Salud Carlos III(PI18/01737) and a non-conditional-grant from Abbott Vascular.

    L. Nuñez: None. R. Pan-Lizcano: None. P. Piñon: None. X. Flores: None. G. Aldama: None. R. Calviño: None. N. Vázquez-González: None. J.M. Vazquez-Rodriguez: None. M. Hermida-Prieto: None.

    E-P05.28 A new case of Fish-eye disease in Spain.

    J. Sanguino, C. Rodríguez Jiménez, E. Sevilla, A. Carazo, V. Gómez del Pozo, N. Gallego-Onís, F. Arrieta, S. Rodríguez-Nóvoa

    INGEMM, Madrid, Spain

    Introduction: Fish-eye disease (FED; MIM#136120) is a rare disease with inheritance pattern autosomal recessive caused by Lecithin:Cholesterol Acyltransferase Deficiency 1. This disorder is characterized by raised levels of total cholesterol, triglycerides and decreased levels of HDL-c, apoA, and apoB in serum. We report a new case of suspicion of Fish-eye disease send to our laboratory to confirm the diagnosis genetic.

    Patient and method: A 42-years-old male, with corneal opacity, very level low of HDL-c in serum, splenomegaly, without anemia or kidney disease, and raised levels of triglycerides, liver enzymes and homocysteine in serum, was remitted to our laboratory. The patient´s DNA sample was analyzed by NGS using a customized panel MTB-v2 of 411 genes. The variant found was confirmed by Sanger sequencing Results We found an homozygous missense variant in LCAT, NM_000229.2: c.491G>A p.(Arg164His). In silico analysis showed damaging and conservation for this variant.

    Conclusion: In this work, we report a new case of Fish -eye disease. The variant found in LCAT c.491G>A p.(Arg164His) had been previously reported in three siblings with typical triad: corneal opacity, anemia and kidney dysfunction and the functional study showed lack of activity in LCAT2. However, our patient exhibited a mild phenotype despite of display of same variant suggesting the existence of others factors that decreased the clinical manifestations.

    J. Sanguino: None. C. Rodríguez Jiménez: None. E. Sevilla: None. A. Carazo: None. V. Gómez del Pozo: None. N. Gallego-Onís: None. F. Arrieta: None. S. Rodríguez-Nóvoa: None.

    E-P05.29 Genetics of familial left venticular noncompaction cardiomyopathy in Russia

    A. Meshkov1, O. Kulikova1, R. Myasnikov1, A. Kiseleva1, M. Divashuk1,2, A. Zharikova1, O. Skirko1, I. Efimova1, M. Pokrovskaya1, E. Mershina3, V. Sinitsyn3, E. Basargina4, N. Sdvigova4, S. Boytsov5, O. Drapkina1

    1National Medical Research Center for Preventive Medicine, Moscow, Russian Federation, 2RSAU – MAA named after K.A. Timiryazev, Moscow, Russian Federation, 3Lomonosov Moscow State University, Moscow, Russian Federation, 4National Medical Research Center for Children’s Health, Moscow, Russian Federation, 5National Medical Research Center of Cardiology, Moscow, Russian Federation

    Introduction: Left venticular noncompaction cardiomyopathy (LVNC) is a genetically determined cardiomyopathy, characterized by the presence of increased trabecularity and pronounced intertrabecular spaces extending into the left ventricle chamber. This study was aimed at finding new key links in LVNC development.

    Materials and methods: The study included 26 families of LVNC patients. For all individuals was performed exome sequencing on Illumina Nextseq 550.

    Results: Clinical and instrumental examination of 102 people was done: 41 (40.2%) were healthy, in 61 (59.8%) patients the diagnosis of LVNC was confirmed, 15 (14%) were children. According to the examination results, the following clinical phenotypes of LVNC can be distinguished: LVNC dilatation phenotype, LVNC hypertrophic phenotype, LVNC and a combination of hypertrophic with dilatational phenotype, isolated LVNC, a combination of LVNC with congenital heart defects. The pathogenicity was evaluated for the identified nucleotide variants in 66 genes associated with the development of LVNC and in 122 genes associated with the development of other cardiomyopathies. Pathogenic (PV) or probably pathogenic (PPV) variants were found in 16 families: 11 variants in LVNC genes (5 PPV in MYH7, 2 P variants in TTN, one PV and one PPV in MYBPC3, one PPV in TPM1 and one PPV in SCN5A) and 5 variants in genes associated with other cardiomyopathies (2 PPV in DES, 1 PPV in RBM20, 1 PV in VCL, 1 PV in DSG2).

    Conclusions: The study of LVNC development on 26 families revealed mutations in MYH7, TTN, MYBPC3, TPM1, DES, RBM20, VCL and DSG2 genes.

    A. Meshkov: None. O. Kulikova: None. R. Myasnikov: None. A. Kiseleva: None. M. Divashuk: None. A. Zharikova: None. O. Skirko: None. I. Efimova: None. M. Pokrovskaya: None. E. Mershina: None. V. Sinitsyn: None. E. Basargina: None. N. Sdvigova: None. S. Boytsov: None. O. Drapkina: None.

    E-P05.30 Expression of miRNAs as a marker for cardiovascular risk in patients with type 2 diabetes mellitus

    P. Gateva1, I. Mihaleva1, K. Kamenova1, S. Giragosyan2, R. Dodova2, R. Kaneva2, I. Dimova3

    1Department of Pharmacology and Toxicology, Medical University - Sofia, Sofia, Bulgaria, 2Laboratory of Genomic Diagnostics, Molecular Medicine Center, Medical University - Sofia, Sofia, Bulgaria, 3Department of Medical Genetics, Medical University - Sofia, Sofia, Bulgaria

    The use of circulating miRNAs as biomarkers is a potential additional option in the diagnosis and prognosis of diseases, complementary to established protein-based biomarkers. In our study, we isolated miRNAs from plasma of diabetic patients with and without cardio-vascular disease (CVD). The analysis included 6 patients with type 2 diabetes mellitus without CVD (control group) and 9 patients with type 2 diabetes mellitus and CVD (target group). Following reverse transcription and subsequent real-time PCR analysis of an equal amount of baseline miRNAs, the following miRNAs were successfully analyzed: miR-16-5p, miR-155-3p, miR-155-5p,miR-210-3p, miR-221-3p miR-424-5p. The comparative analysis of expression showed a statistically significant increase in the expression of all these miRNAs in the target group compared to the control – see table bellow.

    miRNARelative expression (RQ)
    miR-16-5p2.5
    miR-155-3p2.2
    miR-155-5p7.5
    miR-210-3p5.1
    miR-221-3p6.2
    miR-424-5p10.5

    The highest level of increase was established for miR-155-5p (its target is ICAM-1 – with role in inflammation and in the regulation of vascular permeability, affected in atherosclerosis) and miR-424-5p (its target is HIF1A – the master transcriptional regulator of the adaptive response to hypoxia). In conclusion, CVD risk assessment, supported by emerging circulating biomarkers, such as miRNAs, is important for stratifying high-risk individuals, optimizing treatment strategies, and enhancing our understanding of basic biology. Acknowledgment: This study was supported by Grant NoD-66/2019, Medical University Sofia.

    P. Gateva: None. I. Mihaleva: None. K. Kamenova: None. S. Giragosyan: None. R. Dodova: None. R. Kaneva: None. I. Dimova: None.

    E-P05.31 In vitro induced DNA alkylation in endotheliocytes leads to genotoxic stress and secretion of proatherosclerotic cytokines

    M. Sinitsky, A. Kutikhin, D. Shishkova, A. Tsepokina, M. Asanov, A. Ponasenko

    Research Institute for Complex Issues of Cardiovascular Diseases, Kemerovo, Russian Federation

    Introduction: Atherosclerosis is a leader in morbidity and mortality among all cardiovascular pathologies. There are evidences that somatic mutations can play a role in endothelial dysfunction, and atherosclerotic plaques are characterized by increased level of DNA adducts. The aim of this research was to study the level of genotoxic stress markers; secretion and gene expression of proatherosclerotic cytokines IL-6 and IL-8 by endothelial cells exposed to alkylating mutagen mitomycin C (MMC).

    Materials and methods: Primary human coronary- (HCAEC) and internal thoracic artery endothelial cells (HITAEC) were used in this research. Cytokinesis-block micronucleus assay was performed to score genotoxic stress markers in exposed and control cell cultures. Concentration of IL-6 and IL-8 in culture medium and mRNA level of the corresponding genes were measured immediately after 6 hours of cell incubation with mutagen and 24 hours after elimination of MMC from cell cultures, using ELISA and RT-qPCR.

    Results: Exposed cells were characterized by increased level of all studied cytogenetic markers compared to control. After 6 hours of exposure, a significant decrease in the secretion and gene expression of IL-8, and decrease in the mRNA level of the IL-6 gene in the exposed cultures was discovered. At the second time point (6+24 h), on the contrary, the concentration and mRNA level of IL-8, as well as expression of the IL6 gene sharply increased in cultures exposed to MMC compared to control, and the HCAEC were more sensitive to mutagenic effects than HITAEC. This study was supported by basic research project №0546-2015-0012.

    M. Sinitsky: None. A. Kutikhin: None. D. Shishkova: None. A. Tsepokina: None. M. Asanov: None. A. Ponasenko: None.

    E-P05.36 Association of gene polymorphisms MTHFR in Kazakhstani patients with implanted left ventricular assist devices

    M. Zhalbinova1,2, S. Rakhimova2, M. Bekbosynova3, S. Andosova3, B. Abdirova3, A. Akilzhanova2,1

    1L.N. Gumilyov Eurasian National University, Nur-Sultan, Kazakhstan, 2National Laboratory Astana, Center for Life Sciences, Nur-Sultan, Kazakhstan, 3JSC “National research cardiac surgery center”, National medical holding, Nur-Sultan, Kazakhstan

    Introduction: Chronic heart failure (CHF) is one of the main health problems in Kazakhstan, which requires heart transplantation (HT) to extend the patient’s life. The popular treatment of CHF is the implantation of left ventricular assist device (LVAD) which extends patient’s life before HT. However, LVAD causes risk of thrombosis and bleeding in cardiac patients. Patients are normally prescribed with an antithrombotic therapy to prevent risks of thromboembolism. The purpose of this study is to evaluate patients for genetic variants responsible for risk of thrombosis: MTHFR (*1) and MTHFR (*2).

    Materials and methods: Venous blood samples were recruited from patients (n=100) with implanted LVADs (HW, HM2, HM3) at the National Research Center for Cardiac Surgery. Warfarin was prescribed according to clinical protocol (min=0.9mg; max=7.2mg; Std.=1.15). Genotyping was done for MTHFR (*1) rs1801133 and MTHFR (*2) rs1801131 by real-time polymerase chain reaction with TaqMan probes.

    Results: Genotyping results were analyzed on IBM SPSS Statistics 23 for n=98 patients (>18 years old). Results presented that most of the patients have wild type of genotype which proves absence to the risk of thrombosis: MTHFR (*1) (G/G=47%; G/A=41%; A/A=10%, p = 0.563); MTHFR (*2) (T/T =54%; T/G=38%; G/G=6%, p = 0.288). Results are not statistically significant.

    Conclusions: Research advices to study other SNPs which will allow us to identify the reasons of thrombosis and bleeding in LVAD patients and also to study more about coagulation factors, aspirin resistance, warfarin metabolism. Study needs to add more samples to be able to compare results with other samples.

    M. Zhalbinova: None. S. Rakhimova: None. M. Bekbosynova: None. S. Andosova: None. B. Abdirova: None. A. Akilzhanova: None.

    E-P06 Metabolic and Mitochondrial Disorders

    E-P06.01 The case of atypical form of 3-methylglutaconic aciduria

    O. Vernigor, O. Grechanina, M. Kanyuka

    Interregional Specialized Medical Genetic Center - Center of Rare (Orphan) Diseases, Kharkiv National Medical University, Kharkiv, Ukraine

    Methylglutonic aciduria (MGA) is clinically and genetically heterogeneous disease. Genes responsible for development known diseases: OPA3, AUH, TAZ, DNAJC19. One of the diagnostic methods of MGA is an analysis of the spectrum of organic acids in urine by gas chromatography-mass spectrometry, as there are biomarkers of the disease - 3-methylglutaric and 3-methylglutaconic acid increase is characteristic. Materials and methods: in our center there are 3 children with an atypical form of 3-methylglutaconic aciduria, a description of one clinical case. The child is 3 years old, applied with poor weight gain, a slight speech development delay, poor physical exercise tolerance. At an early age - regurgitation, lack of body weight. The diagnosis has not been established. Examination has revealed diffuse hypotension, asthenia, phenotypically signs of connective tissue dysplasia, Laboratory studies: increased transaminases, increased lactate level, hepatosplenomegaly. According to clinical criteria - mitochondrial Nijmegen disease. Diagnostic assessment (Wolf NI, Smeitink JA. Mitochondrial disorders) in a child confirmed mitochondrial pathology. As the boy grew, there was an increase of clinical symptoms: increased weakness, fatigue, muscle hypotension, hypomimia. GC-MS in dynamics: titer 3- metylglutaric and 3- metylglutaconic increase, MRS- confirmed mitochondrial neurocyte activity. Diagnosed with atypical forms of 3-methylglutaconic aciduria (3-methylglutaconic deficiency — CoA-hydratases) Prescription: mitochondrial therapy during rehabilitation. It led to temporary positive dynamics. Conclusions: timely diagnosis of a rare disease based on biomarkers can improve the condition of the patient due to pathogenetic therapy.

    O. Vernigor: None. O. Grechanina: None. M. Kanyuka: None.

    E-P06.03 X-linked ALG13-CDG resulting from c.320A>G variant - can transferrin profile change and correlate with the clinical phenotype?

    A. Jezela-Stanek1, A. Bogdańska2, P. Pokora3, J. Paprocka4, A. Tylki-Szymańska3

    1National Institute of Tuberculosis and Lung Disease, Department of Genetics and Clinical Immunology, Warsaw, Poland, 2The Children’s Memorial Health Institute, Department of Biochemistry, Radioimmunology and Experimental Medicine, Warsaw, Poland, 3Children’s Memorial Health Institute, Department of Pediatrics, Nutrition and Metabolic Disorders, Warsaw, Poland, 4Medical University of Silesia, Department of Pediatric Neurology, School of Medicine in Katowice, Katowice, Poland

    Introduction: Congenital Disorders of Glycosylation (CDG) are multisystemic metabolic disorders, in general, caused by defects of N-linked, O-linked oligosaccharides pathways. Their clinical presentation and aetiology are highly heterogeneous, which may cause a diagnostic dilemma. So far, ALG13 c.320A > G variant was reported in ten females and one male. Contrary to other known ALG13-CDG, in probands harbouring this mutation normal glycosylation and mass spectrometry pattern were observed (two and one individuals, respectively). There is, however, one another report, giving evidence of slightly reduced glycosylation with the absence of one glycan in MS. Since these laboratory data are not conclusive, and the number of reported patients is still very limited, we like to present novel individuals, pointing out their transferrin IEF results.

    Materials: Three female probands with de novo ALG13 c.320A>G variant (P3, with the most severe psychomotor impairment, also heterozygous for c.3433C>T in the CACNA1A gene).

    Methods: Transferrin isoforms examined by isoelectric focusing (IEF) of iron saturated serum in agarose gel in a pH gradient 5-7 with immunofixation, demonstrated as the percentage of each isoform fraction in a densitometric scan.

    Results: Transferrin isoforms showed normal profiles in P1, while in P2 - slight elevation of asialo, monosialo, disialo fraction; P3 - first analysis: normal; second (in another sample): slight elevation of only disialo fraction.

    Conclusions: Obtained IEF data delineate the characteristics of ALG13-CDG caused by c.320A>G variant, providing evidence of variability or specificity of glycosylation defect. These may be significant for genetic results verification but also clinical assessment and correlation.

    A. Jezela-Stanek: None. A. Bogdańska: None. P. Pokora: None. J. Paprocka: None. A. Tylki-Szymańska: None.

    E-P06.04 Cerebrotendinous xanthomatosis with novel compound heterozygous mutation ofCYP27A1gene

    H. N. Cesur Baltacı1, B. Sağlam Ada2, N. Yürür Kutlay1, A. Tükün2, S. Tıraş Teber3, T. Coşkun4

    1Medical Genetics Department, Ankara University, Ankara, Turkey, 2Department of Medical Genetics, Düzen Laboratories Group, Ankara, Turkey, 3Department of Pediatric Neurology, Ankara University School of Medicine, Ankara, Turkey, 4Departments of Pediatric Metabolism, Hacettepe University Faculty of Medicine, Ankara, Turkey

    Introduction: Cerebrotendinous xanthomatosis (CTX) is a rare lipid storage disease characterized by the accumulation of cholesterol and cholestanol in various tissues. It is inherited in an autosomal recessive manner caused by the mutations of CYP27A1 gene localized on 2q35. This gene encodes sterol 27-hydroxylase. Here we present a 8-year-old male with attention deficit and hyperactivity disorder. He was born to non-consanguineous parents. He was consulted to us for CYP27A1 gene analysis by the information of a homozygous deletion in exon 6 of CYP27A1 gene in his mother. Additionally, his 7-dehydrocholesterol and plasma cholestanol levels increased consistently with CTX. His father had epilepsy together with limited intellectual capacity.

    Material and Method: Genomic DNAs were extracted from the patient and his father, followed by CYP27A1 gene sequencing. Furthermore, in order to demonstrate the deletion, multiplex ligation-dependent probe amplificationof the CYP27A1 gene was performed in the proband.

    Results: We found a novel heterozygous c.508_509ins16 (p.E170Vfs*16) mutation in CYP27A1 gene in the proband’s father. Consequently, a compound heterozygous mutation was detected in the proband. The effect of this novel point mutation on CYP27A1function was predicted to be damaging by in silico analysis. After genetic counseling, his grandmother who was his legal guardian, consented to kenodeoxycholic acid (CDCA) treatment. Cholestanol decreased to normal levels and some symptoms improved at the end of two months treatment.

    Conclusion: Genetic testing for presymptomatic family members of affected patients should be suggested especially to offer an opportunity to prevent or decrease the disease manifestations with CDCA therapy.

    H.N. Cesur Baltacı: None. B. Sağlam Ada: None. N. Yürür Kutlay: None. A. Tükün: None. S. Tıraş Teber: None. T. Coşkun: None.

    E-P06.05 A novel CTCF variant in a patient with congenital anomalies

    N. Okamoto1, F. Miya2,3,4, T. Tsunoda2,3,4, K. Kosaki5

    1Department of Medical Genetics, Osaka Women’s and Children’s Hospital, Osaka, Japan, 2Department of Medical Science Mathematics, Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan, 3Laboratory for Medical Science Mathematics, RIKEN Center for Integrative Medical Sciences, Yokohama, Japan, 4Medical Science Mathematics, Department of Biological Sciences, Graduate School of Science, The University of Tokyo, Tokyo, Japan, 5Center for Medical Genetics, Keio University School of Medicine, Tokyo, Japan

    Introduction: The DNA-binding protein CCCTC-binding factor (CTCF) and the cohesin complex play important roles in chromatin architecture in vertebrates. Pathogenic variants in CTCF were reported in patients with neurodevelopmental disorders with distinctive facial features. We report a patient with a novel variant in CTCF with intellectual disability (ID) and multiple anomalies.

    Clinical Report: The 6-year-old male was the first child of healthy and non-consanguineous Japanese parents. He showed congenital cardiac anomalies, duodenal atresia, and atresia ani. His developmental milestones were also retarded. He also showed characteristic facial features. Conventional cytogenetic studies and microarray analysis gave normal results.

    Method: With the approval of our institutional ethics committee, DNA samples from the patient and her parents were analyzed by WES.

    Results: The patient was heterozygous for CTCF frameshift variant (NM_006565:exon3:c.723delT:p.N241fs). The variant was de novo.

    Discussion: Cornelia de Lange syndrome, a classical cohesinopathy, may show multiple malformations including CHD and gastrointestinal malformations. CTCF may regulate organogenesis. Mutations in CTCF may also cause a multiple anomaly syndrome with ID.

    N. Okamoto: None. F. Miya: None. T. Tsunoda: None. K. Kosaki: None.

    E-P06.07 Two forms of a disease in the same family: compound heterozygosity in the father and heterozygosity in his sister both with corneal cystinosis, and heterozygous daughter and his other sister both having risks for nephropathic cystinosis

    B. Celtikci1, B. Kazanci2

    1Hacettepe University, Ankara, Turkey, 2Ulucanlar Eye Hospital, Ministry of Health, Ankara, Turkey

    Cystinosis is a rare and autosomal recessive inherited disorder resulting from the accumulation of intracellular cystine, due to the mutations of the CTNS gene encoding the cystinosin protein that carries the lysosomal amino acid cystine. Its incidence is high in Turkey, because of the frequent consanguineous marriage and manifesting heterozygotes. The most common clinical diagnosis is kidney involvement. Corneal form occurs later. Some cases are diagnosed with photophobia, halo and glare style visual findings, depending on the density of corneal crystals. Spindle- and fusiform-shaped corneal crystals were detected in our patient and his sister. Sequencing of CTNS gene was performed on a MiSeq (Illumina). VCF files were analyzed by Variant studio (Illumina) and Geneticist Assistant (SoftGenetics) Software. Sequence variant classification was done according to the ACMG Standards and Guidelines. Detected variants were confirmed by Sanger sequencing. Our patient with corneal cystinosis has the compound heterozygosity of c.589G˃A (p.G197R)(p.Gly197Arg) /c.1015G˃A (p.G339R)(p.Gly339Arg) mutations, correlated with cystinosis and his daughter is a heterozygote for c.1015G˃A (p.G339R)(p.Gly339Arg) mutation, correlated specifically with nephropathic cystinosis. As expected, his mother is a heterozygote for c.589G˃A (p.G197R)(p.Gly197Arg) mutation and his father is a heterozygote for c.1015G˃A (p.G339R)(p.Gly339Arg) mutation. One of his asymptomatic sister is a heterozygote for c.1015G˃A (p.G339R)(p.Gly339Arg) mutation. Another sister with corneal cystinosis is a heterozygote for c.589G˃A (p.G197R)(p.Gly197Arg) mutation. Overall, we can trace the (potential) phenotype of these patients using their mutation. This study shows us the genetic heterogenity of cystinosis in Turkish population and helps us to understand the biochemical-genotype-phenotype relationship in this disease.

    B. Celtikci: None. B. Kazanci: None.

    E-P06.08 A unique combination of two lysosomal diseases in a child revealed as a result of a screening

    O. Buhaiova, O. Grechanina, Y. Hrechanina, L. Molodan, N. Pokaziy, A. Bulavina, D. Shkolnikova

    Interregional Specialized Medical Genetic Center - Center of Rare (Orphan) Diseases, Kharkiv National Medical University, Kharkiv, Ukraine

    Introduction: Lysosomal storage disorders are characterized by comorbidity, polymorphism and genetic heterogeneity, which makes their timely diagnosis difficult.

    Materials and methods: To identify patients with atypical forms of MPS, Pompe, Gaucher, Fabry disease among residents of Kharkov region in 2018. In Kharkiv region, selective screening for accumulation diseases has begun.

    Results: determination of excretion of total glycosaminoglycans (GAGs) in daily urine (2733patients); determination of the level of fractional blood GAGs-(683patients), biochemical study of the level of enzymes and molecular genetic diagnostics (712patients). This revealed: Combination of Fabry disease and Pompe disease in 1 patient. In a child with diffuse muscular hypotension, retarded physical and statokinetic development, hepatomegaly, decreased activity of the lysosomal enzyme acid α-glucosidase, decreased Lyso-Gb3, the GLA gene (heterozygous variant c.31G> C p. (Gly11Arg)) was detected. GLA - encodes a homodimeric glycoprotein. A mutation in the gene affects the synthesis, processing and stability of the enzyme that causes Fabry disease, which results from the inability to catabolize alpha - D-galactosyl glycolipid moieties. GAA - The gene produces an acid alpha glycosidase enzyme. The body uses GAA to break down the glycogen used to produce energy.

    Conclusions: The introduction of a selective screening system for diseases of accumulation made it possible to diagnose early and to start adequate pathogenetic personalized therapy in a timely manner for this group of patients. For the first time, a combination of Fabry and Pompe diseases was detected in 1 patient.

    O. Buhaiova: None. O. Grechanina: None. Y. Hrechanina: None. L. Molodan: None. N. Pokaziy: None. A. Bulavina: None. D. Shkolnikova: None.

    E-P06.10 Spectrum of mutations in Russian patients with hypercholesterolemia

    O. N. Ivanova, T. D. Krylova, N. A. Semenova, P. A. Vasiluev, N. V. Milovanova, E. Z. E.Y. Zakharova

    Federal State Budgetary Scientific Institution "Research Centre for Medical Genetics", Moscow, Russian Federation

    -Introduction: We presented a genetic spectrum of hypercholesterolemia in a cohort of 72 unrelated patients from Moscow region. -Materials. The patients with high level of total cholesterol (>6,7 mmol/l) and/or low-density lipoprotein cholesterol (>4,9 mmol/l) were screened on targeted NGS panel on IonS5 (Thermofisher Scientific) for the following genes: LDLR(NM_000527), APOB(NM_000384), PCSK9(NM_174936), ABCG5(NM_022436), ABCG8(NM_022437), APOA2(NM_001643), LIPA(NM_000235), LPL(NM_000237). Informed consents have been obtained from all patients or their legal representatives to conduct the study. The average age of the patients was 12,04+/-1,27 years old. The nomenclature of variants and the assessment of their pathogenicity has been carried out in accordance with HGVS, ACMG recommendations. Variant validation has been performed by Sanger sequencing.

    -Results: We found 44 variants among 72 of cases (61%). Known pathogenic mutations have been detected in 27 patients, 21 of them were in LDLR gene, and six in the genes APOB, LIPA, ABCG8. 17 patients harbor new variants with varying degrees of pathogenicity (see table below).

    -Conclusions: Pathogenic LDLR variants have been detected in 47% (34/72) of unrelated patients with hypercholesterolemia, the same results were shown in the literature. The most common variant in this gene is the known pathogenic mutation c.1775G>A(p.G592E) (6.9%) and the previously unpublished splicing variant c.940+1_c.940+4delGTGA (5,5%). The study has confirmed the genetic heterogeneity of hypercholesterolemia in the Russian cohort.

     pathogeniclikely pathogenicprobably pathogenicvariant of uncertain significance
    LDLRc.316_328delCCCAAGACGTGCT: p.(K107Rfs*95);c.325T>G: p.(C109G);c.2389+5G>Cc.616A>C: p.(S206R);
    LDLRc.940+1_c.940+4 delGTGA;c.401G>C: p.(C134S) c.663_683dupCTGCAAGGACAAATCTGACGA;
    LDLRc.1186+1G>T;  c.798T>A: p. (Asp266Glu);
    LDLRc.1684_1691delTGGCCCAA: p.(P563Hfs*14)  c.1187-7C>G
    LPL   c.472T>C: p.(Y158H)
    APOA2   c.122_123insACCGT: p. (V41= fs*2);
    APOA2   c.53G>A: p.(G18E)

    O.N. Ivanova: None. T.D. Krylova: None. N.A. Semenova: None. P.A. Vasiluev: None. N.V. Milovanova: None. E.Z. E.Y. Zakharova: None.

    E-P06.11 Pathogenic variant p.E191K in ALPL is common in mild forms of hypophosphatasia in Northwest Russia

    M. Fedyakov1, Y. Eismont1, T. Ivaschenko2, I. Sosnina3, Y. Snegova3, S. Scherbak1, Y. Barbitoff4, A. Shikov1, O. Glotov1

    1City Hospital 40, Saint-Petersburg, Russian Federation, 2D.O. Ott Research Institute of Obstetrics, Gynecology and Reproductology, Saint-Petersburg, Russian Federation, 3Consultative and diagnostic center for children, Saint-Petersburg, Russian Federation, 4Bioinformatics institute, Saint-Petersburg, Russian Federation

    Introduction: Hypophosphatasia (HPP) is a rare heritable metabolic disorder characterized by defective mineralization of bone and/or teeth in the presence of reduced activity of unfractionated serum alkaline phosphatase (ALP). The overall prevalence of severe HPP is range from 1/100 000 to 1/300 000. Mild forms of HPP are more frequent than severe forms - expected prevalence can reach 1/6000 in Western populations. Russian prevalence of mild and severe HPP is still unknown. Genetic analysis provides determining of diagnosis in cases with suspected HPP.

    Materials and methods: We analyzed genomic DNA samples from 217 unrelated individuals with suspected HPP (inclusion criteria: low and/or recurrent low levels of ALP, low growth, recurrent fractures and others). Primers’ system for Sanger sequencing was designed and validated for coding 2-12 exons of ALPL gene. Exome data of 353 of unrelated individuals (in-house control group) was used for genetic variant estimation of prevalence in Northwest Russia.

    Results: Detection rate was 11% - 21 in heterozygous and 3 in compound-heterozygous. Mild HPP was founded in 87,5% positive cases (21/24). 5 novel mutations (3 missense, 2 frameshift) were detected. Most frequent pathogenic variant in ALPL gene was p.E191K in exon 6. The prevalence of this mutation was: 2.8% in suspected HPP group (12/434), 0.28% (2/706 chromosome) in home controls, 0.25% in gnomAD.

    Conclusions: Mild forms of HPP predominate in Northwest Russian patients with suspected HPP. Mutation p.E191K in exon 6 is 20 times common in patients with low levels of ALP compare general population.

    M. Fedyakov: None. Y. Eismont: None. T. Ivaschenko: None. I. Sosnina: None. Y. Snegova: None. S. Scherbak: None. Y. Barbitoff: None. A. Shikov: None. O. Glotov: None.

    E-P06.14 High genetic heterogeneity of lysosomal storage diseases in Ukraine

    N. Olkhovych1,2, N. Pichkur1,2, N. Trofimova1,2, S. Kormoz2, I. Gregul2, Y. Gyvitsa2, N. Samonenko2,3, Y. Doronina2, M. Tcygankova2, O. Radzihovskaya2, N. Gorovenko1,3

    1Institute of Genetic and Regenerative Medicine, Kyiv, Ukraine, 2National Children Hospital Ohmatdyt, Kyiv, Ukraine, 3National Medical Academy of Postdiploma Education named P.L.Shupika, Kyiv, Ukraine

    Introduction: Lysosomal storage diseases (LSD) are inherited metabolic diseases that are caused by genetic alterations in lysosomal enzymes genes. Most of the human disease is characterized by marked genetic heterogeneity, far greater than previously appreciated. This degree of allelic, locus, and phenotypic heterogeneity has important implications for gene discovery and has important implications for development of molecular treatments for individual patients.

    Aim: Analysis of genetic heterogeneity of the most common lysosomal storage diseases in patients from Ukraine.

    Materials and methods: The frequencies and spectrum of causes mutations in patients with Gaucher (n=62), Niemann-Peak A/B (n=16), metachromatic leukodystrophy (MLD) (n=28), mucopolysaccharidosis type I (MPS I) (n=17), mucopolysaccharidosis type IIIA (MPS III A) (n=21), GM1-gangliosidosis (n=32) were analyzed. Mutation analysis was performed using classical PCR analysis and Sanger sequencing. Comparative analysis of the common mutations in different populations was performed according to the published data.

    Results: Our research has shown that the frequencies of common mutations in patients with Niemann-Peak A/B, MLD and GM1-gangliosidosis in Ukraine is significantly different from other European. Frequencies of common mutations in patients with Gaucher, MPS I and MPS IIIA is close to that in the nearest neighbors - Poland, Hungary and Slovakia, but are lower than European average, and the genetic heterogeneity of these diseases in Ukraine is pronounced.

    Conclusions: Existence of high genetic heterogeneity of LSD in Ukraine creates significant problems during medical genetic counseling for families and requires the development of specific diagnostic algorithm that regulates the stages of diagnostic search using DNA analysis.

    N. Olkhovych: None. N. Pichkur: None. N. Trofimova: None. S. Kormoz: None. I. Gregul: None. Y. Gyvitsa: None. N. Samonenko: None. Y. Doronina: None. M. Tcygankova: None. O. Radzihovskaya: None. N. Gorovenko: None.

    E-P06.15 A novel de novo variant in MT-ATP6 in a patient with Mitochondrial myopathy, Lactic Acidosis and Sideroblastic Anemia (MLASA) plus: expanding the clinical phenotype

    J. Dupont1, P. Janeiro2, M. J. Palaré3, S. Quintas4, A. B. Sousa1

    1Serviço de Genética Médica, Departamento de Pediatria, Hospital de Santa Maria, Centro Hospitalar e Universitário Lisboa Norte, Centro Académico de Medicina de Lisboa, Lisbon, Portugal, 2Centro de Referência de doenças hereditárias do metabolismo, Departamento de Pediatria, Hospital de Santa Maria, Centro Hospitalar e Universitário Lisboa Norte, Centro Académico de Medicina de Lisboa, Lisbon, Portugal, 3Unidade de Hematologia Pediátrica, Departamento de Pediatria, Hospital de Santa Maria, Centro Hospitalar e Universitário Lisboa Norte, Centro Académico de Medicina de Lisboa, Lisbon, Portugal, 4Unidade de Neurologia Pediátrica, Departamento de Pediatria, Hospital de Santa Maria, Centro Hospitalar e Universitário Lisboa Norte, Centro Académico de Medicina de Lisboa, Lisbon, Portugal

    Introduction: MLASA is a mitochondrial disorder characterized by myopathy, lactic acidosis, and sideroblastic anemia, associated with biallelic mutations in PUS1 and YARS2 genes. In 2014, Burrage et al. reported an MLASA-like phenotype (OMIM 500011) in a patient harboring a novel heteroplasmic point mutation in mitochondrial ATP synthase 6 (MT-ATP6). Pathogenic variants in MT-ATP6 are a cause of NARP (neurogenic muscle weakness, ataxia, and retinitis pigmentosa) and Leigh syndrome.

    Case description: The proband is an 8-year-old girl with an early infantile presentation of failure to thrive, sideroblastic anemia, axial hypotonia, nystagmus and mild developmental delay. Slow-growing, sparse and brittle striking hair was noticed since infancy. She evolved with developmental stagnation and severe ID. Recently, clinical deterioration occurred during acute illness. On physical examination she has tip-toe ataxic gait, dystonia, bradykinesia, rigidity, and muscle weakness with atrophy. Ophthalmologic assessment showed salt-and-pepper retinopathy. Persistent hyperlacticaemia and respiratory chain complex V deficiency in muscle were documented. WES and CNV analysis were negative. Mitochondrial genome sequencing in blood identified a novel de novo homoplasmic variant in MT-ATP6 gene (NC_012920.1:m.9014A>G), classified as uncertain according to ACMG guidelines, but considered likely pathogenic applying the ClinGen SVI Bayesian classification framework. Functional studies are ongoing.

    Conclusions: MLASA plus is a distinctive phenotype associated with MT-ATP6 uncommon variants. MT-ATP6–related disease is best defined as a mitochondrial disease spectrum disorder, as demonstrated by the presence of NARP and Leigh features in our patient. Hair abnormalities are distinctive and might lead the clinician to suspect the diagnosis before multi-organ involvement develops.

    J. Dupont: None. P. Janeiro: None. M.J. Palaré: None. S. Quintas: None. A.B. Sousa: None.

    E-P06.16 Management and outcomes in pregnant women with GCK-MODY and HNF1A-MODY from Poland

    M. Szopa, K. Zawadzka, K. Cyganek, P. Witek, M. T. Malecki

    JUMC, Krakow, Poland

    Introduction: Mutations in the glucokinase (GCK) and hepatocyte nuclear factor1a (HNF1A) gene are the most common causes of maturity-onset diabetes of the young (MODY). The management of both MODY types during pregnancy is challenging and differs from other forms of diabetes. The aim was to assess clinical management and pregnancy outcomes among women with GCK-MODY and HNF1A-MODY.

    Material and Methods: We included 13 GCK and 14 HNF1A-MODY patients.

    Results: There was no significant difference in age of pregnancy between GCK-and HNF1A-MODY women; those with the HNF1A gene mutation were diagnosed with MODY earlier (28vs.30years). HNF1A-MODY patients preconception body weight was higher (67.28 kg) compared to GCK-MODY (62.71kg), but the body weight gain during pregnancy was significantly higher among GCK-MODY patients (18.5vs.12.78 kg,p<0.005). Treatment modification during pregnancy was more common among GCK-MODY patients: most switched from only diet to insulin. Total insulin per day in the 1st trimester was significantly higher in GCK-MODY (34.57vs. 30.5units,p<0.005) patients and the difference between percentage of basal insulin was also significantly higher (34.99vs.20.87%,p<0.005), the latter of which remained significant until the end of pregnancy. There were no macrosomic or low birth weight neonates.

    Conclusions: GCK-MODY pregnant women received a higher daily dose of insulin, especially in percentage of basal insulin, compared to HNF1A-MODY patients. This could be due to attempts to achieve target fasting glucose levels during pregnancy established for gestational diabetes despite different specificities of GCK-MODY. The higher dose of given insulin could be responsible for the greater weight gain among GCK-MODY patients.

    M. Szopa: None. K. Zawadzka: None. K. Cyganek: None. P. Witek: None. M.T. Malecki: None.

    E-P06.18

    Mucopolysaccharidosis IIIA - a clinical case

    E. S. SHELBY, M. Axente, A. I. Grigoriu, L. Pădure;

    CNC RNC Dr. Nicolae Robanescu, Bucharest, Romania.

    Introduction: We present the case of a 16 year old boy admitted in our hospital in May 2019 with no significant birth or family history, normal mental and motor development until one year and six months and progressive onset of symptoms consisting in macrocrania, hepatosplenomegaly, cognitive and motor retardation, hetero-aggressive behaviour, insomnia, incontinence, hirsutism, coarse facial features, muscle atrophies and scoliosis. Testing for several storage diseases was normal. MRI showed cortical atrophy, right maxillary mucocele, corpus callosum hypoplasia, occipital cyst. He had optic atrophy and aortic insufficiency. A diagnosis of mucopolysaccharidosis was suspicioned.

    Objectives: The goal was to establish a diagnosis for optimal medical management and for establishing the recurrence risk in order to offer genetic counselling to the family.

    Method: Further investigations were performed. CT showed skull hyperostosis, thickening of left clavicle and vertebrae (dysostosis multiplex) and femoral head necrosis. EEG was hypovoltated with epileptiform discharge. Genetic testing (panel for mucopolysaccharidoses) was performed.

    Results: Patient was homozygous for SGSH c.1297C>T, p.(Arg433Trp) mutation, classified as pathogenic. He was diagnosed with Sanfilippo syndrome (MPZ type IIIA).

    Conclusions: As treatment for several types of mucopolysaccharidoses exists, diagnosis must be made as soon as possible. To our knowledge, cortical atrophy and corpus callosum hypoplasia were described in other Sanfilippo subtypes but - except for two Israeli Arab sisters from a consanguineous family, in no other cases of Sanfilippo type A syndrome. This is the third case with these features, indicating they might also be associated with Sanfilippo type A syndrome.

    E.S. Shelby: None. M. Axente: None. A.I. Grigoriu: None. L. Pădure: None.

    E-P06.20 A novel homozygous pathogenic PEX26 gene’s variant in patients with Zellweger syndrome from Dagestan

    N. Semenova1, M. Kurkina1, E. Dadaly1, D. Guseva1, T. Strokiva2, N. Taran2

    1Reseach Center for Medical Genetics, Moscow, Russian Federation, 2Federal Research Centre of Nutrition and Biotechnology, Moscow, Russian Federation

    Introduction: Peroxisome biogenesis disorders (PBD) are a heterogeneous group of autosomal recessive disorders that affect multiple organ systems. Approximately 80% of PBD patients are classified in the Zellweger syndrome spectrum, which are caused generally by mutations in the PEX1, PEX6, PEX10, PEX12, or PEX26 genes.

    Materials and methods: We present two unrelated families of Dagestan origin with three 1-year-old male members with cholestasis hepatopathy and development delay. Parents of one family were consanguineous. All patients were born at term, had appropriate birth weights for gestational age. From 2 months of age they have had poor feeding, development delay. Physical examination showed jaundiced, hepatosplenomegaly and coagulopathy. At 1year of age, they couldn’t sit and stand on their own. Two sibs (monozygous twins) had very low cholesterol level and normal GGT. The concentrations of C26 and phytanic acid in plasma were increased and made up respectively 13.2mM/ml (normal 0.22-2.2nN/ml) and 59.42mg/ml (normal 0-3.11mg/dl); ratio of C26/C22 was 0.149 (normal 0.009-0.018). Another patient had normal phytanic acid concentration in plasma (0.01 mg/ml) but high level of C26 and C26/C22 (15.4 and 0.312 respectively). All children had normal bile acid concentration in urine.

    Results: NGS was used to analyze 52 genes responsible for hereditary diseases with cholestasis. A nucleotide variant in PEX26 gene was identified: c.347T>A (p.Leu116Gln) in homozygous state. This variant was confirmed with Sanger sequencing. Parents are healthy and heterozygous for mutant allele.

    Conclusions: Our clinical cases describe the phenotype associated with the c.347T>A (p.Leu116Gln) variant in PEX26 gen of Dagestan origin

    N. Semenova: None. M. Kurkina: None. E. Dadaly: None. D. Guseva: None. T. Strokiva: None. N. Taran: None.

    E-P06.21 BH4-deficient hyperphenylalaninemia in Russia

    P. Gundorova1, I. A. Kuznetsova1, A. A. Stepanova1, A. V. Polyakov1, Y. S. Itkis2

    1Federal State Budgetary Institution "Research Centre for Medical Genetics", Moscow, Russian Federation, 2Research Centre for Medical Genetics, Moscow, Russian Federation

    Introduction: Tetrahydrobiopterin-deficient hyperphenylalaninemia (BH4-HPA) is a group of heterogeneous diseases, caused by impaired synthesis or regeneration of tetrahydrobiopterin (BH4), a cofactor of the phenylalanine, tyrosine and tryptophan hydroxylases. Six different genes are known as responsible for BH4 metabolism. The proportion of BH4-HPA and the mutation spectrum of BH4 synthesis and regeneration genes is unknown in Russia.

    Materials and methods: During the 20 years, more than 3,100 patients with PKU and HPA were diagnosed in the DNA-diagnostic laboratory of “RCMG”. Among them, 30 patients with BH4-HPA were identified. Sanger sequencing of PTS and QDPR genes and custom panel NGS sequencing of all HPA genes and DNAJC12 were performed.

    Results: In 25 patients “HPA-BH4A” diagnosis was confirmed, 18 different PTS variants were found on 50 alleles. The most common variant were p.Thr106Met (32,0%), p.Asn72Lys (20,0%), p.Arg9His (6,0%). Seven novel variant were found, including the whole PTS gene deletion. In 4 patients “HPA-BH4C” diagnosis was confirmed, 5 different QDPR variants were found on 8 alleles. Three of them were not previously reported. Three patients were homozygous and one compound-heterozygous. In addition, one patient with DOPA-responsive dystonia and homozygous variant с.524С>А (p.Ala175Asp) in SPR gene was identified.

    Conclusions: The proportion of BH4-HPA in Russia is about 1% of all HPA. PTS gene mutations lead to the BH4-HPA in 86% of cases, QDPR mutations in 14%. The detection of BH4-HPA patients should be performed via differential diagnostic methods. Nowadays the reported cohort is involved in setting up a pterin method into a practice.

    P. Gundorova: None. I.A. Kuznetsova: None. A.A. Stepanova: None. A.V. Polyakov: None. Y.S. Itkis: None.

    E-P06.26 Screening for genetic variants associated with cardiovascular diseases in patients with type 2 diabetes mellitus

    I. Mihaleva1, M. Mincheva2,3, M. Hristova-Savova3, K. Belemezova3, M. Rizov3, S. Yovinska3, R. Dimova4, T. Tankova4, P. Andreeva-Gateva1, I. Dimova2,3

    1Department of Pharmacology and Toxicology, Medical University Sofia, Sofia, Bulgaria, 2Laboratory of Genomic diagnostics, Molecular Medicine Center, Medical University Sofia, Sofia, Bulgaria, 3Genetic Laboratory, SAGBAL “Dr Shterev”, Sofia, Bulgaria, 4Department of Endocrinology, Medical University Sofia, Sofia, Bulgaria

    A strong association between type 2 diabetes mellitus (DM) and cardiovascular diseases (CVD) exists. CVD are the leading cause of morbidity and mortality among patients with diabetes. Our objective was to study the allelic and genotypic frequencies of genetic variants that have shown a strong association with CVD in diabetic patients with and without cardiovascular complications and to assess the additional contribution of genetic variation in determining the risk for such complications. We have used CVD StripAssay kit (Vienna Lab) based on polymerase chain reaction (PCR) and reverse hybridization. The following mutations were studied: FV G1691A (Leiden), FV H1299R (R2), Prothrombin G20210A, Factor XIII V34L, β-Fibrinogen -455 G-A, PAI-1 4G/5G, GPIIIa L33P (HPA-1), MTHFR C677T, MTHFR A1298C, ACE I/D, Apo B R3500Q, Apo E2/E3/E4. 36 diabetic patients divided in 2 groups were analyzed: 1) 20 diabetic patients with CVD and 2) 16 diabetic patients without CVD. Results: We found higher than population frequency for the following alleles/genotypes - 5.5% for FV Leiden allele, 9.7% for FVR2 allele, 38.9% for β-Fibrinogen genotype -455G/A, 58.9% for PAI-1 4G allele, 36.1% for ACE D/D genotype. Statistically higher frequency was established for β-Fibrinogen -455 G-A in the patients with CVD compared to non-CVD (55% vs. 18.7%). Conclusion: We detected high frequency of β-Fibrinogen - 455 G/A genotype in diabetic patients, especially in these with CVD. Based on its pro-inflammatory role and its connection to possible thrombotic events, patients would benefit from anti-inflammatory treatment. Acknowledgment: This study was supported by Grant NoD-66/2019, Medical University Sofia.

    I. Mihaleva: None. M. Mincheva: None. M. Hristova-Savova: None. K. Belemezova: None. M. Rizov: None. S. Yovinska: None. R. Dimova: None. T. Tankova: None. P. Andreeva-Gateva: None. I. Dimova: None.

    E-P06.28 Variant nonketotic hyperglycinemia due to novel compound heterozygous LIAS mutations: a case with a branchpoint mutation

    L. Pölsler1, B. Mühlegger1, S. Gang2, P. Traunfellner1, A. Amberger1, K. Wimmer1, S. Rudnik1, J. Zschocke1

    1Institute of Human Genetics; Medical University Innsbruck, Innsbruck, Austria, 2Department of Pediatrics and Adolescent Medicine; Academic Teaching Hospital LKH Feldkirch, Feldkirch, Austria

    Nonketotic hyperglycinemia (NKH) results from defects in the glycine cleavage system and is characterized by neonatal seizures, psychomotor delay, and elevated glycine levels. It is caused by bi-allelic mutations affecting the subunits of the mitochondrial glycine cleavage system (including GLDC). The term “variant NKH” refers to the deficiency of one of the glycine cleavage cofactors, such as lipoate. This organosulphur compound is also part of the oxoacid dehydrogenase complexes such as PDHC and requires lipoyl synthase (LIAS gene) for its biosynthesis.

    NKH was suspected in a boy who presented with neonatal intractable seizures from day 2 and died at 6 weeks of age. Blood and CSF glycine concentrations were elevated, lactate was normal.

    Massive parallel sequencing showed heterozygosity for the known GLDC mutation c.2316-1G>A and the nonsense mutation c.985A>T, p.(Lys329*) in LIAS. Additionally, a novel intronic variant c.551-24A>T affecting a predicted branch point in LIAS intron 5 was found. Analysis of mRNA transcripts in lymphocytes of the heterozygous LIAS c.551-24A>T carrier father showed retention of the 82-bp intron. Presumably due to nonsense-mediated mRNA decay, this splice effect, leading to the premature stop codon p.(Asp184Glyfs1*), was seen only in a small proportion of the father’s transcripts. A minigene experiment confirmed this effect in the majority of the minigene transcripts.

    This case report represents the 6th patient with variant NKH due to bi-allelic LIAS mutations. It illustrates the difficulties encountered by identification of single heterozygous coding or splice donor/acceptor variants in more than one candidate gene for a recessive condition.

    L. Pölsler: None. B. Mühlegger: None. S. Gang: None. P. Traunfellner: None. A. Amberger: None. K. Wimmer: None. S. Rudnik: None. J. Zschocke: None.

    E-P07 Immunology and Hematopoietic System

    E-P07.1 Novel Indel variants in the CALR gene in mieloproliferative neoplasm patients

    L. Gailite1, Z. Dobele1, D. Rots1, J. Isakova1, B. Janicka Kupra2, K. Bernate3, L. Belajeva2, L. Zarina2, S. Lejniece1

    1Riga Stradins University, Riga, Latvia, 2Riga East Clinical University Hospital, Riga, Latvia, 3Pauls Stradins University Hospital, Riga, Latvia

    Objectives: Mieloproliferative neoplasm (MPN) subtypes are diagnosed based on clinical and genetical data. JAK2 gene variants serves as diagnostic criteria for polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF), while CALR gene variants - for ET and PMF. The aim of the study was to summarize molecular data and utility of CALR gene indel testing in a clinical MPN cohort.

    Material and methods: In the study 354 patients with MPN were included. All patients were tested for JAK2 p.V617F variant by qPCR and CALR gene indels by fluorescent-fragment length analysis (PCR-FFLA). Sanger sequencing was performed to confirm and identify previously detected variants.

    Results: JAK2 gene variant p.V617F was identified in 208 (58.8%) patients. Indels in CALR gene were identified in 38 (10.7%) patients: 52bp deletion c.1099_1150del52 in 20 cases and 5bp insertion c.1154_1155insTTGTC in 12 cases. The rest six patients were identified to have rare variants: c.1103_1148del (2 patients), c.1111_1141del and novel variants - c.1107_1140del and complex indel - c.1131_1154delinsTTGTC (2 patients), that could be identified only with Sanger sequencing not by PCR-FFLA. CALR variant identification in two patients with previously diagnosed PV resulted in re-analysis of the clinical data and change of diagnosis to ET. For one patient JAK2 and CALR variant co-occurrence was identified.

    Conclusions: CALR testing should be performed for all MPN cases. CALR testing can help to distinguish PV from other MPN forms. Validation with Sanger sequencing is necessary to confirm and identify rare CALR variants.

    L. Gailite: None. Z. Dobele: None. D. Rots: None. J. Isakova: None. B. Janicka Kupra: None. K. Bernate: None. L. Belajeva: None. L. Zarina: None. S. Lejniece: None.

    E-P07.3 Young adult with co-occurrence of common variable immunodeficiency and Loeys-Dietz syndrome: near the end of the diagnostic odyssey?

    D. F. Osorio1, M. L. Agudelo1, O. I. Beltrán1,2

    1Facultad de Medicina, Universidad Militar Nueva Granada, Bogotá DC, Colombia, 2Unidad de Genética. Organización Colsanitas SA, Bogotá DC, Colombia

    Introduction: Patients with rare diseases often go undiagnosed for years while suffering from acute and/or chronic symptoms and signs that resulting in numerous health service use, multiple specialist involvement, and poor-quality life. The case report here describes a female adult with familial articular hyperlaxity due to Loeys-Dietz Syndrome found on exome sequencing and primary immunodeficiency confirmed by hypogammaglobulinemia

    Methods: a retrospective analysis of family history, detailed clinical history since infancy and adulthood, physical evaluation by geneticist for contrasting phenotype combined with immunological tests and trio exome sequencing

    Results: a 27-year-old woman of non-consanguineous parents; mother and aunts with symptoms of chronic myalgia, joint hyperlaxity, frequent sprains. Sister presented multiple dislocations that have required surgical interventions. Father shows a history of asthma, various atopies and depression. Since childhood, she presents mild hypotonia, myalgia, recurrent ankle and rotula sprains and chronic fatigue without an identified cause. During high school has suffered asthma, myopia, astigmatism, multiple foods, and medication allergies, inflammatory bowel disease, gastritis, overweight, depression and difficulties in learning. Face with downslanting palpebral fissures, cutaneous and joint hyperlaxity and skin striae. Normal echocardiography. Functional test revealed low serum IgG (5.76 g/L) and IgA (0.16 g/L), normal postvaccinal antibodies production, and a trio-based exome sequencing reporting a probably pathogenic variant (c.980G>A, p. Arg327Gln) in TGFB2 gene.

    Conclusion: Usually, cases with medical complexity can be explained by an extremely rare disease. However, another hypothesis diagnostic maybe that constellation of symptoms is due to the co-occurrence of two or more rare disease in an individual

    D.F. Osorio: None. M.L. Agudelo: None. O.I. Beltrán: None.

    E-P08 Intellectual Disability

    E-P08.02 Further clinical and molecular delineation of Alazami syndrome associated with variants in LARP7

    E. Gumuslu1, K. Karaer2, E. Gumus3, A. Ekici1, C. Kraus1, A. Reis1

    1Institute of Human Genetics, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany, 2Gaziantep Genetik Hastaliklar Tani Merkezi, Gaziantep, Turkey, 3Sitki Kocman University School of Medicine, Medical Genetics Department, Mugla, Turkey

    Autosomal recessive neurodevelopmental disorders are extremely heterogeneous and for many only few affected individuals have been described hampering delineation of the full spectrum of clinical presentation. In a large study of Turkish consanguineous families we identified a family with 3 affected siblings (two males 11 and 8 y.o. and one 5 y.o. female) all presenting with intellectual disability, severe verbal deficiency (2-3 words), short stature (<3p), delayed walking, seizures and dysmorphic features including malar hypoplasia, broad nose, short philtrum, wide mouth and full lips. After excluding aneuploidies exome sequencing revealed a novel frameshift insertion c.475_478dup, p.(Lys160Ilefs*2) in the LARP7 gene. LARP7 is a negative transcriptional regulator of polymerase II, acting by means of the 7SK RNP system.

    Frameshifting variants in LARP7 have been associated with Alazami Syndrome (OMIM 615071) characterized by ID, severe growth restriction and characteristic facial dysmorphisms. To date, 15 patients were reported. By comparing this family with the previously reported cases, we strengthen the key features of AS: ID, growth restriction, and highlight the facial features including malar hypoplasia, broad nose, full lips and teeth abnormalities. Interestingly, no cases with seizures were described, so far. As we failed to identify in exome sequencing any variant in seizure associated genes and all three siblings are concordant we wondered if this symptom is part of the clinical spectrum of AS. Although we cannot exclude an undetected cause independent of LARP7, we propose that seizures are a so far undescribed symptom associated with Alazami Syndrome.

    E. Gumuslu: None. K. Karaer: None. E. Gumus: None. A. Ekici: None. C. Kraus: None. A. Reis: None.

    E-P08.03 Genomic and clinical characterisation of microduplications in a patient with developmental delay

    D. Nestoroska, V. Anastasovska, E. Sukarova-Angelovska, M. Pesevska, G. Ilieva

    Genetic Laboratory, University Pediatric Clinic, Skopje, Macedonia, The Former Yugoslav Republic of

    Introduction: The implementation of array Comparative Genomic Hybridization (aCGH) allows efficient genetic diagnosis of pathological conditions before their full clinical manifestation. Application of novel “genotype-first” diagnosis is of great importance to the patient’s health and medical outcome due to higher rates of chromosomal abnormalities detection compared to conventional karyotyping and multiple ligation-dependent probe amplification (MLPA) analysis.

    Materials and methods: The aCGH technique was used to determine the genetic background of developmental abnormalities in a 8-year-old female Macedonian patient. The blood-derived DNA sample was analyzed using the Affymetrix® CytoScanTM 750K Array (Applied Biosystems) that includes 550 k non-polymorphic and 200 k SNP markers. The data were interpreted by using Chromosome Analysis Suite (ChAS) Software (v4.0).

    Results: The patient showed the following clinical conditions: motor delay, deafness, lack of concentration and several dysmorhological features (blepharophymosis, telecanthus, narrow palpebral fissures, wide nose, low set ears, small mouth and arched eyebrows). Noteworthy, the girl was operated from atrial septal defect and was previously diagnosed with Ohdo Sy. Karyotyping results revealed a normal female 46, XX karyotype, while the MLPA analysis for microdeletions was negative. The aCGH analysis detected a pathological microduplication occurring at the 10q26.3 cytoregion (787 kb, 26 genes included), as well as mosaic presence of 3 copies of the Xq26.3q28 cytoregion (15,864 kb, 115 genes included).

    Conclusion: The present chromosomal abnormalities detected by aCGH analysis could be responsible for the developmental delay of the patient, considering their pathological expression according to ClinVar database. Further studies are needed to confirm these preliminary findings.

    D. Nestoroska: None. V. Anastasovska: None. E. Sukarova-Angelovska: None. M. Pesevska: None. G. Ilieva: None.

    E-P08.05 BRAT1-related neurodevelopmental disorders: two unrelated patients - one previously undescribed mutation

    B. Eichhorn1, S. Weidensee2, H. Reichenbach3, M. Klaus1

    1MVZ Mitteldeutscher Praxisverbund Humangenetik GmbH, Dresden, Germany, 2MVZ Mitteldeutscher Praxisverbund Humangenetik GmbH, Erfurt, Germany, 3MVZ Mitteldeutscher Praxisverbund Humangenetik GmbH, Leipzig, Germany

    BRAT1 gene mutations cause lethal neonatal rigidity and multifocal seizure syndrome (RMFSL) or neurodevelopmental disorder with cerebellar atrophy with or without seizures (NEDCAS), inherited in an autosomal-recessive manner. RMFSL is characterized by lack of developmental progress, neonatal onset hypertonia, microcephaly, intractable seizures and death before the age of two years, whereas NEDCAS results in milder clinical course. Here, we report a 2 9/12-year-old girl with severe global developmental delay (absent speech, no sitting), short stature, microcephaly, mild facial dysmorphism, brain ventricle enlargement and stereotypic hand movements. The second female patient showed also profound developmental disability (no head control), lack of eye contact with ocular motility disturbance, microcephaly, and mild facial dysmorphism. Epileptic seizures occurred at the second day of life. She died at 17 months. A panel diagnostic via sequencing by synthesis was conducted, including candidate genes contributing to neurodevelopmental disorders. Patient 1 and 2 each carried a well-described mutations causing either RMFSL or milder phenotype (c.638dupA/p.(Val214Glyfs*189)) and involved in a RMFSL (c.2125_2128delTTTG/p.(Phe709Thrfs*17)), respectively. Additional, both girls harbour the identical previously undescribed variant c.2164_2165delinsGA/p.(Leu722Asp) resulting in a missense mutation. Generally, amino acid substitutions in BRAT1 gene in homozygous or compound heterozygous state have been described to be causative for neurodevelopmental disorders. Segregation analysis in our families confirmed compound heterozygosity. There is a strong evidence for the disease causing effect of the unknown mutation in the BRAT1 gene, due to the evidence in two unrelated cases. Although a genotype-phenotype correlation is not noticeable for this variant.

    B. Eichhorn: None. S. Weidensee: None. H. Reichenbach: None. M. Klaus: None.

    E-P08.06 Phenotypic presentation of two additional individuals with heterozygous variants in BRSK2

    H. Kemmer1, B. Popp2,3, A. Verloes4, D. Horn1, M. Holtgrewe5, C. Zweier3, N. Ehmke1

    1Institute of Medical Genetics and Human Genetics, Charité-Universitaetsmedizin Berlin, Berlin, Germany, 2Institute of Human Genetics, University of Leipzig Hospitals and Clinics, Leipzig, Germany, 3Institute of Human Genetics, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany, 4Department of Genetics, APHP-Robert DEBRE University Hospital, Denis Diderot School of Medicine, Paris University, Paris, France, 5Core Unit Bioinformatics - CUBI, Berlin Institute of Health, Berlin, Germany

    Introduction: Loss-of-function variants in BRSK2 have recently been described as causative for a neurodevelopmental phenotype in 12 individuals with speech delay and variable additional features including intellectual disability, motor delay, behavioral issues and autism. Here we provide a detailed clinical description of two further individuals with variants in BRSK2.

    Materials and methods: We performed phenotype analysis and exome sequencing on two individuals with intellectual disability and developmental delay of unknown cause.

    Results: We identified two previously undescribed heterozygous variants in BRSK2: the frameshift variant c.1398del; p.(Ser467Alafs*42) and the de novo missense variant c.209T>C; p.(Leu70Pro). Both individuals presented with developmental delay/mild intellectual disability with pronounced speech delay. One individual had unilateral renal agenesis and inguinal hernia, which have not been described in individuals with BRSK2 variants before.

    Conclusion: Our data provide further insight into the BRSK2-associated phenotype. So far, no genotype-phenotype correlation can be determined.

    H. Kemmer: None. B. Popp: None. A. Verloes: None. D. Horn: None. M. Holtgrewe: None. C. Zweier: None. N. Ehmke: None.

    E-P08.08 New insights into the phenotype of COL4A3BP-related intellectual disability: an emerging Golgipathy

    J. R. Alves1, J. Dupont1, J. P. Monteiro2, A. B. Sousa1

    1Serviço de Genética Médica, Hospital de Santa Maria, Centro Hospitalar e Universitário Lisboa Norte, Lisboa, Portugal, 2Serviço de Pediatria, Hospital Garcia de Orta, Almada, Portugal

    Introduction: COL4A3BP encodes a protein implicated in intracellular ceramide transport to the Golgi complex. De novo missense variants in this gene have been linked to developmental disorders (DD) in a large-scale study of patients with severe undiagnosed DD (Fitzgerald et al., 2015). Only five patients have been reported to date and clinical data remains very scarce. We report a new patient with COL4A3BP-related intellectual disability (ID) aiming to contribute to the recognition of this condition.

    Materials and methods: Clinical data was collected from the patient’s medical records and compared with previous reports from scientific literature and databases.

    Results: A 5 year-old girl with unremarkable family history, pregnancy and delivery, presented with postnatal microcephaly, axial hypotonia, and severe global developmental delay. Short stature and facial dysmorphisms were noted and, at 24 months, she developed generalized seizures. Currently, she does not walk unaided, says only one word, and has poor visual contact and marked stereotypic behavior with bruxism. Whole exome sequencing identified a de novo pathogenic variant in COL4A3BP (S260L).

    Conclusions: This missense variant was previously found in 4 out of 5 known patients, suggesting a mutational hotspot in this gene. Former functional evidence indicates it results in intracellular imbalances in ceramide, pivotal to the synthesis of sphingolipids. Our case has significant overlap with clinical data from previous patients. This report adds evidence to an emerging consistent phenotype associated with COL4A3BP mutations, characterized by severe ID, postnatal microcephaly, epilepsy, autistic behavior including striking bruxism, and unspecific dysmorphic features.

    J.R. Alves: None. J. Dupont: None. J.P. Monteiro: None. A.B. Sousa: None.

    E-P08.09 Paediatric patient with deletion on chromosome 10q11.22 diagnosed by aCGH

    M. Pesevska, V. Anastasovska, E. Sukarova-Angelovska, D. Nestoroska, G. Ilieva

    University Pediatric Clinic, Skopje, Macedonia, The Former Yugoslav Republic of

    Introduction: The microchip-based diagnostic practices become widely introduced in postnatal diagnosis of individuals with developmental delay and dysmorphism. Array Comparative Genomic Hybridization (aCGH) technology to whole human genome screening revealed an unexpectedly large number of deletions and duplications.

    Materials and methods: aCGH analysis was perform in pediatric patient with dysmorphia and motor delay using the CytoScan_750k Array platform (Affymetrix) which comprises 550 k non-polymorphic and 200 k SNP markers by the Chromosome Analysis Suite (ChAS) Software (v4.0).

    Results: Our patient was born with small birth weight with idiopathic thrombocytopenia during the neonatal period. At the age of 4 years, she has short stature and following sings of dysmorphia - sparse hair, baldness in infancy, slow growing hair, wide fontanel, dry skin, no sweating, small teeth, deep set eyes, wide nasal tip, smooth philtrum, up slanted palpebraes, protruded tongue in infancy, prominent forehead and some missing teeth-upper incisors. Hydronephrosis on the left kidney, reflux vesicaurinaria, atrial septal defect, dilatated pulmonary artery and CNS plexus hypertrophy were noticed by ultrasonography. Also, subclinical hypothyreosis was present. She has mild motor delay, started to walk at 20 months, first words spoken at 2.5 years with poor vocabulary at the moment. Good social skills were present. Karyotype was normal. aCGH analysis showed 1 pathogenic copy of the segment on the chromosome 10q11.22 (437 kb) including GPRIN2(611240) gene associated with brain development, according to aDGV and ClinVar databases.

    Conclusions: The application of microarray will expand the spectrum in diagnosing cytogenomic abnormalities by including complex structural variants.

    M. Pesevska: None. V. Anastasovska: None. E. Sukarova-Angelovska: None. D. Nestoroska: None. G. Ilieva: None.

    E-P08.10 Deletion 7q31.2q31.31 segregating in a family with speech and language deficiencies

    M. Rieger1, M. Krumbiegel1, M. Reuter1, A. Schützenberger2, A. Reis1, C. Zweier1

    1Institute of Human Genetics, Friedrich-Alexander-Universität Erlangen-Nürnberg FAU, Erlangen, Germany, 2Division of Phoniatrics and Pediatric Audiology, Department of Otorhinolaryngology, Head and Neck Surgery, Friedrich-Alexander-Universität Erlangen-Nürnberg FAU, Erlangen, Germany

    Deletions of chromosome 7q31 have been described in individuals with variable neurodevelopmental disorders and speech impairment. These deletions usually contain FOXP2, in which loss-of-function mutations represent a major cause for specific language and speech phenotypes. Recently, a single patient with developmental delay as well as speech and language impairment carrying a 3.2 Mb deletion in 7q31.2q31.31 excluding FOXP2 was reported. By chromosomal microarray analysis we now identified a similar microdeletion in three family members presenting with variable speech, language and neurodevelopmental phenotypes. The index patient presented with normal motor milestones but delayed speech development, reduced comprehension and an incomplete sentence structure at age 5 years. At age 10 years he attended a school for children with special needs and presented with microcephaly, attention deficits and slurred speech. His sister was referred at age 3 years with normal first milestones but a delay in speech development. Linguistic testing revealed impairment of all language and speech levels with limited vocabulary and slurred and imprecise pronunciation. The mother had attended a school focusing on speech and language deficiencies and now presented with slurred speech. Segregation analysis in the healthy, maternal grandparents did not detect the microdeletion, thus indicating de novo occurrence in the mother. The deletion contains 17 genes and is located in close proximity to the 3’ end of FOXP2, but not including it. Though positional effects on FOXP2 expression cannot be excluded, our findings support a new locus on 7q31.2q31.31 associated with mild neurodevelopmental and more prominent speech and language phenotypes.

    M. Rieger: None. M. Krumbiegel: None. M. Reuter: None. A. Schützenberger: None. A. Reis: None. C. Zweier: None.

    E-P08.11 Clinical significance of 2q37.1 duplication in patients with intellectual disability and facial dysmorphism

    Z. Capkova1,2, P. Capkova1,2, J. Srovnal1,3, K. Staffova1,3, K. Adamova1,2, J. Pazderova1, M. Hajduch3, M. Prochazka1,2

    1Department of Medical Genetics, University Hospital Olomouc, Olomouc, Czech Republic, 2Department of Medical Genetics, Faculty of Medicine and Dentistry, Palacký University Olomouc, Olomouc, Czech Republic, 3Institute of Molecular and Translational Medicine, Faculty of Medicine and Dentistry, Palacký University Olomouc, Olomouc, Czech Republic

    Background: 2q37 duplications including only ALPP, ALPPL2, DIS3L2 have been already described in patients with ID and facial dysmorphia. However, these duplications were concluded as benign variations based on inheritance from health parents.

    Aim: We report two unrelated patients with ASD, ID and facial dysmorphic features.

    Methods: Karyotyping, exclusion of CGG triplet repeats expansion in FMR1 and chromosomal microarray (CMA) were performed in both patients after informed consent collecting from their parents.

    Results: Chromosomal aberration and Fragile-X syndrome were excluded in both. 2q37 duplication including ALPP, ALPPL2, DIS3L2 was revealed by CMA. In patient 1 the duplication was inherited from father. Inheritance was unknown in patient 2. No other clinically relevant CNVs were observed.

    Clinical and genetics features of both patients
    FeaturePatient 1Patient 2
    Height<3th percentile40th percentile
    Head circumference<3th percentile34th percentile
    Weight<3th percentile23th percentile
    Body mass index (BMI)15.0215.50
    Add clinical featuresmicrocephalynone
    Coordinate (GRCh37)233195538-233318065233195538-233311912
    Length123 kb116 kb
    Overlapped coding genesALPP, ALPPL2, DIS3L2ALPP, ALPPL2, DIS3L2
    Inheritancefatherunknown

    Discussion and conclusion: Duplication of 2q37 including DIS3L2 is assumed as benign (DECIPHER, ISCA, ClinVar). We described two unrelated patients with ASD, ID and facial dysmorphia who carried the duplication of 2q37 including DIS3L2. We suggest that this CNV might cause of abnormal phenotype with variable penetrance. Of course, we cannot exclude a nucleotide level changes which could explain a variable penetrance of 2q37 duplication. Acknowledgment: Supported by MH_CZ_DRO_FNOL_00098892, IGA_LF_2020_007

    Z. Capkova: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; University Hospital Olomouc, Palacký University Olomouc. P. Capkova: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; University Hospital Olomouc, Palacký University Olomouc. J. Srovnal: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; University Hospital Olomouc, Palacký University Olomouc. K. Staffova: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; University Hospital Olomouc, Palacký University Olomouc. K. Adamova: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; University Hospital Olomouc, Palacký University Olomouc. J. Pazderova: None. M. Hajduch: None. M. Prochazka: None.

    E-P08.14 Early neurodevelopmental milestones acquisition in fragile X syndrome, a caregivers online report

    C. Azevedo Soares1,2, D. Gonzaga3, I. Vaz Matos3, N. Tkachenko1, A. Fortuna1,2, G. Soares1, A. Prior3

    1Centro de Genética Médica Jacinto Magalhães, Porto, Portugal, 2Unit for Multidisciplinary Research in Biomedicine, Instituto de Ciências Biomédicas Abel Salazar/Universidade do Porto, Porto, Portugal, 3Unidade de Neurodesenvolvimento, Serviço de Pediatria, Centro Materno-Infantil do Norte, Centro Hospitalar Universitário do Porto, Porto, Portugal

    Introduction: Fragile X syndrome (FXS) is a genetic disorder affecting neurodevelopment caused by FMR1 dysfunction. The identification of developmental delay patterns could accelerate the diagnostic of FXS in a population of children with development delay.

    Methods: We designed an online survey in which FXS patients’ caregivers indicated patients characteristics. We used the Haizea-Llevant development scale as a reference of normalcy. Time of acquisition was expressed as months old (mo) and for each milestone timing it was calculated the median (M) and P25 and P75 (P25-P75).

    Results: Fifteen cases were considered for analysis: three females and 12 males. The median age for postnatal diagnosis was 48 mo: 36 mo for males and 72 mo for females. Male FXS patients showed a delayed acquisition of early milestones such as cervical control (M= 6mo, 2-12 mo) with normal median time of acquisition of the first word (M= 13mo, 11.75-21mo), and delayed acquisition of autonomous walking (M= 22mo, 16.5-24 mo). Given the small number of female FXS in our study, it was not possible to conclude if females had a characteristic pattern of developmental delay.

    Conclusions: FXS patients present a biphasic delayed development in the first two years of life with an important delay on the acquisition of gross motor skills. Nevertheless, the clinical presentation was highly variable to allow the discrimination these patients with FXS by their pattern of developmental delay. Notwithstanding, this work bring the attention to the early gross motor skills impairment in FXS, that can be improved with targeted interventions.

    C. Azevedo Soares: None. D. Gonzaga: None. I. Vaz Matos: None. N. Tkachenko: None. A. Fortuna: None. G. Soares: None. A. Prior: None.

    E-P08.16 A case of autosomal recessive spinocerebellar ataxia type 18 with a novel mutation in GRID2

    K. L. M. L. Hetzelt1, C. Kraus1, S. Kusnik2, C. Thiel1, A. B. Ekici1, A. Reis1, C. Zweier1

    1Institute of Human Genetics, Friedrich-Alexander-Universität Erlangen-Nürnberg FAU, Erlangen, Germany, 2Department of Pediatrics, University Hospital for Children and Adolescents, Friedrich-Alexander-Universität Erlangen-Nürnberg FAU, Erlangen, Germany

    Autosomal-recessive spinocerebellar ataxia type 18 is a rare genetic neurologic disorder. It is caused by homozygous or compound-heterozygous mutations in the GRID2 gene, encoding an ionotropic glutamate receptor. So far, seven affected individuals from three unrelated families have been reported. The disorder is characterized by delayed psychomotor development, intellectual disability, severely impaired gait due to progressive cerebellar ataxia, ocular movement abnormalities, and progressive cerebellar atrophy in brain imaging. By trio exome sequencing, we now identified a novel homozygous variant (c.568C>T; p.Gln190*) in GRID2 in a four year old female patient from a consanguineous Iraqi family. Both parents were confirmed to be heterozygous carriers. The patient was born after uneventful pregnancy and showed early-onset severe delayed psychomotor development. At the age of 4 years, she does not sit, walk or speak and presents with severe muscular hypotonia. Further clinical characteristics are a distinct truncal and appendicular progressive ataxia and binocular vertical nystagmus with a high frequent horizontal component, central hearing loss and incomplete loss of sight. She does not fix objects or interacts with people. She is dystrophic with a weight under the third percentile of the central European standard. Eating hair and gnashing of teeth are striking behaviors. In addition, cerebral magnetic resonance imaging (MRI) showed cerebellar hypoplasia. Our findings further delineate the mutational and clinical spectrum of GRID2 associated spinocerebellar ataxia type 18.

    K.L.M.L. Hetzelt: None. C. Kraus: None. S. Kusnik: None. C. Thiel: None. A.B. Ekici: None. A. Reis: None. C. Zweier: None.

    E-P08.17 A novel patient helps to define the phenotype, developmental trajectory and clustering of de novo missense mutations in the HECW2 syndrome

    S. Bendova1, M. Vlckova1, M. Hancarova1, D. Prchalova1, V. Stranecky2, Z. Sedlacek1

    1Department of Biology and Medical Genetics, Charles University 2nd Faculty of Medicine and University Hospital Motol, Prague, Czech Republic, Prague, Czech Republic, 2Department of Pediatrics and Adolescent Medicine, Diagnostic and Research Unit for Rare Diseases, Charles University 1st Faculty of Medicine and General University Hospital, Prague, Czech Republic, Prague, Czech Republic

    De novo variants in HECW2, which encodes the HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2, were initially identified in large exome sequencing (ES) studies. A series of seven patients clearly associated HECW2 with a neurodevelopmental disorder with hypotonia, seizures and absent language (OMIM #617268) in 2017. Since then only two novel case reports have been published. We present the genotype, phenotype and developmental trajectory of a new patient, and review all previous cases. The 8-year-old boy has hypotonia, microcephaly, failure to thrive, severe intellectual disability, absent speech, and seizures. His facial features include prominent upper lip and strabismus. Trio ES identified de novo variant Chr2(GRCh37):g.197106886C>T, NM_001348768.1(HECW2):c.3572G>A, p.(Arg1191Gln). The variant has been reported in three previous patients, and is considered causal for the HECW2 syndrome. The phenotype of the patient fits the previous cases; however, he also has a ventricular septum defect, and he neither has abnormal brain MRI findings nor requires gastrostomy tube feeding. Long-term follow-up shows regression of motor skills around 12 months, abnormal EEG findings since 14 months (prompting anti-epileptic therapy), and self-injurious behaviour and sleep disturbances since 45 months of age. Our analysis (including variants from large studies and databases) indicates that deleterious missense HECW2 variants cluster in exons encoding the HECT domain and its adjacent region (exons 20-29, with residues Arg1191, Arg1330 and Glu1445 being the hotspots), and possibly also the WW2 domain (exons 12-13). Concurrently, these regions are deserts for missense variation in normal individuals. Supported by 17-29423A, LM2018132 and 00064203.

    S. Bendova: None. M. Vlckova: None. M. Hancarova: None. D. Prchalova: None. V. Stranecky: None. Z. Sedlacek: None.

    E-P08.18 A novel PGAP3 mutation in two siblings with hyperphosphatasia with mental retardation syndrome

    F. Hazan1, S. Gürsoy2, P. Karaoğlu3, Ü. Yılmaz3

    1Department of Medical Genetics, Dr. Behcet Uz Children’s Hospital, Izmir, Turkey, 2Department of Pediatric Genetics, Dr. Behcet Uz Children’s Hospital, Izmir, Turkey, 3Department of Pediatric Neurology, Dr. Behcet Uz Children’s Hospital, Izmir, Turkey

    Introduction: Hyperphosphatasia with mental retardation syndrome (HPMRS) OMIM # 239300), is an autosomal recessive disorder characterized facial dysmorphism, intellectual disability, seizures, cardiac abnormalities, developmental delay and elevated alkaline phosphatase. Six subgroups of HPMRS were idefined in which pathogenic mutations affect genes involved in either synthesis (PIGV, PIGW, PIGO, PIGY) or remodeling (PGAP2, PGAP3) of the anchor proteins.

    Material and methods: A two year-old girl patient was referred to our genetic clinic for intellectual disability and hypotonia. There was a first-degree consanguinity between the parents. This patient had microcephaly, facial dysmorphism including upslanting palpebral fissure, bulbous nose, cleft lip and palate, pectus excavatum, intellectual disability, developmental delay, hypotonia and increased alkaline phosphatase level. One out of three sisters of index patient had similar clinical features. The other family members were healthy. Whole exome sequencing (WES) was performed to the index patient. Sanger seguencing analysis was used for family segregation analysis.

    Results: A novel homozygous mutation (c.715_717delTGG; p.Trp239del) of PGAP3 gene was detected with WES analysis in the index patient (NM_033419.5). Family segregation analysis was performed and bioinformatic tools were used for the evaluation of this novel variant. The same homozygous mutation was noted by sanger seguencing analysis in her younger sister, who had similar clinical features. Both parents and the other healthy sisters were heterozygous for this mutation.

    Conclusions: We report e novel homozygous mutation of PGAP3 gene. HPMRS should be kept in mind in patients with developmental delay, hypotonia, cleft palate and mild to moderate serum ALP elevation.

    F. Hazan: None. S. Gürsoy: None. P. Karaoğlu: None. Ü. Yılmaz: None.

    E-P08.19 A 3-year old girl with Hypotonia, Ataxia, And Delayed-Development Syndrom (HADDS)

    K. Khuller1, T. Haack2, C. Finetti3, F. J. Kaiser1, A. Kuechler1

    1Institut für Humangenetik, Universitätsklinikum Essen, Universität Duisburg-Essen, Essen, Germany, 2Institut für Medizinische Genetik und Angewandte Genomik, Tübingen, Germany, 3SPZ, Elisabeth-Krankenhaus, Essen, Germany

    Hypotonia, ataxia, and delayed development syndrome (HADDS, OMIM #617330) is a neurodevelopmental syndrome characterized by congenital hypotonia, delayed psychomotor development, variable intellectual disability with speech delay, variable dysmorphic facial features, and ataxia, often associated with cerebellar hypoplasia. In 2017, heterozygous variants in EBF3 are described for the first time by three parallel publications in 2017 as causative for HADDS (Chao et al., 2017, Harms et al., 2017, Sleven et al., 2017). At present, 23 patients with different types of mutations including missense, frameshift or nonsense mutations as well as variants affecting conserved splice elements are reported. All reported cases showed a heterogenous phenotype. We report on a case of a 3-year old girl with a class 5-mutation in EBF3, detected by Next-Generation-Sequencing. She presented with delayed development, microcephaly, ataxia, reflux, and feeding difficulties. She also showed a thermoregulatory dysfunction, which was not observed in other affected individuals so far. We present detailed clinical data of our patient in the context of the current literature thus expanding the phenotypic spectrum of the HAAD syndrome.

    K. Khuller: None. T. Haack: None. C. Finetti: None. F.J. Kaiser: None. A. Kuechler: None.

    E-P08.20 TMEM222 is a new cause of autosomal recessive intellectual developmental disorder

    O. Levchenko, N. Demina, A. Lavrov

    Research centre for medical genetics, Moscow, Russian Federation

    Introduction: The prevalence of autosomal recessive intellectual developmental disorder (ARIDD) in affected children of an outbred population is estimated about 10%. There are 72 types of ARIDD described in OMIM. TMEM222 was once described as a candidate gene for ARIDD with moderate intellectual disability, speech delay, mild hypotonia, aggressiveness and body shivering.

    Materials and methods: Whole exome sequencing (WES) was performed using IlluminaTruSeq® ExomeKit and IDT xGen® Exome Research Panel on Illumina NextSeq 500.

    Results: We describe the Caucasian 31-year-old men born from consanguineous parents. Birth weight was 4800 g, condition severe. He had infantile spasms when woke up during first 2-8 months. He walks since 3 years with ataxia, speaks few words, understands speech and uses computer. Phenotype: hypotonia, microcephaly, hypothelorism, big nose, short philtrum, big mouth, full lips, gingival hyperplasia, small chin, broad and short distal phalanges, narrow feet with valgus deformity, broad big toe. His brother 11 years old has similar phenotype but with prominent incisors and seizures since birth. He cannot walk and speak. His birth weight was 4700 g. Their healthy sister had birth weight 3500 g. WES revealed homozygous splice variant c.539+2T>C NM_032125 in TMEM222. Sanger sequencing confirmed this variant as heterozygous in parents and sister, and homozygous in affected brother.

    Conclusions: Given the similarity of the phenotype with the previously described, the correspondence of segregation to the autosomal recessive type of inheritance, we suppose this variant to be causative. We describe new ARIDD with developmental delay, hypotonia, seizures, high birth weight and dimorphisms.

    O. Levchenko: None. N. Demina: None. A. Lavrov: None.

    E-P08.23 Patient with the Tatton-Brown-Rahman syndrome &lt de novo constitutive DNMT3A variant

    I. Jaszczuk1,2, I. Winkler3, A. Sobczyńska-Tomaszewska4, M. Lejman5, A. Pietrzyk4, M. Kacprzak4

    1University Children’s Hospital, Department of Pediatric Hematology, Oncology and Transplantology, Lublin, Poland, 2Department of Cancer Genetics with Cytogenetic Laboratory, Medical University, Lublin, Poland, 3St’Johns Center Oncology, Lublin, Poland, 4MedGen Medical Centre, Warsaw, Poland, 5Genetic Diagnostics, Department of Pediatric Hematology, Oncology and Transplantology, Medical University, Lublin, Poland

    Introduction: Tatton-Brown-Rahman syndrome (TBRS; OMIM 615879) is an overgrowth and intellectual disability syndrome, first described in 2014. Additional clinical features include dysmorphic features, obesity, musculoskeletal disorders (hypotonia, hypermobility, kyphoscoliosis) and behavioural problems (autistic spectrum disorders) and afebrile seizures. The underlying cause of the syndrome is constitutive variants in the DNMT3 gene. We present an 11-old boy with recognized Tatton-Brown-Rahman syndrome and confirmed variant in the DNMT3 gene.

    Materials and methods: During molecular diagnostic procedure analysis of FMR1 gene for FRAXA syndrome and panel of 264 genes correlated with autism and mental retardation (NGS) were performed.

    Results: For FMR1 gene expansion of CGG repeats was not identified. NGS analysis allowed identification of known heterozygotic variant p.Pro904Leu (c.2711C>T) in the DNMT3A. This variant is reported in dbSNP database (rs149095705) and ClinVar Database as likely pathogenic. Molecular analysis of p.Pro904Leu was also performed for proband’s mother and sister were mutation was not identified. Unfortunately the father’s material was not available for genetic analysis. There is high probability of de novo character of identified variant.

    Conclusions: In the case of patients with intellectual disability and obesity, Tatton-Brown-Rahman syndrome should be considered in the differential diagnosis. Studies using the NGS technique facilitate the diagnosis of patients with intellectual disabilities.

    I. Jaszczuk: None. I. Winkler: None. A. Sobczyńska-Tomaszewska: None. M. Lejman: None. A. Pietrzyk: None. M. Kacprzak: None.

    E-P08.24 Biallelic NALCN variant detected by homozygosity mapping and whole exome sequencing in a consanguineous family from Turkey

    S. Susgun1,2,3, E. Yucesan1, O. Kocaturk4, M. Calik5, U. Ozbek2,6, S. Ugur Iseri2

    1Department of Medical Biology, Faculty of Medicine, Bezmialem Vakif University, Istanbul, Turkey, 2Department of Genetics, Aziz Sancar Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey, 3Graduate School of Health Sciences, Istanbul University, Istanbul, Turkey, 4Department of Neurology, Faculty of Medicine, Harran University, Sanliurfa, Turkey, 5Department of Pediatric Neurology, Faculty of Medicine, Harran University, Sanliurfa, Turkey, 6Department of Medical Genetics, School of Medicine, Mehmet Ali Aydinlar Acibadem University, Istanbul, Turkey

    Neurodevelopmental disorders (NDD) are a large and heterogeneous group of diseases including intellectual disability, developmental delay and autism spectrum disorders. Several ultra rare NDD associated variants in numerous genes specific almost to single families have been identified by unbiased next generation sequencing technologies. To determine the genetic component of NDD in a consanguineous family from Turkey, we have performed SNP-based homozygosity mapping in the family along with whole exome sequencing (WES) in the affected sib pair.

    The SNP genotyping data generated on two different array chips was combined with PLINK to detect homozygous stretches common to the affected sib pair. The WES data was filtered for rare alleles with predicted pathogenic impact on protein function in the homozygous loci. This collective effort has led us to identify a loss of function variant in NALCN in the homozygous state. Sanger sequencing has confirmed segregation of this variant with the NDD phenotype in the pedigree. NALCN encodes a member of sodium leak channel complex and is associated with a recessive OMIM phenotype; Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 (MIM:615419)

    Our study presents the combined analysis of linkage and exome analysis as a powerful and precise tool to diagnose a clinically rare and recessively inherited condition on molecular level. We are planning to analyze possible functional effects for the variant using in vitro studies to enlighten the molecular pathogenesis.

    This work has been supported by the grants of TUBITAK (113S331) and TUBA GEBIP 2019 program and Bezmialem Vakif University Scientific Research Support Unit (Project no:12.2019/9)

    S. Susgun: None. E. Yucesan: None. O. Kocaturk: None. M. Calik: None. U. Ozbek: None. S. Ugur Iseri: None.

    E-P08.27 Laryngomalacia, recurrent overgrowth of pharyngeal lymphoid tissue, mild developmental delay and macrocephaly in a girl with a de novo heterozygous mutation in ZBTB7A

    C. von der Lippe1, K. Tveten1, Ø. L. Holla1, Ø. L. Busk1, M. G. Haug2, W. Thorstensen3,4, A. K. Aasebøstøl3, T. Prescott1

    1Dept of Medical Genetics, Telemark Hospital Trust, Skien, Norway, 2Dept of Medical Genetics, St. Olavs University Hospital, Trondheim, Norway, 3Dept of Otolaryngology, Head and Neck Surgery, St. Olavs University Hospital, Trondheim, Norway, 4Dept of Neuromedicine and Movement Science, Norwegian University of Science and Technology (NTNU), Trondheim, Norway

    Case: This 12-year-old girl had a congenital umbilical hernia and laryngomalacia, as well as frequent upper airway infections, obstructive sleep apnea and serious otitis media from infancy. Strikingly, recurrent pharyngeal lymphoid hyperplasia has necessitated 17 surgical procedures; starting at age 15 months old. Her thymus is described as large for her age. Generalized lymphadenopathy / hepatosplenomegaly are absent. She has mild motor and language delay. Current measurements are height 25%, weight 4 kg > 97,5%, head circumference 97,5%. WES-trio detected a de novo nonsense variant in ZBTB7A, NM_015898.3:c.832G>T p.(Glu278*). The variant is not present in gnomAD, and the gene is LoF-intolerant (pLI=0.96; O/e=0:07) and is predicted to result in NMD. No other SNVs of interest were detected, and a 180k array CGH analysis was unremarkable.

    Discussion: ZBTB7A (OMIM #605878) encodes the leukemia/lymphoma related factor, LRF ZBTB7A is a candidate gene for some phenotypic features reported in individuals with microdeletions of chromosome 19p13.3; notably macrocephaly, obesity, sleep apnea, umbilical hernia, learning difficulties and developmental delay (1,2) - all features present in the girl we describe. Ohishi et al. (3) recently reported a boy with macrocephaly, intellectual disability and sleep apnea who had a de novo likely pathogenic heterozygous missense variant in ZBTB7A.

    Conclusion: We believe that the de novo ZBTB7A variant in our patient is the cause of her distinct phenotype -- laryngomalacia, recurrent overgrowth of pharyngeal lymphoid tissue, macrocephaly and delayed motor and language development.

    C. von der Lippe: None. K. Tveten: None. Ø.L. Holla: None. Ø.L. Busk: None. M.G. Haug: None. W. Thorstensen: None. A.K. Aasebøstøl: None. T. Prescott: None.

    E-P08.31 Study of diagnostic yield of genetic studies in neuronal migration disorders

    N. Ortiz Cabrera, M. Vilar Egea, B. Fernández Garoz, V. Cantarín Extremera, A. Duat Rodríguez, L. González Gutierrez Solana, M. Jimémez Legido, V. Soto Insuga, M. Ruiz Falcó, J. García Peñas

    Hospital Infantil Universitario Niño Jesús, Madrid, Spain

    Neuronal migration is the key factor in lamination of cerebral cortex. At 12th day stage of development neuronal progenitors begin migration. Excitatory neurons are born in the dorsal ventricular zone and migrate superficially to the cortical plate. These neurons migrate along the vertical fibers of the radial glia. The layers of the cortex form in an “inside-out” sequence with later born neurons migrating past their predecessors in the cortical plate so that they are more superficial in their final position than earlier born neurons(1).

    The neuronal migration disorders (NMD) include: lissencephaly, periventricular heterotopia, polymicrogyria (PMG) and cortical dysplasias(2). NMD present with: epilepsy, developmental delay (DD), intellectual disability (ID) and other malformation could be associated. Although the majority of this disorders have a genetic base, some environmental causes such as intrauterine infections could cause them(3). Today more than 100 genes have been related to NMD (3) including genes related to tubulinopathies (2).

    We did an observational study of NMD patients seen at the Clinical Genetic clinic from june 2018 until december 2019. We analyzed the results of NGS based genetic studies.

    Results: 29 patients were studied, the global diagnostic yield was 28%. We were able to detect large deletions using NGS. We found pathogenic variants in ARFGEF2, ARX, DEPDC5, DYNC1H1, NEDD4L, PAFAH1B and TCF20. Pathogenic variants in DEPDC5 were the most frequent pathogenic finding 29% of positive results.

    Conclusions: One third of patients with NMD will benefit from a genetic diagnosis. DEPDC5 is a frequently involved in this disorders.

    N. Ortiz Cabrera: None. M. Vilar Egea: None. B. Fernández Garoz: None. V. Cantarín Extremera: None. A. Duat Rodríguez: None. L. González Gutierrez Solana: None. M. Jimémez Legido: None. V. Soto Insuga: None. M. Ruiz Falcó: None. J. García Peñas: None.

    E-P08.32 The clinical utility of targeted NGS in neurodevelopmental disorders: a case of a girl with pontocerebellar hypoplasia caused by TSEN54 gene pathogenic variants

    M. Wayhelova1,2, V. Vallova1,2, E. Hladilkova2, H. Filkova2, J. Oppelt3, J. Soukalova2, P. Kuglik1,2

    1Department of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic, 2Department of Medical Genetics, University Hospital Brno, Brno, Czech Republic, 3CEITEC-Central European Institute of Technology, Masaryk University, Brno, Czech Republic

    Next-generation sequencing (NGS) techniques represent a widely used, powerful tool for the identification of the genetic causes of neurodevelopmental disorders and congenital abnormalities. We present a case of a girl (*2016) from the 3rd gravidity of healthy non-consanguineous couple (mother *1984, father *1978). She was diagnosed a global developmental delay, microbrachycephaly, severe dysplasia of brainstem and muscle hypertonia. She has a normal female karyotype 46,XX and normal array-CGH profile arr(1-22,X)x2. She was investigated by targeted NGS by gene panel ClearSeqXT Inherited Disease (Agilent Technologies) containing more than 2700 genes known to cause inherited disorders. We detected pathogenic variants in the TSEN54 gene in compound heterozygosity, NM_207346.2:c.[56+2T>G;160C>G];[919G>T]. The parents are healthy heterozygous carriers of these variants, as was confirmed by Sanger sequencing. Pathogenic variants of the TSEN54 are causative in extremely rare pontocerebellar hypoplasia (PCH) type 2A, 4 and 5. The combination of splicing and missense variants has been described in only one case of PCH5 so far, resulting in recurrent fetal lethality. Therefore, we suggest the TSEN54 pathogenic variants could have been the cause of previous recurrent abortions in the presented family. This case showed the usefulness and effectivity of our molecular diagnostics algorithm enhanced by NGS approaches to elucidate the molecular genetic causes in heterogeneous neurodevelopmental disorders. Supported by the project of Faculty of Science of Masaryk University MUNI/A/1127/2019 and IP UH Brno 2019 PIG 5/19.

    M. Wayhelova: None. V. Vallova: None. E. Hladilkova: None. H. Filkova: None. J. Oppelt: None. J. Soukalova: None. P. Kuglik: None.

    E-P08.33 Intrafamilial variability of Refsum syndrome

    S. Geuer, I. Schwaab, R. König

    Bioscientia, Ingelheim, Germany

    A consanguine Pakistani couple with two daughters affected by intellectual disability and developmental delay has been investigated by genetic diagnostics. The younger girl has more severe development delay and shows in contrast to her sister microcephaly, craniosynostosis and autistic behaviour. Whole exome sequencing of the more severe affected sister revealed a homozygous pathogenic variant in PEX5 - a gene known to be causative for autosomal recessive Refsum syndrome. Segregation analysis confirmed homozygosity of the variant in the other sister and heterozygosity of the parents. Whole exome sequencing did not detect another potential pathogenic variant. Thus, it can be concluded that the detected PEX5 variant causes a Refsum syndrome with uncharacteristic features and a high intrafamilial variability.

    S. Geuer: A. Employment (full or part-time); Significant; Bioscientia. I. Schwaab: A. Employment (full or part-time); Significant; Bioscientia. R. König: A. Employment (full or part-time); Significant; Bioscientia.

    E-P08.35 A further patient with Skraban-Deardorff syndrome: Presentation of the clinical and molecular phenotype of a rare intellectual disability syndrome

    A. Busche, M. Vockel, A. Bohring

    Institut für Humangenetik, Westfälische Wilhelms-Universität, Münster, Germany

    The Skraban-Deardorff syndrome (SKDEAS, OMIM#617616) is a rare genetic condition characterized by intellectual disability, a history of febrile and/or non-febrile seizures, and a recognizable facial appearance. SKDEAS is caused by heterozygeous mutations in WDR26 (OMIM*617424) and is inherited in an autosomal dominant pattern. To our knowledge only 15 patients have been reported so far.

    Here we present a 3 year and 3 months old boy with SKDEAS due to the heterozygous de novo mutation c.508G>T; p.(Gly170*) in WDR26. He has moderate intellectual disability and shows the characteristic facial gestalt comprising prominent forehead, bitemporal narrowing, large appearing eyes with rounded palpebral fissures, depressed nasal root, rounded nasal tip, anteverted nares, short philtrum, tended upper lips, full checks, and low set ears. He has widely spaced teeth and elongated gums. Since the age of 8 months he has fever/infection associated seizures but needs no permanent medication.

    In this report we present detailed clinical and molecular data of a new patient with SKDEAS to raise awareness of this clinically recognizable rare intellectual disability syndrome.

    A. Busche: None. M. Vockel: None. A. Bohring: None.

    E-P08.36 Two families with inherited protein truncating CHD3 variants suggest reduced penetrance in Snijders Blok-Campeau syndrome

    J. van der Spek1, J. den Hoed2, L. Snijders Blok1,2,3, C. W. Ockeloen1, M. E. H. Simon4, L. E. L. M. Vissers1,3, S. E. Fisher2,3, T. Kleefstra1,3

    1Department of Human Genetics, Radboud University Medical Center, Nijmegen, Netherlands, 2Language and Genetics, Max Planck Institute for Psycholinguistics, Nijmegen, Netherlands, 3Donders Institute for Brain, Cognition and Behaviour, Nijmegen, Netherlands, 4Department of Medical Genetics, University Medical Center Utrecht, Utrecht, Netherlands

    Chromodomain Helicase DNA-binding 3 (CHD3) is a chromatin remodeling ATPase which functions as an important subunit of the nucleosome remodeling and deacetylase (NuRD) complex. De novo mutations in CHD3 result in Snijders Blok-Campeau syndrome (#MIM618205), characterized by global developmental delays and/or intellectual disability, speech delay, macrocephaly, hypotonia and facial dysmorphism. The vast majority (~95%) of pathogenic mutations reported so far are missense mutations. Interestingly, CHD3 is predicted to be extremely intolerant for loss of function variance. Non-penetrance and/or variable expressivity has not been reported. Here we describe two cases with seemingly pathogenic, but inherited, protein truncating variants in CHD3.

    In a 4-year-old girl with global developmental delay, autism spectrum disorder, severe feeding difficulties, and facial dysmorphisms, fitting with the spectrum of Snijders Blok-Campeau syndrome, whole exome sequencing revealed a nonsense variant, p.(W1217*), in the CHD3 helicase domain. The variant was inherited from her healthy mother and grandmother.

    In a 3-year-old boy with developmental delays, predominated by speech delay, another maternally inherited nonsense variant, p.(S1443*), was found. Facially, he resembled the gestalt previously described for Snijders Blok-Campeau syndrome. His mother, in whom the variant was de novo, had macrocephaly and was otherwise unaffected.

    These two cases exemplify that protein truncating variants in CHD3 may result in reduced penetrance and/or variable expressivity. We are currently collecting more families with inherited CHD3 variants to enhance our understanding of disease penetrance in Snijders Blok-Campeau syndrome. Additionally, we will perform functional studies of these CHD3 variants to increase our insight in the underlying pathogenic mechanisms.

    J. van der Spek: None. J. den Hoed: None. L. Snijders Blok: None. C.W. Ockeloen: None. M.E.H. Simon: None. L.E.L.M. Vissers: None. S.E. Fisher: None. T. Kleefstra: None.

    E-P08.37 Snyder-Robinson syndrome with notable intrafamilial clinical variability detected by WES and PEDIA

    K. Cremer1, S. Hoffjan2, A. Schmidt1, S. Peters1, M. Kreiß1, E. Mangold1, M. Mücke3, H. Hundertmark1, F. Brand4, A. Heimbach1, A. Knaus4, A. Buness5, S. Sivalingam5, P. M. Krawitz4, H. Engels1

    1Institute of Human Genetics, University of Bonn, School of Medicine & University Hospital Bonn, Bonn, Germany, 2Institute of Human Genetics, Ruhr-University Bochum, Bochum, Germany, 3Center for Rare Diseases Bonn (ZSEB), University Hospital Bonn, Bonn, Germany, 4Institute for Genomic Statistics and Bioinformatics, School of Medicine & University Hospital Bonn, Bonn, Germany, 5Core Unit for Bioinformatics Data Analysis, University of Bonn, School of Medicine & University Hospital Bonn, Bonn, Germany

    Pathogenic variants in the spermine synthase (SMS) gene cause the X-linked recessive Snyder-Robinson syndrome (SRS, MIM #309583), which is characterized by developmental delay / intellectual disability (DD / ID), speech abnormalities, muscle and bone abnormalities, growth retardation, epilepsy, and facial dysmorphism. We report on two brothers with non-specific DD and muscular hypotonia. The older, nine-year-old brother showed motor developmental delay, speech abnormalities, intelligence in the lower average range (total IQ 89), asthenic build with a borderline tall stature, long fingers and toes, hyperextensible joints, and mild facial dysmorphism. The younger, two-year-old brother showed motor and speech developmental delay and a similar facial gestalt. Family history comprised a cousin (son of the mother’s sister) with global developmental delay (total IQ 50), muscular hypotonia and EEG abnormalities. An X-linked ID syndrome was suspected. Whole exome sequencing (WES) of both brothers was performed within the TRANSLATE-NAMSE care project. The resulting variants were prioritized using phenotype and image data (PEDIA / Prioritization of Exome Data by Image Analysis). A probably pathogenic hemizygous variant c.410A>G;p.(Asp137Gly) in the SMS gene was detected in both brothers and subsequently also in the affected cousin. The mothers are heterozygous carriers of the SMS variant. We emphasize the marked intrafamilial variability of intelligence from low normal to mild / moderate ID of this rare and possibly recognizable X-linked DD / ID syndrome.

    K. Cremer: None. S. Hoffjan: None. A. Schmidt: None. S. Peters: None. M. Kreiß: None. E. Mangold: None. M. Mücke: None. H. Hundertmark: None. F. Brand: None. A. Heimbach: None. A. Knaus: None. A. Buness: None. S. Sivalingam: None. P.M. Krawitz: None. H. Engels: None.

    E-P08.39 X-linked TAF1 intellectual disability - decoding a new neurodevelopmental entity in the genomic era

    R. Gouveia, O. Moldovan, A. B. Sousa

    Serviço de Genética, Hospital de Santa Maria, Centro Hospitalar e Universitário Lisboa Norte, Centro Académico de Medicina de Lisboa, Lisboa, Portugal

    Introduction: TAF1 is a subunit of the transcription factor IID complex important in embryogenesis and neuronal development. Recently, X-linked mental retardation 33 syndrome (MRXS33; MIM#300966) caused by pathogenic variants in TAF1 was described, featuring intellectual disability (ID), hypotonia, neurological abnormalities, and dysmorphic features. To our knowledge, 36 missense and a splice site pathogenic variants have been reported so far.

    Case Presentation: A 10-year-old boy with developmental delay was referred for genetic evaluation. He was the only child of non-consanguineous parents with no relevant family history. Atrial septal defect, restrictive muscle ventricle septal defect, mild Ebstein malformation, and axial hypotonia, were documented in the neonatal period. He evolved with moderate to severe ID, limited speech (barely 20 words), hypertonic lower limbs, ataxic gait, midline stereotypies, self-injurious behavior, and severe strabismus (surgically corrected). He had no autonomy for daily activities. Cerebral MRI was normal. On physical examination, he presented slight facial asymmetry, downslanted palpebral fissures, sunken eyes, bulbous nose, downturned corners of the mouth, micrognathia, and deep plantar creases. Karyotype, array-CGH, and metabolic investigation were normal.

    Results: Whole exome sequencing was performed after extensive investigation, revealing a hemizygous TAF1 variant: c.412+4A>G, affecting splicing. Maternal testing confirmed it was de novo.

    Conclusions: This variant, which had not been previously reported, was classified as probably pathogenic. According to the literature, this is the second pathogenic splice site variant described in TAF1. Our case shares common features with previously described patients, but there is wide clinical variability making WES/WGS best suited to reach a diagnosis.

    R. Gouveia: None. O. Moldovan: None. A.B. Sousa: None.

    E-P08.40 Analysis of the effect of a novel splice site variant in TGFBR2 on mRNA level

    G. Petraitytė;1, E. Siavrienė1, V. Mikštienė1, R. Norvilas2, B. Burnytė1, A. Utkus1, E. Preikšaitienė1

    1Department of Human and Medical Genetics, Institute of Biomedical Sciences, Faculty of Medicine, Vilnius University, Vilnius, Lithuania, 2Hematology, Oncology and Transfusion Medicine Center, Vilnius University Hospital Santaros Klinikos, Vilnius, Lithuania

    Introduction: TGF-β signaling pathway is a critical molecular pathway in a regulation of cell growth, development, and differentiation. One of the receptors of this pathway is encoded by TGFBR2 (MIM#190182) gene. Heterozygous pathogenic variants in TGFBR2 are the cause of Loeys-Dietz syndrome 2 (LDS2; MIM#610168), a disorder which mainly affects the connective tissue. Here we report a novel splice site variant in TGFBR2 gene and present its effect on mRNA level.

    Materials and methods: DNA of the proband was analyzed by next generation sequencing gene panel technology. In order to elucidate the pathogenicity of the identified splice site variant in the TGFBR2 gene, total blood mRNA of the proband was isolated, template cDNA was synthesized and quantitative PCR using TaqMan gene expression assay designed for TGFBR2 gene was performed.

    Results: TGFBR2 gene acceptor splice site variant NC_000003.12(NM_001024847.2):c.1600-2A>G was detected in proband’s DNA. Using different bioinformatics tools, this variant was predicted to be pathogenic and affecting mRNA splicing. Quantitative expression analysis of several TGFBR2 exons revealed that c.1600-2A>G causes loss of 5’ part of exon 8 - the last exon of analyzed transcript, presumably leading to a frameshift and a loss of part of Ser/Thr kinase domain and C-terminus of TGFBR2 protein.

    Conclusions: According to the proposed analysis results, splice site variant NC_000003.12(NM_001024847.2):c.1600-2A>G in TGFBR2 gene disrupts mRNA splicing leading to a truncated protein and causing LDS2.

    The work was funded by the Research Council of Lithuania (No. S-MIP-17-19/LSS-150000-1179).

    Keywords: TGFBR2, Loeys-Dietz syndrome 2, qPCR

    G. Petraitytė;: None. E. Siavrienė: None. V. Mikštienė: None. R. Norvilas: None. B. Burnytė: None. A. Utkus: None. E. Preikšaitienė: None.

    E-P08.41 A novel de novo truncating TRIM8 mutation associated with intellectual disability and renal failure.

    M. A. McClatchey1, Z. D. du Toit2, R. Vaughan1, S. D. Whatley3, S. Martins3, S. Hegde4, J. te Water Naude5, D. H. Thomas6, D. F. Griffiths6, Genomics England Research Consortium, A. J. Clarke1,3, A. E. Fry1,3

    1Division of Cancer and Genetics, Cardiff University, Cardiff, United Kingdom, 2Department of General Medicine, Glangwili General Hospital, Carmarthen, United Kingdom, 3All Wales Medical Genomics Service, Cardiff, United Kingdom, 4Children’s Kidney Centre, University Hospital of Wales, Cardiff, United Kingdom, 5Paediatric Neurology Service, University Hospital of Wales, Cardiff, United Kingdom, 6Department of Cellular Pathology, University Hospital of Wales, Cardiff, United Kingdom

    Introduction: Truncating mutations in the C-terminus of the TRIM8 protein have been reported in patients with severe developmental delay, intellectual disability and epilepsy. Only six previous patients have been reported (see Assoum et al PMID: 30244534). Three of the previous patients were noted to have proteinuria and one (a patient with epileptic encephalopathy) was diagnosed with nephrotic syndrome.

    Case Presentation: We describe an 8-year-old boy with mild intellectual disability who was found to have proteinuria at 2 years of age. Renal biopsy findings were suggestive of focal segmental glomerulosclerosis. The proteinuria persisted and the patient’s kidney function declined despite treatment. He had a renal transplant at 7 years of age. Prior to the transplant he had three generalized seizures which were controlled with sodium valproate. Trio-based whole genome sequencing as part of the 100,000 Genomes Project found a de novo heterozygous frameshift mutation in TRIM8 (NM_030912.2) c.1198_1220del, p.(Tyr400ArgfsTer2).

    Conclusion: The experience of this patient is further evidence that TRIM8 truncating mutations cause both neurological and renal features. This case also suggests the spectrum of disease associated with TRIM8 mutations may be wider than previously thought - with the potential for more severe kidney problems but milder intellectual disability. We highlight the need for proteinuria screening in patients with TRIM8 mutations.

    M.A. McClatchey: None. Z.D. du Toit: None. R. Vaughan: None. S.D. Whatley: None. S. Martins: None. S. Hegde: None. J. te Water Naude: None. D.H. Thomas: None. D.F. Griffiths: None. A.J. Clarke: None. A.E. Fry: None.

    E-P08.42 A recurrent ZC4H2 gene mutation associated with diverse neurological symptoms in a patient with Wieacker-Wolff syndrome

    G. Büki1,2, J. Zima1, B. Galik2, A. Gyenesei2, K. Hadzsiev1,2, B. Melegh1,2, J. Bene1,2

    1University of Pecs, Medical School, Clinical Center, Department of Medical Genetics, Pecs, Hungary, Pecs, Hungary, 2Szentagothai Research Center, University of Pecs, Pecs, Hungary, Pecs, Hungary

    Introduction: Wieacker-Wolff syndrome is an X-linked recessive neurodevelopmental disorder presenting e.g. intellectual disability, developmental delay, characteristic facial features and contractures of the feet. Relatively few cases have been reported so far with high clinical heterogeneity, especially amongst heterozygous females. The disease is caused by mutations in the ZC4H2 gene, altering a zinc finger domain-containing protein with four cysteine and two histidine residues.

    Materials and methods: Whole-genome sequencing was performed in a 5-year-old male patient to identify the disease-causing mutation. Libraries were prepared using TruSeqTM DNA PCR-Free HT Library Prep Kit (Illumina) and sequenced on NovaSeq 6000 platform (Illumina) with 150bp paired-end chemistry. The detected mutation was validated by Sanger sequencing.

    Results: A recurrent hemizygous missense mutation (c.593 G>A) in ZC4H2 gene was discovered in our patient and not in his parents. This mutation leads to an arginine-glutamine amino acid change and so far it was found only in one large family. However, our patient shares common hallmarks of the syndrome with the previously reported cases, the unique feature is that he does not present seizure and he has a severe speech delay.

    Discussion: Intra- and interfamiliar phenotypic variability is a well-known phenomenon in several Mendelian disorders. Among patients with Wieacker-Wolff syndrome only one recurrent mutation was reported in the ZC4H2 gene until now. Here we report another recurrent ZC4H2 gene mutation with diverse neurologic features. Our case supports the interfamiliar variability of the same mutation in this gene.

    G. Büki: None. J. Zima: None. B. Galik: None. A. Gyenesei: None. K. Hadzsiev: None. B. Melegh: None. J. Bene: None.

    E-P09 Neurogenetic and Psychiatric Disorders

    E-P09.02 Probably digenic Aicardi-Goutieres syndrome caused by heterozygous ADAR- and RNASEH2B- mutations- an extended case report

    M. Hempel1, A. Bley1, T. Bierhals1, K. Radig1, M. Lee-Kirsch2, C. Kubisch1

    1University Medical Center Hamburg-Eppendorf, Hamburg, Germany, 2Technical University Dresden, Dresden, Germany

    Introduction: Aicardi-Goutières syndrome (AGS) is an inflammatory disease associated with a broad phenotypic spectrum although an infantile sub-acute encephalopathy represents the classical manifestation. Mutations in seven genes have been identified causing monogenic AGS: TREX1, ADAR, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, IF1H1. The majority of patients carry biallelic mutations, however for specific variants in ADAR, TREX1 and IF1H1 a dominant effect has been described.

    Case report: We report on a boy presenting with muscular hypotonia and global developmental delay at the age of 6 months, who further developed slow regression, secondary microcephaly and movement abnormalities. A brain MRI revealed a leukencephalopathy with severe hypomyelination of cerebral white matter. Blood interferon signature showed the characteristic pattern of an interferonopathy type 1.

    Genetic results: Whole exome sequencing in the index and his healthy unrelated parents identified a maternally inherited recurrent mutation in RNASEH2B (p.Ala177Thr) and a paternally inherited very likely pathogenic variant in ADAR (p.Arg892Cys). Neither a second coding variant in these two genes nor other variants explaining the phenotype could be detected. Genome-wide CNV analysis did not show a relevant CNV, in particular not in AGS-associated genes. RNA analysis from skin fibroblasts verified both variants in a heterozygous state but could not detect a second aberration affecting the RNASEH2B or ADAR transcripts.

    Discussion: The patient reported here is affected by classical AGS. Extended genetic analysis revealed combined heterozygous mutations in RNASEH2B and ADAR as the most probably cause of disease strongly suggesting a digenic inheritance of AGS in this pedigree.

    M. Hempel: None. A. Bley: None. T. Bierhals: None. K. Radig: None. M. Lee-Kirsch: None. C. Kubisch: None.

    E-P09.03 The connection of COMT and receptor DRD2 polymorphisms with alcohol craving and hunger in people treated due alcohol dependence

    D. Czarnecki1, M. Ziółkowski1, A. Długosz2, J. Feldheim2, N. Waszkiewicz3, A. Kułak-Bejda3, M. Gorzkiewicz4, J. Budzyński5, J. Chodkiewicz6, A. Junkiert-Czarnecka7

    1Nicolaus Copernicus University, Department of Psychiatric Nursing, Torun, Poland, 2University of Technology and Life Sciences, Faculty of Chemical Technology and Engineering, Bydgoszcz, Poland, 3Medical University of Białystok, Department of Psychiatry, Choroszcz, Poland, 4Nicolaus Copernicus University, Department of Molecular Genetics and Justice, Torun, Poland, 5Nicolaus Copernicus University, Department of Vascular and Internal Diseases, Torun, Poland, 6University of Lodz, Institute of Psychology, Department of Health Psychology, Łódź, Poland, 7Nicolaus Copernicus University, Department of Clinical Genetics, Torun, Poland

    Introduction: In Poland about 25% patients maintains abstinence, after one year from finished of therapy. So it’s important, to identify the predictors of relapse of alcohol drinking. To the predictors belong among others alcohol craving, which in some patients is the strongly connected with hunger before meal. It is consider that polymorphisms of COMT and DRD2 genes are associated with increase of alcohol drinking. Aim of study was evaluation of connection, feeling of alcohol craving and hunger in patients with alcohol dependence with polymorphism of DRD2 (c.2137G>A) and COMT (c. 472G>A).

    Material and Methods: Studied 184 patients during hospitalization due to alcohol dependence and 99 people with control group. In study, used the scales: PACS, scale of hunger before meals and also molecular testing of COMT and DRD2 polymorphism.

    Results: Patients without COMT polymorphism, but with polymorphism of DRD2 (genotype G/A) felt high values of alcohol craving, which did not decrease during 4 weeks of therapy (7.18 vs. 7.00; p>0.05). At the same time, patients felt strongly hunger, which did not decrease during 4 weeks of therapy (13 vs. 11; p>0.05). The observation, suggest, that it can be extracted, based on the tested polymorphism, group of patients who feel chronic and co-existing alcohol craving and hunger, and this patients have got risk of relapse alcohol drinking or nutrition disorders.

    Conclusions: The polymorphism of DRD2 can be connected with the strongly alcohol craving and hunger. The investigation was financed by grant of Poland’s National Health Program for 2016-2020 (no. 74/44/3.4.3/18/DEA).

    D. Czarnecki: None. M. Ziółkowski: None. A. Długosz: None. J. Feldheim: None. N. Waszkiewicz: None. A. Kułak-Bejda: None. M. Gorzkiewicz: None. J. Budzyński: None. J. Chodkiewicz: None. A. Junkiert-Czarnecka: None.

    E-P09.04 Case report: Alexander Disease in a 12-month-old male infant with epilepsy and global retardation

    N. Baba, K. Burghardt, I. Schreyer, C. A. Hübner

    Institute of Human Genetics, University Hospital Jena, Jena, Germany

    We report on a 12-month-old male infant of healthy unrelated German parents who was presented in our genetic counseling center in September 2019 with global retardation. One month before, he had two focal clonic seizures predominantly on the left side of the body, which led to hospitalization. The family history revealed no epilepsy or other relevant neurological or genetic diseases. An MRI scan of the brain revealed a severe myelination defect with white matter abnormalities. Genetic diagnostic workup included: cytogenetic analysis, array-CGH and NGS-based panel diagnostics for familial focal epilepsies, extended regarding GFAP. NGS identified a likely pathogenic mutation in GFAP (c.235C>G (p.Arg79Gly) heterozygous). To our knowledge this specific mutation has been reported in only one patient suffering from Alexander disease (AxD) (Gorospe et al., 2002). AxD is a very rare neurodegenerative disease which belongs to the leukodystrophies. Patients with AxD have unspecific symptoms like progressive motor and intellectual retardation, developmental regression and multiple other neurological symptoms including seizures. In most cases gain-of-function mutations in GFAP encoding the glial fibrillary acidic protein underlie this disorder, which result in the accumulation of the variant protein in astrocytes, then called Rosenthal fibers. The exact cellular pathogenesis remains unknown. Only about 500 cases of AxD have been reported worldwide. Survival time depends on the age at onset of AxD, a median of 14 years was found in a larger cohort (Prust et al., 2011). AxD should be considered differential diagnosis of global developmental retardation, seizures and white matter abnormalities.

    N. Baba: None. K. Burghardt: None. I. Schreyer: None. C.A. Hübner: None.

    E-P09.07 Copy number variants in autism spectrum disorders patients

    S. M. Papuc1, A. Erbescu1, C. Iliescu2,3, M. Dobre1, I. Minciu2,3, F. Rad2,3, I. Mihailescu3, L. Mateescu2,3, A. C. Tutulan-Cunita1,4, R. Grozavescu2,3, E. Andrei3, B. Budisteanu3, I. Focsa1,2, F. Linca3, D. Ioana3, G. Gaina1, L. Albulescu1, I. Dobrescu2,3, M. Budisteanu1,3,5, A. Arghir1

    1Victor Babes National Institute of Pathology, Bucharest, Romania, 2Carol Davila University of Medicine and Pharmacy, Bucharest, Romania, 3Prof. Dr. Alex. Obregia Clinical Hospital of Psychiatry, Department of Pediatric Neurology, Bucharest, Romania, 4Cytogenomic Medical Laboratory, Bucharest, Romania, 5Titu Maiorescu University, Faculty of Medicine, Bucharest, Romania

    Copy-number variants (CNVs) have been shown to be involved in etiology of neurodevelopmental disorders like autism spectrum disorders (ASDs), intellectual disability (ID), and other psychiatric disorders. Chromosomal microarray analyses (CMA) has offered a high detection rate of small and large CNVs associated with ASD, and led to discovery of new autism genes. We report on the results of chromosomal CMA investigation in a group of ASDs patients. Eighty patients were referred to our laboratory for genetic testing with ASDs as part of a broad phenotype including ID or other clinical features. A complete clinical evaluation was performed with focus on psychiatric examination and psychological evaluation with specific ASDs tests (ADOS, ADI-R). Array-CGH completed with karyotyping, FISH and qPCR tests were performed. A total of 21 pathological CNVs (14 deletions and 7 duplications), with a median length of 3.7 Mb were detected in 17 patients. The involved genomic regions overlap 550 OMIM genes. Besides well-described syndromic regions associated with ASDs (e.g. deletions of 1q21.1, 22q13.3, 22q11.2, MBD5; Xq28 duplication), other genomic regions, rarely reported in patients with ASDs were identified (deletion of 8p11.2p21.2, 9q34.1, 9p13, duplication of 7p22.2p22.1, CHRNA7); thus having the potential to reveal new ASD genes. Our data illustrates the utility of array-CGH in the investigation of patients with ASDs, specifically in the context of complex phenotypes. Acknowledgment: The research leading to these results has received funding from the EEA Grant 2014-2021, under the project contract No 6/2019, and MRI Projects PN 92.033.02.03 and PN 16.22.05.01.

    S.M. Papuc: None. A. Erbescu: None. C. Iliescu: None. M. Dobre: None. I. Minciu: None. F. Rad: None. I. Mihailescu: None. L. Mateescu: None. A.C. Tutulan-Cunita: None. R. Grozavescu: None. E. Andrei: None. B. Budisteanu: None. I. Focsa: None. F. Linca: None. D. Ioana: None. G. Gaina: None. L. Albulescu: None. I. Dobrescu: None. M. Budisteanu: None. A. Arghir: None.

    E-P09.09 A new case of beta-propeller protein-associated neurodegeneration (BPAN) in a 7-year old male with a novel mosaic WDR45 mutation

    H. Wang, G. Fteeh

    Loma Linda University, School of Medicine, LOMA LINDA, CA, United States

    Introduction: Beta-propeller protein-associated neurodegeneration (BPAN) is a neurodegeneration with brain iron accumulation disorder. BPAN is very rare, with few than 60 cases reported to date in which the vast majority of cases are female and sporadic, resulting from a de novo mutation in the WDR45 gene located at Xp11.23. Here we report a new case of BPAN in a male.

    Case Description: This a 7 years old adoptive boy with history of autism, developmental delay, and seizures. He was not able to walk until age of 4 and nonverbal. He was diagnosed with Lennox Gastaut syndrome. EEG (during the sleep) showed frequent to abundant high to very high voltage sharp, spike and slow wave discharges present in right and left hemisphere. The brain MRI indicated prominent mineralization of the globus pallidi and substantia nigra considering iron accumulation or mitochondrial disorder.

    Result: The initial workup of chromosome microarray was negative, the subsequent brain-iron accumulation gene panel reported as WDR45, X-linked, c.577C>T (p.Gln193*), zygosity (indeterminate, 46% allele fraction), pathogenic.

    Discussion/Conclusion: BPAN is phenotypically similar in both male and female which is characterized by clustered spasm, hypsarrhythmia patterns on EEG and developmental delay or regress. The similarity in both genders was explained by somatic mosaicism in surviving males and germline or somatic mutations in females, as well as skewing of X chromosome inactivation. Only a few male cases were reported and this is a new male case with a novel mosaic mutation and presenting with characteristic clinical features.

    H. Wang: None. G. Fteeh: None.

    E-P09.10 New mendelian gene for bipolar disorder.

    M. F. Rossi1,2, D. Lopergolo1,2, M. A. Trusso3, E. Benetti4, C. Fallerini1, S. Furini4, A. Goracci3,5, A. Fagiolini3,5, A. Renieri1,2, F. Mari1,2

    1Medical Genetics, University of Siena, Siena, Italy, 2Genetica Medica, Azienda Ospedaliera Universitaria Senese, Siena, Italy, 3Department of Molecular Medicine and Development, University of Siena, Siena, Italy, 4Department of Medical Biotechnologies, University of Siena, Siena, Italy, 5Department of Mental Health; Psychiatry Unit, Azienda Ospedaliera Universitaria Senese, Siena, Italy

    Introduction: Bipolar Disorder (BP) is a mental health condition characterized by extreme mood fluctuations that include emotional highs and lows. It affects about 1% of the world population and its estimated heritability is around 70%, similar to Schizophrenia.

    Materials and methods: A large autosomal dominant BP family with eleven affected subjects was included in the study. Mental health of seven family members was ascertained by clinical observation and by the use of specific tests. Exome sequencing was performed in all members. Variants prioritization was performed on the basis of the frequency (<5%), evidence of pathogenicity and association with BP.

    Results: Three members, the female proband, her mother and his maternal uncle, were diagnosed with BP and four members (two proband’s sisters and two proband’s male cousins) were categorized as healthy subjects. Exome analysis revealed one single variant that met the above given criteria present in all three affected members and in none of the healthy ones. It is a missense variant, absent in controls (Exome Sequencing Project or 1000 Genomes Project). Multiple lines of computational evidence support a deleterious effect of the variant (CADD 35). The mutated gene encodes for a protein involved in cell motility and extracellular matrix remodeling. A recent study revealed that this protein is downregulated in plasma samples of a large cohort of patients with mood disorder and its expression was reduced in a C. elegans model of Alzheimer’s disease.

    Conclusions: We were able to identify a gene that likely contributed to BP in our family.

    M.F. Rossi: None. D. Lopergolo: None. M.A. Trusso: None. E. Benetti: None. C. Fallerini: None. S. Furini: None. A. Goracci: None. A. Fagiolini: None. A. Renieri: None. F. Mari: None.

    E-P09.11 RASSF10, a new gene associated to hereditary forms of Bipolar Disorder?

    E. Dámaso1, A. Culiáñez-Casas2, I. Lara-Espejo2, M. Castillejo1, A. Castillejo2, M. García-Escudero2, J. Soto2

    1Elche University Hospital - FISABIO, Elche, Spain, 2Elche University Hospital, Elche, Spain

    Introduction: Bipolar disorder (BD) is a complex psychiatric condition with high heritability. Extended families with high prevalence of BD provide an opportunity to identify novel risk genes. We present findings from whole exome sequencing (WES) obtained from a Spanish family with high density of BD cases and dominant autosomal pattern of inheritance.

    Materials and -Methods: Blood DNA was obtained from 8 family members: five patients diagnosed of BD, another patient with other mental disorder and two healthy individuals. WES was performed using SureSelect-Human-AllExonV6+UTR (AgilentTechnologies) libraries and sequencing on Illumina-NovaSeq6000. Alignment and variant calling was performed by SureCall and variant filtering by a custom pipeline for cohort analyses on Alissa Interpret softwares (AgilentTechnologies).

    Results: The total size of captured region was 90Mb. An average of 87% of the target regions had 30X coverage or better. The within-family association of rare coding and splice-site variants with predictable loss of function present in cases and absent in controls was investigated. We found an unreported stopgain candidate variant (NM_001080521.3:c.161C>A) at RASSF10 gene, co-segregating with BD (p=0.036). RASSF10 plays an important role in regulating embryonic neurogenesis. It is expressed in normal brain tissue and epigenetically inactivated in brain tumors. These evidences might suggest an important role of RASSF10 in normal brain function.

    Conclusions: RASSF10 could be a new candidate gene associated to BD, although further studies are needed to be validated. New associated BD genes could shed light on understanding the molecular basis of mental disorders and defining possible targets for new treatments.

    E. Dámaso: None. A. Culiáñez-Casas: None. I. Lara-Espejo: None. M. Castillejo: None. A. Castillejo: None. M. García-Escudero: None. J. Soto: None.

    E-P09.12 Brain malformations diagnosis and clinical management in pediatric patients

    A. Erbescu1, S. M. Papuc1, C. Iliescu2,3, C. Burloiu2, O. Tarta- Arsene2,3, D. Barca2,3, C. Motoescu2,3, I. Minciu2,3, N. Butoianu2,3, B. Budisteanu2, A. C. Tutulan-Cunita1,4, A. Dica2, C. Anghelescu2, D. Craiu2,3, A. Arghir1, M. Budisteanu1,2,5

    1Victor Babes National Institute of Pathology, Bucharest, Romania, 2Prof. Dr. Alex. Obregia Clinical Hospital of Psychiatry, Bucharest, Romania, 3Carol Davila University of Medicine and Pharmacy, Bucharest, Romania, 4Cytogenomic Medical Laboratory, Bucharest, Romania, 5Titu Maiorescu University, Faculty of Medicine, Bucharest, Romania

    Brain malformations (BMs) encompass a large spectrum of disorders with various genetic etiologies, anatomic abnormalities, and clinical features. We report on the results of a study focused on diagnosis and clinical management of BMs in a Romanian pediatric population. One hundred and twenty patients with BMs and complex phenotype were selected from those referred for developmental delay and/or epilepsy, between 2010-2019, to our departments. General clinical examination, neurologic, dysmorphologic, psychiatric/psychologic evaluations and brain imaging studies were performed for all the children. Genetic investigations included array based comparative genomic hybridization (Agilent Technologies), and classical and molecular cytogenetics. Gyration anomalies, corpus callosum defects, cerebellar malformations, and heterotopia, isolated or in different combinations, associated with complex clinical presentations were detected in our patient group. Genomic imbalances, 4 deletions and 3 duplications, were detected in 7 patients. Syndromic regions (17p13.3, 1q21.1, 1q43-q44, 22q11.2) were prevalent in our study group; however, some of these regions are known to be clinically heterogeneous, thus our patients might contribute to further delineation of the phenotypic spectrum. In our study group, chromosomal defects were detected with a high incidence in patients with BMs as part of complex phenotypes. Epileptic seizures and/or developmental delay were the most common clinical features. Brain imaging and genetic studies were instrumental in the diagnostic algorithm, with impact on prognosis and genetic counselling of these cases. Acknowledgment: This work was supported by grants of the Romanian National Authority for Scientific Research Innovation, CCCDI-UEFISCDI, Projects number 87/2019 and 88/2019, COFUND-ERANET E-RARE 3-HETER-OMICS-2, within PNCDI III

    A. Erbescu: None. S.M. Papuc: None. C. Iliescu: None. C. Burloiu: None. O. Tarta- Arsene: None. D. Barca: None. C. Motoescu: None. I. Minciu: None. N. Butoianu: None. B. Budisteanu: None. A.C. Tutulan-Cunita: None. A. Dica: None. C. Anghelescu: None. D. Craiu: None. A. Arghir: None. M. Budisteanu: None.

    E-P09.13 Whole exome sequencing greatly increases the chances for the differential diagnosis in complex clinical phenotypes involving cerebellar ataxia

    N. Ivanova1, K. Mihova1, K. Kamenarova1, S. Bichev2, T. Chamova3, S. Cherninkova3, J. Samuel3, V. Guergueltcheva4, D. Avdjieva-Tzavella5, H. Kathom5, A. Savov2, I. Kremensky1, V. Bojinova6, V. Mitev1, I. Tournev3,7, A. Jordanova1,8, R. Kaneva1

    1Molecular Medicine Centre, Department of Medical Chemistry and Biochemistry, Medical University – Sofia, Sofia, Bulgaria, 2National Genetic Laboratory, University Hospital of Obstetrics and Gynaecology “Maichin dom”, Sofia, Bulgaria, 3Neurology Clinic, University Hospital “Aleksandrovska”, Sofia, Bulgaria, 4Neurology Clinic, University Hospital “Sofiamed”, Sofia, Bulgaria, 5Specialized Hospital for Active Treatment Children’s Hospital, Prof. Dr. Ivan Mitev“, Sofia, Bulgaria, 6Neurological Clinic for Children, Multiprofile hospital for active treatment in neurology and psychiatry “St. Naum”, Sofia, Bulgaria, 7Department of Cognitive Science and Psychology, New Bulgarian University, Sofia, Bulgaria, 8Molecular Neurogenomics Group, VIB-UAntwerp Center for Molecular Neurology, University of Antwerp, Antwerp, Belgium

    Introduction: Cerebellar ataxias are genetically heterogeneous group of neurodegenerative disorders that could be present with complex and variable clinical phenotypes overlapping other neurological disorders. Most of them are extremely rare and therefore, poorly studied, difficult to diagnose and symptomatically treated. Introduction of next-generation sequencing in clinical practice provides a fast and effective decision for precise genetic diagnosis.

    Materials and methods: We performed whole exome sequence (WES) to search for disease-causing variants in 13 patients with complex clinical phenotypes involving cerebellar ataxia and one or more of the following symptoms: spasticity, peripheral neuropathy, epilepsy, dysmorphic features, intellectual disability.

    Results: WES-data analysis led to the identification of the potentially disease-causing variants in 10 families. They include five novel and four already known pathogenic variants in the SACS, PNPLA6, PRNP, SCN8A, SPG7, CoQ8A and KIF1A genes. After additional genetic analysis and thorough patients’ phenotyping we were able to confirm genetic diagnosis in 9 families.

    Conclusions: Our study enriches genetic and clinical databases with novel genetic variants and clinical cases of several rare genetic disorders that will help to delineate their molecular mechanisms. It added a new spot to the geographic distribution worldwide of the spastic ataxia of Charlevoix-Saguenay that has been previously limited to a specific geographic region. WES provides a fast and effective tool for precise genetic diagnosis that allows to destinguish among variaty of clinical phenotypes sharing common clinical feature of cerebellar ataxia.

    Acknowledgements: This study was supported by Grants B02/3/2014 and D01-285/17.12.2019 National Science Fund/Ministry of Education and Science, Bulgaria.

    N. Ivanova: None. K. Mihova: None. K. Kamenarova: None. S. Bichev: None. T. Chamova: None. S. Cherninkova: None. J. Samuel: None. V. Guergueltcheva: None. D. Avdjieva-Tzavella: None. H. Kathom: None. A. Savov: None. I. Kremensky: None. V. Bojinova: None. V. Mitev: None. I. Tournev: None. A. Jordanova: None. R. Kaneva: None.

    E-P09.14 A novel mutation of GDAP1 associated with severe form of Charcot-Marie-Tooth disease

    N. BENSLIMANE1, F. Miressi1, C. Magdelaine1,2, P. Faye1, F. Sturtz1,2, F. Favreau1,2, A. Lia1,2

    1EA6309-Neuropathie périphérique et Maintenance Myélinique, Limoges, France, 2Laboratoire de Biochimie et Génétique Moléculaire CHU DUPUYTREN, Limoges, France

    Introduction: Charcot-Marie-Tooth disease (CMT) is the most common hereditary neuropathy with a prevalence of 1/2500; also known as sensory-motor neuropathy. There are several forms of CMT which are differentiated by their mode of transmission (recessive, dominant, autosomal or X-linked), and their electrophysiological aspect (demyelinating or axonal forms). Currently, more than 90 genes are involved in CMT.

    Material and Methods: A 47-year-old patient presenting CMT disease was sampled with peripheral blood collected in EDTA tubes after giving her informed consent. Genomic DNA was extracted by standard methods. Next Generation Sequencing (NGS) strategy was performed using a 92 genes custom panel designed for CMT and associated neuropathies diagnosis.

    Results: The patient was a 47-year-old woman, presenting a severe demyelinating form of CMT disease. The disease onset was in early childhood with a loss of walking around the age of 11 and since then a wheelchair dependence. Molecular biology analysis highlighted the presence of a new GDAP1 mutation, never described to date. This mutation, c.165T>G, located on exon 2, was presented in the homozygous state and leads to the replacement of an aspartic acid in position 55 by a glutamic acid (p.Asp55Glu) and it is predicted pathogenic by two prediction softwares. Splicing involvement is under investigation. Asymptomatic parents presented the GDAP1 mutation in the heterozygous state.

    Conclusion: The homozygous c.165T>G detected in GDAP1 in our patient is likely responsible for her CMT disease. This result is important in terms of diagnosis for molecular biologists and geneticists.

    N. Benslimane: None. F. Miressi: None. C. Magdelaine: None. P. Faye: None. F. Sturtz: None. F. Favreau: None. A. Lia: None.

    E-P09.15 Another case of Coffin-Siris-Syndrome 10 identified by trio exome sequencing.

    L. Mulahasanovic1, H. Gabriel1, S. Biskup1, C. Schell-Apacik2, C. Bus3

    1Praxis für Humangenetik, Tuebingen, Germany, 2Medicover Human Genetics Berlin-Westend MVZ, Berlin, Germany, 3Humangenetik Tübingen, Tuebingen, Germany

    Coffin-Siris syndrome (CSS) is a rare genetic disorder characterized mainly by developmental delay, intellectual disability and characteristic facial features. Hypoplasia or absence of the fifth finger and toe nails are most common in affected individuals. Until now, ten responsible genes for CSS have been identified. Recently, de novo variants in the gene SOX4 were identified in four patients with typical features of CSS, particularly fifth finger clinodactyly (Zawerton et al., 2019). This new CSS type 10 is characterized by intellectual disability, microcephaly and facial abnormalities. SOX4 belongs to a family of SRY-related transcription factors, which are playing a key role in multiple developmental pathways. Expression studies showed that SOX4 is highly expressed during neurogenesis. All four pathogenic SOX4 variants identified before were located within the SOX family-specific HMG domain of the protein, which is crucial for DNA-binding. Here we report on a mildly affected female patient carrying the de novo variant c.278T>A; p.Leu93Gln in the SOX4 gene, which is also located in the HMG domain. She could sit at the age of 4 months and started walking on his own with 15 months. She had delayed speech development and learning disability, was restless and agitated, and was diagnosed with ADHD at the age of 8 years. At the age of 21, she presented with mild dysmorphic features (e.g. long face; deep-set, dysmorphic ears; low palpepral fissures; diffuse inserted eyebrows; wide mouth; long fingers; slight brachydactyly of the fifth fingers; broad big toes) and displayed anxiety and a lack of motivation.

    L. Mulahasanovic: None. H. Gabriel: None. S. Biskup: None. C. Schell-Apacik: None. C. Bus: None.

    E-P09.18 Clinical features of three familial cases of Neuronal Intranuclear Inclusion Disease (NIID)

    H. Furuya, Y. Miyamoto, T. Furushima, S. Ohtsuru, Y. Morita, Y. Osaki

    Kochi Medical School, Kochi, Japan

    Background: Neuronal intranuclear inclusion disease (NIID)(MIM 603472) is a neurodegenerative disorder characterized by eosinophilic intranuclear inclusions in neuronal cells. Such inclusions are also found in non-neuronal cells. The clinical features and pathological findings in patients with NIID are highly varied. Here, we present three familial NIID cases accompanied with parkinsonism, which is not so common in this disorder.

    Objective: Cases: All cases are adult onset NIID with Parkinsonism with dementia and severe psychosis.

    Results: In MRI imaging, diffuse cerebral atrophy was observed in all cases. High intensity of the cortico-medullary junction in diffusion-weighted imaging (DWI), which is characteristic findings in NIID, was seen in all NIID. In neurological examination, all NIID showed laterality or severely increased Pulmomental Reflex (PMR). Ante-mortem diagnosis was made by identification of intranuclear inclusions with skin biopsy in all NIID. Neuroimaging diagnosis for usual Parkinsonism shows normal with DAT scan and MIBG scintigraphy.

    Conclusion: Intranuclear accumulation of abnormal proteins and/or dysfunction of protein degradation might underlie in the pathogenesis of NIID. However, NIID is considered as a heterogeneous disease entity and shows various clinical features. Although dementia is common in NIID, Parkinsonism is also often observed in this disorder. Achknowledgement: We also thank to Dr. Sone J and Prof. Sobue G (Department of Neurology, Nagoya University, Japan) for immune staining of biopsy specimen.

    H. Furuya: None. Y. Miyamoto: None. T. Furushima: None. S. Ohtsuru: None. Y. Morita: None. Y. Osaki: None.

    E-P09.20 The Complex Molecular Basis of Dystonias in a Turkish Cohort

    S. Tekgul1, G. Simsir1, Z. Yapici2, A. Basak1

    1Koç University, Istanbul, Turkey, 2Istanbul University, Istanbul, Turkey

    Introduction: Dystonias are neurological conditions in which abnormal movements or postures are observed, that are caused by sustained or intermittent muscle contractions. The major feature is over-activity of muscles required for movement. Dystonias can clinically vary in their manifestation and severity affecting all age groups and leading to considerable disability and impaired quality of life. With its high throughput capacity and proportionally low cost, next generation sequencing is now being extensively used in research/diagnostic settings to determine novel genes and mutations associated with dystonias.

    Materials and methods: Genomic DNA was isolated from whole blood. Whole exome sequencing (WES), followed by family segregation analysis using Sanger sequencing, was performed on 21 probands with heterogenous dystonia phenotypes. The pathogenicity of the variant was scored by the prediction tools DANN, GERP, SIFT and MutationTaster.

    Results: WES revealed 10 dystonia genes with varying frequencies and 12 variants, 4 of which are novel (Table 1). The diagnostic rate is 62%. Table1 Genes and variants identified in Turkish dystonia cohort

    Genes (# of families)MutationsZygosityNovel/Reported
    GCH1 (n=3)c.284C>T p.Pro95Leu c.631_632delAT p.Met211ValfsTer38 c.646C>T p.Arg216Terhet het hetNovel Reported Reported
    PTS (n=2)c.84-3C>GhomReported
    TOR1A (n=1)c.907_909delGAG p.Glu303delhetReported
    SLC2A1 (n=1)c.972G>A p.Ser324SerhetReported
    DDC (n=1)c.1040G>A p.Arg347GlnhomReported
    KMT2B (n=1)c.6863delC p.Pro2289ArgfsTer36hetNovel
    TH (n=1)c.698G>A p.Arg233HishomReported
    ATP13A2 (n=1)c.1551_1556delCCTCAC p.Leu518_Thr519delhomNovel
    ATP1A3 (n=1)c.1838C>T p.Thr613MethetReported
    KIF1C (n=1)c.2005C>T p.Arg669TerhomNovel

    Conclusions: The 10 genes identified reveal a high locus heterogeneity. Further, ATP13A2 and KIF1C which also give rise to spasticity and ataxias, point to genetic and pathophysiological overlaps between neurological conditions.

    S. Tekgul: None. G. Simsir: None. Z. Yapici: None. A. Basak: None.

    E-P09.21 Genetic study of early-onset parkinsonism in Thailand: targeted next-generation sequencing

    P. Phowthongkum

    Faculty of Medicine, Bangkok, Thailand

    Background: Early-onset Parkinson disease (EOPD) is defined by PD with the onset age of less than 50 years. Patients may present predominantly with lower limb dystonia rather than typical resting tremor in late-onset patients which is the challenge in making the diagnosis in younger patients. Many patients apparently are responded dramatically with dopamine replacement but developed early motor complications, in contrast, to consistently respond to the treatment in DOPA Responsive Dystonia (DSD). Molecular diagnosis, therefore, helps in diagnosis EOPD, facilitates genetic counseling and treatment customization.

    Methods: A total of 51 patients with early-onset parkinsonism from 49 families referred to Neurogenetics Center at King Chulalongkorn Memorial Hospital. Genetic test was performed with targeted next-generation sequencing panel containing 34 genes causing PD or dystonia.

    Results: Eleven patients with EOPD (21.5%) were found to carry likely pathogenic or pathogenic variants in GBA (5/51),PARK2(4/51 from 2 families),PINK1 (2/51 from 2 families). Familial EOPD (2 families) harbored 3 different pathogenic variants in PARK2 (one family with homozygous deletion of exon7 and the other family with one heterozygous deletion of exon 5 and one heterozygous missense variant). They all have onset of less than 30 years.

    Conclusions: Our findings add an understanding of the genetic architecture of EOPD in Southeast Asia. Targeted next-generation sequencing is an effective and affordable method for making genetic diagnosis for PD. Heterozygous GBA definitely increases risk of EOPD in the Southeast Asian population. Individual seeking carrier testing includes GBA should be informed about the risk of parents to develop neurological disorders.

    P. Phowthongkum: None.

    E-P09.23 NGS survey in neurological disorders - focus on variants in HLA class II genes

    F. Shakola, I. Dimova, V. Peycheva, K. Mihova, K. Kamenarova, R. Kaneva

    Molecular Medicine Center, MU Sofia, Sofia, Bulgaria

    Neuroinflammatory mechanisms may be involved in the genesis of epilepsies and autistic spectrum disorders. An NGS study with TrueSightOne gene panel was performed on 30 patients with neurological disorders (including seizures as a main component). In 10 patients pathogenic/probably pathogenic mutations were discovered. We have performed comprehensive study of HLA gene variants discovered by NGS after lack of pathogenic mutations in patients affected by epilepsy with or without autism/mental retardation and compared with patients with other pathologies (referred as controls). We focused on variants annotated as Variants of Unknown Significance (VUS). We determined the frequency of such variants in DRB1 and DRB5, in cases and controls, as they were the most commonly found in both groups. The frequency varied between 11-15% in cases and 11-23% in controls. In addition, we reported variants found only in cases(5 variants in DRB5 and 1 in DRB1), only in controls (7 in DRB5 and 10 in DRB1) and both in cases and controls (5 in DRB5 and 6 in DRB1). We found 2 HLA-DMB and 2 HLA-G variants only in cases. This is a pilot study of the involvement of HLA class II gene variants in neurological disorders and it will be followed by the analysis of these individual variants’ role.

    F. Shakola: None. I. Dimova: None. V. Peycheva: None. K. Mihova: None. K. Kamenarova: None. R. Kaneva: None.

    E-P09.27 Identification of the molecular etiology in early epileptic encephalopathy using whole exome sequencing

    E. Isik1, T. Atik1, S. Keskin Yilmaz2, G. Aktan2, H. Onay3, S. Gokben2, F. Ozkinay1,3

    1Subdivision of Pediatric Genetics, Department of Pediatrics, Faculty of Medicine, Ege University, Izmir, Turkey, 2Subdivision of Pediatric Neurology, Department of Pediatrics, Faculty of Medicine, Ege University, Izmir, Turkey, 3Department of Medical Genetics, Faculty of Medicine, Ege University, Izmir, Turkey

    Epileptic encephalopathies (EEs) are a group of devastating disorders caused by epileptic activity; resulting in deterioration in developmental, cognitive and motor functions. The number of genes identified as being responsible for EEs has been increasing rapidly. However, despite a comprehensive molecular analysis, a molecular diagnosis can only be established in 50% of cases. The aim of this project is to use whole exome sequencing to determine the molecular etiology of EEs in molecularly undiagnosed patients with a pedigree suggestive of an autosomal recessive single gene disease. Three EEs families, having either consanguineous parents of an affected individual and/or having more than one affected offspring were enrolled in the project. Prior to this project, the families had been evaluated using a next generation sequencing panel which included 16 EE genes; however, no molecular diagnosis could be established. In 5 cases from the 3 selected EEs families in our study genetic etiology was investigated using WES, with segregation analysis then being performed using Sanger sequencing. All patients in the study group had infantile onset epileptic seizures and severe developmental delay. WES revealed biallelic disease causing mutations in DENDD5A, GRN and TBCD genes in Family 1, Family 2 and Family 3, respectively. In each family, the identified variants associated with the disease were segregated. Reverse phenotyping supported the molecular analysis. In conclusion, this study provides a valuable contribution to the genotype-phenotype relationship by determining rare epilepsy syndromes in a previously undiagnosable patient group. WES provides a useful diagnostic alternative; particularly in consanguineous families.

    E. Isik: None. T. Atik: None. S. Keskin Yilmaz: None. G. Aktan: None. H. Onay: None. S. Gokben: None. F. Ozkinay: None.

    E-P09.28 Whole-exome sequencing in familial multiple sclerosis

    L. Torre Fuentes1, J. Matías-Guiu Antem2, V. Pytel1, P. Montero Escribano2, L. Hernández Lorenzo1, P. Maietta3, S. Álvarez3, U. Gómez Pinedo1, J. Matías-Guiu Guía1,2

    1Institute of Neuroscience, Health Research Institute of San Carlos Clinical Hospital, Madrid, Spain, 2Neurology department, San Carlos Clinical Hospital, Madrid, Spain, 3NIMGenetics, Madrid, Spain

    Introduction: Multiple sclerosis (MS) is an inflammatory autoimmune disease of the central nervous system (CNS) which causes demyelination and axonal damage. MS is considered a polygenic disease where genetic risk factors can be more likely detected in familial MS. The aim of the study is to analyse genetic variations of signalling pathways and genes related to MS.

    Materials and methods: Whole-exome sequencing (WES) with Ion Proton technology was performed in 138 individuals from 23 families including at least 2 MS patients. We compared patients with MS, patients with other autoimmune disease and healthy individuals. Signalling pathways and genes related to MS were analysed. Variant filtering and prioritization were performed with an own pipeline using criteria to include relevant and functional variants associated to MS.

    Results: In our cohort, some variants matched criteria to be considered as a possibly pathogenic variable. The associated genes (NOD2, NLRP7, CYP24A1, TNFAIP3, TNFRSF13B, LRP2, CIITA, ACE) were mainly involved in the immune system as well as in vitamin D regulation. These genes have been previously reported in literature associated to MS.

    Conclusions: These findings support the idea that familial MS could present a genetic background. The variants found in this research require further study and could lead to a better understanding of MS.

    L. Torre Fuentes: None. J. Matías-Guiu Antem: None. V. Pytel: None. P. Montero Escribano: None. L. Hernández Lorenzo: None. P. Maietta: None. S. Álvarez: None. U. Gómez Pinedo: None. J. Matías-Guiu Guía: None.

    E-P09.30 Spontaneous rescue of a FMR1 repeat expansion

    E. Erbs, M. Rasmussen, D. L. Lildballe

    Department of Clinical Genetics, Lillebælt Hospital, Vejle, Denmark

    Introduction: Fragile X syndrome (FXS) is usually caused by CGG-repeat expansion in the 5’ UTR region of the Fragile X Mental Retardation 1 (FMR1) gene of >200 repeats causing methylation of the region. Rare cases are caused by pathogenic variants within the coding region.

    Materials and methods: Genetic testing for FXS was requested in a male infant born to a mother known to harbour a FXS full mutation (>200 CGG-repeats). The maternal grandmother was a carrier of a FXS premutation. Analysis of CGG-repeats of the FMR1 gene was performed using PCR, RP-PCR, and Sanger sequencing. STR markers were used in linkage analysis.

    Results: An unexpected very short PCR fragment was detected in the male infant. Subsequent Sanger sequencing confirmed an 88 bp deletion (c.1-156_1-69del) in hemizygous form. The deletion included all CGG-repeats and flanking sequences. However, the deletion did not include FMR1 exons. Linkage analysis revealed that the allele, which has been expanded in the mother and the maternal grandmother, was passed on to the male infant.

    Conclusion: Grønskov et al. previously reported a ~150 bp deletion of all CGG-repeats and flanking sequences in a normal female patient, who was hemizygous for the FMR1 gene due to a large deletion of the other X chromosome. Western blot showed that the FMR1 protein level was unaffected. This reported deletion comprises the deletion detected in the male infant. Based on this report, we expect our patient to be unaffected.

    In conclusion, a male infant was rescued from FXS by a spontaneous deletion.

    E. Erbs: None. M. Rasmussen: None. D.L. Lildballe: None.

    E-P09.32 Genes with variants associated with frontotemporal dementia are enriched in extracellular matrix organization pathways

    S. Karachanak-Yankova1,2, L. Balabanski1,3, D. Serbezov1, R. Vazharova3,4, O. Antonova1, D. Nikolova1, M. Mihaylova1, R. Staneva1, V. Damyanova1, M. Ganev1, V. Spasova1, D. Nesheva1, Z. Hammoudeh1, S. Hadjidekova1, S. Mehrabian5, M. Petrova5, L. Traykov5, D. Toncheva1,6

    1Department of Medical Genetics, Medical Faculty, Medical University-Sofia, Sofia, Bulgaria, 2Department of Genetics, Faculty of Biology, Sofia University “St. Kliment Ohridski”, Sofia, Bulgaria, 3Gynecology and assisted reproduction hospital “Malinov”, Sofia, Bulgaria, 4Department of Biology, Medical genetics and Microbiology, Faculty of Medicine, Sofia University “St. Kliment Ohridski”, Sofia, Bulgaria, 5Depatment of Neurology, UH “Alexandrovska”, Medical University-Sofia, Sofia, Bulgaria, 6Bulgarian Academy of Sciences, Sofia, Bulgaria

    Introduction: Frontotemporal dementia (FTD) is a genetically and pathologically heterogeneous degenerative disorder, second to Alzheimer’s disease as a cause of dementia in patients under 65 years of age. The present case-control study aims to broaden the understanding of the molecular pathogenesis of FTD by whole exome sequencing (WES) of pooled DNA samples.

    Materials and methods: The analysis was undertaken on 140 FTD patients grouped in two DNA pools (original and replicate) and a control DNA pool of 100 age-matched healthy subjects. The WES was performed in BGI Genomics at a mean coverage of at least 250 x per sample and the obtained variants were filtered by stringent criteria.

    Results: The number of biallelic autosomal variants found in the control DNA pool is 180 692. The original and replicate patient DNA pool contain 18 003 and 21 555 variants not found in the control pool, respectively. Among these variants 2344 are found in both patient pools, as 175 have less than 1% frequency in non-Finish Europeans in GnomAD. These variants are located in 174 genes and can be considered as FTD associated. The pathway enrichment analysis of these genes using Reactome software platform showed over-represented pathways mainly in extracellular matrix organization.

    Conclusion: The detection of over-represented extracellular matrix organization pathways in FTD contributes to the understanding of the pathogenetic mechanisms underlying neurodegeneration. Acknowledgment: KP-06-N33/5 from 13.12.2019 - National Science Fund of Bulgaria.

    S. Karachanak-Yankova: None. L. Balabanski: None. D. Serbezov: None. R. Vazharova: None. O. Antonova: None. D. Nikolova: None. M. Mihaylova: None. R. Staneva: None. V. Damyanova: None. M. Ganev: None. V. Spasova: None. D. Nesheva: None. Z. Hammoudeh: None. S. Hadjidekova: None. S. Mehrabian: None. M. Petrova: None. L. Traykov: None. D. Toncheva: None.

    E-P09.33 Characterization of the PRNP gene mutations and the genotype-phenotype correlation in Hungarian patients with prion disease

    H. Zeke1, Á. Palásti1, B. A. Fekete1, V. Molnár1, A. Gál1, Z. Grosz1, G. G. Kovács2, M. J. Molnár1

    1Institute of Genomic Medicine and Rare Disorders, Semmelweis University, Budapest, Hungary, 2Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada

    Introduction: Abnormal accumulation of prion proteins are responsible for several fatal neurodegenerative diseases. PRNP is the only gene in which pathogenic variants are known to cause genetic prion disease. However, several pathogenic mutations of PRNP with heterogeneous type and position were published with disease-causing or modifying effect on other neurodegenerative disorders. In a significant portion, genetic cause can be explained with the most common pathogenic mutation E200K in the PRNP gene.

    Materials and methods: Hundred-twenty-six patients were referred (age at referral: 57+13,7years) to our institute with clinically suggested prion disease during 2015-2019. Sanger sequencing was applied to analyze the entire coding region of PRNP gene.

    Results: Altogether 25 unrelated prion-positive cases were detected during the 4-year observational period. Heterozygous c.598G>A (E200K) variant was detected in 22/25 cases. Besides this most common variant in one case the previously described c.350 C>T (A117V) variant was found. In one family a rare, 168 bp octapeptid-repeat insertion was observed, which is known to be associated with a very slow disease progression. In addition, a novel mutation c. 490 A>G (R164G) has been also identified which associated to a slow progression as well.

    Conclusions: In our cohort 88 % of the genetically confirmed prion disorders were associated to the most common E200K PRNP mutation. The type and location of the alteration of the PRNP gene may have an important role in the determination of the phenotype, which makes the genetic counselling challenging.

    Funding: This study was supported by the Hungarian Brain Research Program (KTIA_NAP_ 2017-1.2.1-NKP-2017-00002).

    H. Zeke: None. Á. Palásti: None. B.A. Fekete: None. V. Molnár: None. A. Gál: None. Z. Grosz: None. G.G. Kovács: None. M.J. Molnár: None.

    E-P09.35 Autosomal recessive axonal neuropathy with neuromyotonia; mutations in HINT1 are not uncommon in the Greek population

    Z. Kontogeorgiou1, D. Pandis2, C. Kartanou1, M. Breza1, T. Zambelis2, M. Panas1, G. Karadima1, G. Koutsis1

    1Neurogenetics Unit, 1st Department of Neurology, School of Medicine, Eginition Hospital, National and Kapodistrian University of Athens, Athens, Greece, 2Clinical Neurophysiology Unit, 1st Department of Neurology, School of Medicine, Eginition Hospital, National and Kapodistrian University of Athens, Athens, Greece

    Autosomal recessive axonal neuropathy with neuromyotonia (ARAN-NM) has been recently shown to result from histidine triad nucleotide-binding protein 1 (HINT1) gene mutations. It accounts for around 10% of recessive axonal Charcot-Marie-Tooth disease (CMT) in European populations. A single case has been reported to date in the Greek population. We presently report a case-series of 3 Greek patients with ARAN-NM identified during screening of undiagnosed recessive axonal CMT cases with a combination of whole-exome and Sanger sequencing. Patient 1 was a 19 year-old female presenting with walking difficulty at the age of 8 years. She gradually developed lower limb atrophies and at 15 years old was also diagnosed with myoclonic epilepsy. On EMG she showed motor axonal neuropathy with neuromyotonia. She was compound heterozygous for mutations c.110G>C (p.Arg37Pro) and c.250T>C (p.Cys84Arg) in HINT1. Patient 2 was a 20 year-old woman presenting with walking difficulties at the age of 14 years. She gradually developed foot drop and upper limb distal weakness. On EMG she showed a motor axonal neuropathy with neuromyotonia. She was homozygous for the c.110G>C (p.Arg37Pro) mutation in HINT1. Patient 3 was a 49 year-old male presenting with walking difficulties at the age of 15 years. He gradually developed foot drop and upper limb distal weakness. On EMG he showed a predominantly motor axonal neuropathy with neuromyotonia. He was homozygous for the c.110G>C (p.Arg37Pro) mutation in HINT1. We conclude that HINT1-related CMT may be relatively common in Greece and should be further systematically screened for in appropriately selected populations.

    Z. Kontogeorgiou: None. D. Pandis: None. C. Kartanou: None. M. Breza: None. T. Zambelis: None. M. Panas: None. G. Karadima: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Pfizer. F. Consultant/Advisory Board; Modest; Roche. G. Koutsis: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; Teva Pharmaceuticals, Genesis Pharma. Other; Significant; Novartis, Genesis Pharma, Sanofi-Genzyme, Teva.

    E-P09.38 Trio whole-exome sequencing confirms KCND2 de novo missense mutations as a cause of autosomal dominantly inherited severe seizures and developmental delay

    U. Zechner, D. Rosenkranz, H. Bolz

    Senckenberg Centre of Human Genetics, Frankfurt, Germany

    Trio whole-exome sequencing was carried out in a female proband with epileptic encephalopathy (delayed myelination, hypoplastic corpus callosum, abnormal EEG) and severe global retardation noticed from the age of 3 months (no psychomotor milestones acquired, muscle hypotonia, irregular eye movements and lack of fixation, stereotypic hyperkinetic arm and leg movements) and her healthy parents. The patient manifested intractable epileptic seizures from the age of 1 year; there was no significant psychomotor development. She died at the age of 21 years. A heterozygous de novo missense variant, c.1210G>C (p.(Val404Leu)), was detected in KCND2, the gene encoding Kv4.2, a major pore-forming subunit in somatodendritic subthreshold A-type potassium current (ISA) channels. The variant has not been described in the literature or in disease- and population-specific variant databases. It leads to the exchange of an evolutionarily highly conserved residue in the S6 transmembrane segment which is part of the channel’s central pore for ion permeation. All 11 applied in silico prediction algorithms categorized the variant as deleterious. In a previous report on KCDN2 as a disease gene, a monozygotic twin pair with epilepsy and developmental delay carried a heterozygous de novo missense variant affecting the same residue (Lee et al., PMID: 24501278). This p.(Val404Met) mutation (c.1210G>A) was shown to lead to enhanced inactivation of closed Kv4.2 channels and impaired inactivation of open channels (Lin et al., PMID: 29581270). Thus, our finding supports dominant de novo KCND2 missense variants as a cause of intractable, early-onset epilepsy with severe global retardation.

    U. Zechner: None. D. Rosenkranz: None. H. Bolz: None.

    E-P09.39 Correlation of genetic analysis and evolution of MRI changes leading to diagnosis of Labrune syndrome

    J. Pilch1, M. Machnikowska-Sokołowska2, M. Rydzanicz3, A. Pollak3, J. Kosińska3, P. Gasperowicz3, K. Gruszczynska2, E. Emich-Widera1, R. Płoski3

    1Department of Pediatric Neurology, Medical University of Silesia, Katowice, Poland, 2Department of Diagnostic Imaging and Interventional Radiology, Department of Radiology and Nuclear Medicine, Medical University of Silesia, Katowice, Poland, 3Department of Medical Genetics, Medical University of Warsaw, Warsaw, Poland

    Progressive leukoencephalopathy with calcification and cysts was first reported by Labrune in 1996. The pathology underlying the disease is a diffuse cerebral microangiopathy with development of micro-, macrocysts, tumour-like vascular hyperplasia, calcification, glial proliferation, demyelination, necrosis, iron deposition and haemorrhage. Mutations in the SNORD118 gene were associated with Labrune syndrome in 2012. Since then only individual cases have been presented.

    We report a normally developing 10-years-old girl suffering from chronic headaches without neurological symptoms. Initially, Aicardi-Goutieres syndrome was suspected. We performed retrospective analysis of three annual brain MRI with MR angiography. In all MRI we found diffuse symmetrical white matter areas of increased signal with U-fibers sparing. Deep nuclei were affected. Cystic areas, enlarging in consecutive examinations were observed in thalami, with mass effect in last MRI. Multiple signals with blooming effect were spread both supra- and infratentorially. Partial peripheral contrast enhancement was seen in supratentorial changes. A suspicion of Labrune syndrome has arose after progression of cysts in degenerated white matter and appearance of calcifications. Complex heterozygous mutations 17:008173448-G>C and 17:008173570-G>C in the SNORD118 gene encoding small nuclear RNA were found in patient using whole exome sequencing. Both parents are carriers of identified mutations.

    Conclusion: Follow up MRI examinations in normally developing child and correlation with in-depth genetic analysis led to diagnosis of a rare genetic metabolic syndrome. Collaboration between radiologists, geneticist and clinicians was crucial for establishing final diagnosis.

    J. Pilch: None. M. Machnikowska-Sokołowska: None. M. Rydzanicz: None. A. Pollak: None. J. Kosińska: None. P. Gasperowicz: None. K. Gruszczynska: None. E. Emich-Widera: None. R. Płoski: None.

    E-P09.42 Early onset of complex seizures as a first sign of 16p11.2 deletion syndrome

    E. Sukarova-Angelovska, V. Anastasovska, F. Duma, L. Muaremovska, D. Nestoroska, G. Ilieva, M. Pesevska, M. Velkov

    Pediatric Clinic, Skopje, Macedonia, The Former Yugoslav Republic of

    Background: Recent technologies enabled clarification of some previously undetected causes of intellectual disability and autism spectrum disorders. There are reports of 16p11.2 deletion in the literature, describing variable clinical presentation in patients. Most of them describe developmental delay, autism and seizures, however phenotypic pattern is undistinguishable and variable. There is still no sufficient clinical data of this CNV in babies.

    Case report: We report on a patient with developmental delay and complex seizures. This is a second child in a family, the pregnancy and delivery was uneventful. Microcephaly, foramen ovale and generalized hypotonia were noticed shortly after birth. At the age of 3 months he developed infantile spasms, followed by profound developmental delay within the next several months. He has microcephaly, early closure of the fontanel, high forehead, bitemporal narrowing, wide nasal root, narrow palpebral features, upper lip notch, short neck, cryptorchidism. Karyotype was normal. aCGH analysis (using Affymetrix® CytoScanTM 750K Array) showed deletion of 16p11.2 (1.430 kb), also deletion on chromosome 14q11.2 (433 kb), both are considered as pathogenic according aDGV database.

    Discussion and conclusion: Deletion of the 16p11.2 is mostly described in older children that developed autistic spectrum of disorder, ADHD, etc. Wide clinical variability is described between patients, mostly due to the variations on size and breakpoint of the deleted region. There are some inconsistencies in phenotype described in literature, however this could be a part of a changing phenotype with age. Since the baby had two pathogenic microdeletions, it is difficult to distinguish between two phenotypes.

    E. Sukarova-Angelovska: None. V. Anastasovska: None. F. Duma: None. L. Muaremovska: None. D. Nestoroska: None. G. Ilieva: None. M. Pesevska: None. M. Velkov: None.

    E-P09.45 Whole Exome Sequencing of consanguineous families of clinically diagnosed with Neurodevelopmental Disorders

    B. Turkgenc1, K. Yararbas2,3, H. Keskin Karakoyun1,4, A. Yesilyurt1, A. Gezdirici5, B. Tatlı6,7, N. H. Akcakaya8, N. E. Hacifazlioglu9, O. Coskun7, G. Yesil10, B. Ekici11, C. Yıldırım12, H. Onal13, G. Turanlı14, Y. Alanay15,16

    1Acibadem Genetic Diagnostic Center, Istanbul, Turkey, 2Acibadem Genetic Diagnosis Center, Istanbul, Turkey, 3Department of Medical Genetics, Faculty of Medicine, Acibadem University, Istanbul, Turkey, Istanbul, Turkey, 4Department of Biochemistry and Molecular Biology, Acibadem University, Istanbul, Turkey, 5Kanuni Sultan Süleyman Training and Research Hospital, University of Istanbul Health Sciences, Istanbul, Turkey, 6Pediatric Extreme NeuroTherapeutics Center, Istanbul, Turkey, 7Department of Pediatric Neurology, Faculty of Medicine, Istanbul University, Istanbul, Turkey, 8Department of Genetics, Aziz Sancar Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey, 9Zeynep Kamil Women’s and Children’s Disease Training and Research Hospital, Istanbul, Turkey, 10Department of Medical Genetics, Faculty of Medicine, Bezmialem Foundation University, Istanbul, Turkey, 11Pediatric Neurology, Vital Fulya, Istanbul, Turkey, 12Department of Pediatric Neurology, Acibadem Altunizade Hospital, Istanbul, Turkey, 13Department of Pediatric Endocrine and Metabolism, Istanbul Kanuni Sultan Süleyman Training and Research Hospital, Istanbul, Turkey, 14Department of Pediatric Neurology, Faculty of Medicine, Medipol University, Istanbul, Turkey, 15Department of Pediatric Genetics, Acibadem Maslak Hospital, Istanbul, Turkey, 16Department of Medical Genetics, Faculty of Medicine, Acibadem University, Istanbul, Turkey

    Introduction: Neurodevelopmental disorders (NDD) are heterogeneous conditions in which the development of the central nervous system is disturbed. Recent advancements in genomics have enabled scientists to identify numerous mutations underlying NDD.

    Materials and methods: We used whole exome sequencing (WES) to identify the causative genes in 22 patients with NDD. Consanguinity was reported in all families. Genomic DNA was extracted using the QIAamp DNA Blood Mini QIAcube Kit (QIAGEN, Hilden, Germany). The DNA libraries were created by the Nextera DNA Exome kit (Illumina) and sequenced on NextSeq 500 sequencer using 2x150 bp sequencing kits (Illumina). Bioinformatic analyses were performed on Seqgenomize platform including an automated variant classification tool.

    Results: In series of patients with NDD studied by WES, we found pathogenic/likely pathogenic variants in 17 different genes, which consist of 2 frameshift duplication, 4 frameshift deletion, 6 nonsense, 9 missense and a splice site variants in WDR62, CLP1, IGHMBP2, ADSL, GJC2, EXOSC3, B4GALNT1, GBA2, WWOX, ERCC6, CHKB, TBCK, GLDC,TRAPPC9, CYP7B1, MID1 and TTN genes. CLP1 and GJC2 genes were found mutated twice. A total of 6 novel variants were identified. Interestingly, clinically relevant TTN and MID1 variants were detected in the same patient, explaining the combinatorial effects of the genes may contribute to phenotype complexity and variability.

    Conclusions: Identification of pathogenic/ potentially pathogenic variants and novel variants may lead to the design of personalized therapeutic strategies and the implementation of genetic counseling of NDD as well as to monitoring and early intervention, even before the onset of the disorder.

    B. Turkgenc: None. K. Yararbas: None. H. Keskin Karakoyun: None. A. Yesilyurt: None. A. Gezdirici: None. B. Tatlı: None. N.H. Akcakaya: None. N.E. Hacifazlioglu: None. O. Coskun: None. G. Yesil: None. B. Ekici: None. C. Yıldırım: None. H. Onal: None. G. Turanlı: None. Y. Alanay: None.

    E-P09.50 Early-onset parkinsonian syndrome and PLA2G6 gene mutation

    C. Skrypnyk1, M. B. Falah2

    1Arabian Gulf University, College of Medicine and Medical Sciences, Al Jawhara Center for Molecular Medicine, Manama, Bahrain, 2Arabian Gulf University, University Medical Center, King Abdullah Medical City, Manama, Bahrain

    Introduction: The parkinsonian syndromes encompass a number of entities grouped based on shared clinical features but separated by different pathologies. Non-motor features evolving coincident with progressive motor disability make the diagnosis very challenging.

    Material and methods: Clinical assessment, brain MRI, EEG, biochemical profile and genetic testing were performed for a 25 years old male patient that presented with progressive neurological symptoms, generalized myoclonic jerks, unilateral left upper body tremor and rigidity, walking difficulties, swallowing difficulties, poor concentration and attention, behavioral changes and bouts of anger.

    Results: The patient is the first child of healthy first degree cousins parents and has a positive family history of epilepsy. Behavioral changes were recorded since age 17 years old and neurological symptoms had onset at age 22. CAG repeats testing was previously reported normal and ruled out Huntington disease. Brain MRI shown generalized cerebral and cerebellar atrophy without signs of iron accumulation or T2 lesions in basal ganglia. EEG revealed generalized epileptic complexes. Serum ceruroplasmin and copper values were normal. Rare forms of Parkinson, Multiple system cerebellar atrophy and Spinocerebellar ataxia were considered as differential diagnoses. Whole genome sequencing identified a PLA2G6 gene homozygous pathogenic missense mutation and clarified the diagnosis of Parkinson Disease type 14 (OMIM#612953, ORPHA199351).

    Conclusions: Whole genome sequencing is a very useful and fast tool in elucidating a complex and heterogeneous phenotype. PLA2G6 mutations should be considered in patients with atypical early-onset parkinsonian syndrome. Genetic testing is required when consanguinity associates with complex and early neurodegenerative onset.

    C. Skrypnyk: None. M.B. Falah: None.

    E-P09.52 Polymorphisms in genes for proinflammatory cytokines IL-6, IL-1β, andTNF-α in relation with Parkinson’s disease progression

    M. Pesic1, N. Maksimovic1, A. Aleksic2, M. Gulic1, A. Djuranovic1, M. Grk1, M. Dusanovic Pjevic1, I. Stankovic3, V. Markovic3, A. Marjanovic3, I. Novakovic1, N. Dragasevic-Miskovic3, V. S. Kostic3

    1Institute of Human Genetics, Belgrade, Serbia, 2Institute of Medical Statistics and Informatics, Belgrade, Serbia, 3Clinic for Neurology, Clinical Center of Serbia, Belgrade, Serbia

    Introduction: Parkinson’s disease (PD) is a progressive and complex neurological disorder with heterogeneous symptomatology. Chronic neuroinflammation contributes to the pathogenesis of PD. Activation of microglia and increased levels of pro-inflammatory mediators such as tumor necrosis factor alpha (TNF-α), interleukine-1 beta (IL-1β), and interleukine-6 (IL-6) have been reported after post-mortem analysis of the substantia nigra from PD patients. This study aimed to estimate the association of TNF-α rs1800629, IL-1β rs16944, and IL-6 rs1800795 with the disease progression in the initial motor stage, after five-year follow-up.

    Material and methods: Our study included 64 consecutive PD outpatients at Hoehn and Yahr disease stage 1. The severity of PD, depression, anxiety, and cognitive impairment were evaluated using rating scales: Unified Parkinson Disease Rating Scale (UPDRS) Part (I-IV), Mini-Mental State Examination (MMSE) score, Hamilton Depression Rating Scale (HAM-D), and Hamilton Anxiety Rating Scale (HAM-A). Patients completed the same protocol at Years 1, 2, 3, and 5. Genotyping of TNF-α rs1800629, IL-1β rs16944, and IL-6 rs1800795 was performed using TaqMan real-time PCR assays.

    Results: IL-1β rs16944 G allele in females has been associated with faster PD progression on UPDRS motor examination (Part III, p=0.014), on motor complications (Part IV, p=0.026), and on UPDRS total (p=0.005). IL-6 rs1800795 GG genotype was statistically significant predictor of depression (p=0.047) and anxiety (p=0.004) progression on related scales.

    Conclusion: Polymorphic variants in IL-1β, and IL-6 genes influence Parkinson’s disease course during five-year follow-up.

    M. Pesic: None. N. Maksimovic: None. A. Aleksic: None. M. Gulic: None. A. Djuranovic: None. M. Grk: None. M. Dusanovic Pjevic: None. I. Stankovic: None. V. Markovic: None. A. Marjanovic: None. I. Novakovic: None. N. Dragasevic-Miskovic: None. V.S. Kostic: None.

    E-P09.53 Search for molecular genetic factors in Parkinson’s disease

    M. Shadrina1, S. Pchelina2, S. Illarioshkin3, P. Slominsky1

    1Institute of Molecular Genetics, Russian Academy of Sciences, Moscow, Russian Federation, 2The Petersburg Nuclear Physics Institute of the National Research Center, Kurchatov Institute, Russian Academy of Sciences, Gatchina, Russian Federation, 3Federal State Scientific Institution, Scientific Center of Neurology, Russian Academy of Sciences, Moscow, Russian Federation

    Introduction: At present, there is no doubt about the complexity of the nature of the pathogenesis of Parkinson’s disease (PD) due to disruption in the functioning of various metabolic systems, which leads to dopaminergic system deficiency. At the moment, there is no single picture of the etiopathogenesis of this disease.

    Materials and methods: Toxic models of PD in rodents and various samples of patients with PD were studied using sequencing of full exome, transcriptome, and RT-PCR.

    Results: An analysis of patients with a presumed autosomal dominant form of PD revealed eight new genes, mutations in which can lead to the development of the disease, was carried out. Three different variants were detected in the SCN3A gene in three patients. Analysis of toxic models of PD revealed new ones that can play an important role at different stages of pathogenesis (vesicular transport, projection of neurons, RNA splicing and myelination processes). A detailed analysis of the mRNA level of individual genes in the peripheral blood of patients with PD revealed several genes, the level of which specifically varied in untreated patients with PD.

    Conclusion: Our data indicate a consistent involvement of the transcriptome in the pathogenesis of PD and highlight the independent role of various brain structures and individual parts of nerve cells in the formation of a response to the development of neurodegeneration. In addition, we showed the possible involvement of SCN3A in the process of neurodegeneration. This work was supported by the Russian Science Foundation (grants 20-15-00262).

    M. Shadrina: None. S. Pchelina: None. S. Illarioshkin: None. P. Slominsky: None.

    E-P09.54 Polymorphism of the functional promoter microsatellite locus of the arginine vasopressin receptor in Yakut men are linked to extraversion & neuroticism personality traits

    S. S. Nakhodkin1, N. A. Barashkov1,2, V. G. Pshennikova1,2, S. A. Fedorova1

    1M.K. Ammosov North-Eastern Federal University, Yakutsk, Russian Federation, 2Laboratory of Molecular Genetics, Yakut Scientific Centre of Complex Medical Problems, Yakutsk, Russian Federation

    Polymorphism of the functional promoter microsatellite locus of the arginine vasopressin receptor (AVPR1A) can cause the formation of personality traits characterized by impulsivity, poor control of one’s impulses, extravagance, anxiety, exaggeration of the expected danger and an acute reaction to social disapproval. In this paper, we evaluated the effect of the RS1 locus in the AVPR1A gene, in the formation of personal characteristics in 121 individuals of Yakut men, and also conducted a comparative analysis of the frequency distribution of alleles and genotypes. The study revealed the involvement of the polymorphic marker RS1 in the formation of such personal traits as "avoidance of damage" and "dependence on reward". The data obtained indicate a modulating effect of ethnicity on identifying associations of the AVPRA1 gene with personality traits. The frequencies of RS1 alleles differed in Yakut (Asian) volunteers compared to white (Finland, Ireland, Israel), and European white populations had a higher range of GATA track diversity. We identified seven different alleles of the RS1 marker. At the same time, short and long alleles (R8, R14, R15, R16) were absent in our sample in homozygous form. The Yakut population is characterized by a pronounced deficit of heterozygotes and a low level of actual heterozygosity, which can be explained by the founder effect in the Yakut population. The work was supported by the Ministry of science and higher education of the Russian Federation (the main part of NEFU) and with the support of RFBR grant (18-05-600035_arctic).

    S.S. Nakhodkin: None. N.A. Barashkov: None. V.G. Pshennikova: None. S.A. Fedorova: None.

    E-P09.55 Further evidence of the expanding clinical spectrum of PIGT-CDG: from epileptic encephalopathy to intellectual disability with epilepsy.

    I. Ben Ayed1,2, F. Kamoun3, A. Souissi4, A. Bouzid4, M. Ben Said4, S. Ben Nsir3, W. Bouchaala5, A. Tlili6,7, C. Triki3, S. Masmoudi4

    1Laboratory of Molecular and Cellular Screening Processes, Center of Biotechnology of Sfax, University of Sfax, Tunisia., SFAX, Tunisia, 2Medical Genetic Department, University Hedi Chaker hospital of Sfax,, Sfax, Tunisia, 3Child Neurology department, Universitary Hedi Chaker hospitol of Sfax,, SFAX, Tunisia, 4Laboratory of Molecular and Cellular Screening Processes, SFAX, Tunisia, 5Child Neurology department, Universitary Hedi Chaker hospitol of Sfax,, SFAX, Tunisia, SFAX, Tunisia, 6Department of Applied Biology, College of Sciences, University of Sharjah, Sharjah, United Arab Emirates, 7Human Genetics and Stem Cell Laboratory, Research Institute of Sciences and Engineering, University of Sharjah, Sharjah, United Arab Emirates

    Introduction: PIGT-CDG is a rare Glycosylphosphatidylinositol disorder. The patients show a broad clinical spectrum from epileptic encephalopathy to severe intellectual disability and treatable epilepsy with later age at onset.

    Patient and Methods: Illumina® TruSight™ One clinical exome was performed in a 4-year-old girl with MiSeq next-generation sequencing platform in order to explore a profound developmental delay associated with severe hypotonia, seizure, and nystagmus.

    Results: The analysis revealed a homozygous missense variant in PIGT (NM_015937.6): c.1519C>T (p.Arg507Trp). Segregation analysis supports the recessive pattern of inheritance. The pathogenicity of p.Arg507Trp was estimated as deleterious by web-based prediction tools. So far 26 patients with a GPI anchor deficiency due to recessive PIGT variants have been described. Our patient shares the most common features associated with PIGT-CDG: intellectual disability/development delay, seizures, nystagmus, and brain MRI anomalies. Most of the published PIGT deficient patients had evident cortical and cerebellar atrophy. Our patient demonstrated severe atrophy of the cerebral hemispheres with slight atrophy of the cerebellum at the age of 4 years. If the predominant presentation of patients is that of an epileptic encephalopathy including severe drug resistance, only some cases (4/26) with severe ID and treatable epilepsy with later age at onset were reported. Our patient had a global developmental delay with seizures; she became seizure-free with only one antiepileptic drug.

    Conclusion: Here, a report a novel pathogenic missense variant in PIGT gene associated with treatable epilepsy strengthening the hypothesis that missense variant can lead to cause a milder phenotype with treatable seizures

    I. Ben Ayed: None. F. Kamoun: None. A. Souissi: None. A. Bouzid: None. M. Ben Said: None. S. Ben Nsir: None. W. Bouchaala: None. A. Tlili: None. C. Triki: None. S. Masmoudi: None.

    E-P09.56 Primary familial brain calcification manifesting as isolated paroxysmal dyskinesia: Case report of a patient with a homozygous MYORG change

    A. Westenberger1, G. Saranza2, K. Grütz1, C. Klein1, A. E. Lang2,3

    1Instituteof Neurogenetics, University of Lübeck, Lübeck, Germany, 2Edmond J. Safra Program in Parkinson’s Disease and the Morton and Gloria Shulman Movement Disorders Clinic, Toronto Western Hospital, Toronto, ON, Canada, 3Division of Neurology, Department of Medicine, University of Toronto, Toronto, ON, Canada

    Introduction: Primary familial brain calcification (PFBC) is a hereditary disorder characterized by calcium deposits in the brain and presenting clinically with neuropsychiatric symptoms, cognitive dysfunction, or a variety of movement disorders. Currently, changes in six genes are known to cause PFBC, with SLC20A2, PDGFB, PDGFRB, XPR1 variants related to autosomal dominant forms and MYORG and JAM2 variants to autosomal recessive ones.

    Patients and Methods: We identified a 26-year-old female patient, presenting with periodic involuntary posturing of her limbs and symmetrical bilateral brain calcifications. Genetic testing was performed for PRRT2, SLC20A2, PDGFB, PDGFRB, XPR1, and MYORG. Her parents also underwent targeted MYORG sequencing.

    Results: In our patient, the paroxismal kinesigenic attacks first appeared at eight years of age, became more frequent in her teenage years (up to ten attacks per day) and were completely absent during her pregnancies. Neurologic examination was normal between episodes. Neuroimaging revealed symmetrical bilateral calcifications involving the cerebellum, basal ganglia, thalamus, midbrain, and the frontal and occipital cortical and subcortical areas. In addition, in her pregnancies, the placentae were noted to have widespread calcification. Our genetic analyses identified a homozygous previously reported and likely pathogenic missense variant in the MYORG gene (c.1831C>T; p.Arg611Trp) and no PRRT2 changes in our patients. Her father carried the same heterozygous MYORG variant and showed no brain calcification.

    Conclusions: We report a homozygous MYORG change as the most likely cause of PFBC presenting as paroxysmal dyskinesia in our patient and thus expand the known phenotypic spectrum of MYORG-associated PFBC.

    A. Westenberger: F. Consultant/Advisory Board; Modest; Centogene. G. Saranza: None. K. Grütz: None. C. Klein: F. Consultant/Advisory Board; Modest; Centogene. A.E. Lang: None.

    E-P09.57 A Portuguese family-based exome sequencing in primary headaches

    A. Dias1,2, M. Alves-Ferreira1,2, J. Sequeiros1,2, J. Pereira Monteiro1, A. Sousa1,2, C. Lemos1,2

    1i3S – Instituto de Investigação e Inovação em Saúde, Porto, Portugal, 2ICBAS - Instituto Ciências Biomédicas Abel Salazar, Porto, Portugal

    Introduction: Primary headaches comprises migraine with or without aura (MA/MO) and cluster headache (CH). During the last 17 years, our group has been able to clinically characterize more than a thousand patients, relatives and controls and we performed several candidate-gene association studies in different pathways. Moreover, we found several variants involved in the vascular component, trigeminal nociceptive plasticity, neurogenic inflammation and in the release of neurotransmitters. However, these complex diseases are caused by several genetic factors. Whole-exome sequencing (WES) is a powerful approach to explore coding regions, particularly low-frequency variants. Our aim was to perform a WES in three families to unravel genetic factors involved in migraine and CH susceptibility.

    Materials and methods: We gathered clinical information and DNA samples from 3 families with primary headaches and associated phenotypes. Afterwards, a WES was performed.

    Results: We analysed 20 patients from the 3 families and we found common and rare variants in genes already associated with migraine subtypes as CACNA1A and PRRT2 and in new genes that may open new pathways of study.

    Conclusions: These preliminary results need to be further explored and interactions among these variants need to be understood to deepen the pathophysiological pathways of migraine. In the future, we will also correlate epigenetics and brain activity data to assess the risk of chronic and episodic migraine in women. Understanding the mechanisms underlying primary headache pathophysiology could lead to the development of more effective and better-tolerated therapeutic approaches to avoid the overlay of painful events.

    A. Dias: None. M. Alves-Ferreira: None. J. Sequeiros: None. J. Pereira Monteiro: None. A. Sousa: None. C. Lemos: None.

    E-P09.58 Prevalence of PTEN mutations in Turkish children with autism spectrum disorders and macrocephaly

    H. Kaymakcalan1, I. Kaya2, N. Cevher Binici3, B. Ozbaran4, G. Ozyurt5, S. Erbilgin6, E. Nikerel7, M. Aksoy4, D. Celik4, S. Kose4, N. Majroh4, S. Duruk3

    1Demiroglu Bilim University, Istanbul, Turkey, 2Istanbul University, Istanbul, Turkey, 3Behcet Uz Hospital, Izmir, Turkey, 4Ege University, Izmir, Turkey, 5Katip Celebi University, Izmir, Turkey, 6Okmeydanı Hospital, Istanbul, Turkey, 7Yeditepe University, Istanbul, Turkey

    Prevalence of PTEN mutations in Turkish children with autism spectrum disorders and macrocephaly Introduction: Recently, people with autism spectrum disorders (ASD) and macrocephaly were found to carry mutations in PTEN gene. Mutations in this gene cause PTEN Hamartoma Tumour Syndrome (PHTS). However, PHTS often goes undetected especially in children since the manifestations of the disease are variable and subtle and guidelines for testing are few. Studies show 1 to 17% prevalence rates of PTEN mutations in children with ASD and macrocephaly. The varying results on prevalence suggest the need for further studies. The aim of our study is to find PTEN prevalence in Turkish children with ASD and macrocephaly and increase awareness of this syndrome in Turkey. To the best of our knowledge this will be the first PTEN prevalence study done in Turkey and South Eastern Europe. This is also the largest pediatric cohort for PTEN prevalence study in patients with ASD and macrocephaly. Materials and methods: PTEN sequencing were done for 128 patients with ASD and head circumference size more than 97% on growth charts between the ages of 3 to 18 recruited from five different child and adolescent psychiatry clinics in Turkey. Result: We found 2 known pathogenic, 1 new pathogenic and 2 variants of insignificance (VUS) mutations out of 128 patients. The prevalence is 2,3% (VUS mutations are excluded). Conclusion: We recommend PTEN testing in patients with ASD and macrocephaly. Grant for this study is awarded by ‘PTEN Research’ in London, UK.

    H. Kaymakcalan: None. I. Kaya: None. N. Cevher Binici: None. B. Ozbaran: None. G. Ozyurt: None. S. Erbilgin: None. E. Nikerel: None. M. Aksoy: None. D. Celik: None. S. Kose: None. N. Majroh: None. S. Duruk: None.

    E-P09.60 Potential genetic modifiers of the inherited neurodegenerative disorder SCA3

    R. M. Burger1,2,3,4, M. L. Saraiva-Pereira5, M. Franca6, C. Gordon7, L. B. Jardim5, M. Cornejo-Olivas8, O. Rieß1,2,3, T. Schmidt1,2,3

    1University of Tübingen, Medical Genetics and Applied Genomics, Tübingen, Germany, 2University of Tübingen, Center of Rare Diseases, Tübingen, Germany, 3University of Tübingen, NGS Competence Center of Tübingen (NCCT), Tübingen, Germany, 4IZKF, Graduate program of the University of Tübingen, Tübingen, Germany, 5Laboratório de Identificação Genética, Hospital de Clínicas de Porto Alegre, Porto Alegre, Brazil, 6Department of Neurology, University of Campinas-UNICAMP, Campinas, Brazil, 7Sackler Faculty of Medicine, Tel Aviv University,, Tel Aviv, Israel, 8Neurogenetics Research Center, Instituto Nacional de Ciencias Neurológicas, Lima, Peru

    Background: Spinocerebellar ataxia type 3 (SCA3) is an autosomal-dominantly inherited neurodegenerative disease and the most common inherited ataxia worldwide. Its pathogenic mutation is an abnormal expansion of the CAG repeats over 55 triplet-repeats within the ATXN3 gene which encodes for an excessively long polyglutamine (polyQ) tract in the disease protein ataxin-3. Patients show a widely spread variation in age at onset and clinical variability of phenotype. Until today this phenomena is not fully explained. In the past, it was shown that the age at onset inversely correlates with the expanded CAG repeats. Within the wide range of age at onset between 5-75 years only 45-60% can be explained by the CAG repeat expansion.

    Aim: The aim of our study is to identify genetic modifiers which can explain the wide range of age at onset as well as the clinical heterogeneity of SCA3.

    Methods: Previously several genes (ATXN3, ATXN2, APOE, CACNA1A) were described as candidate genes in literature. We are genotyping two big cohorts EUROSCA (Europe) and EUSAge (Israel, Brazil, Peru) in terms of single-nucleotide polymorphism (SNP) within candidate genes.

    Results and Conclusion: A variation in polymorphism can lead to different isoforms of the genes, functional changes of the encoding proteins and different interactions with molecules. A SNP in ATXN3 has already been found to influence the pathophysiology of SCA3. Therefore, SNPs of candidate genes seem to have an influence on the pathophysiology of SCA3 and may be promising genetic modifiers to observe further in order to learn more about the disease.

    R.M. Burger: None. M.L. Saraiva-Pereira: None. M. Franca: None. C. Gordon: None. L.B. Jardim: None. M. Cornejo-Olivas: None. O. Rieß: None. T. Schmidt: None.

    E-P09.61 Co-ocurrence of two rare genetic diseases in a patient with intellectual disability, refractory epilepsy and skeletal abnormalities

    M. Rodrigues, M. P. Soares, P. Dias, A. B. Sousa

    Serviço de Genética Médica, Hospital de Santa Maria, Centro Hospitalar Universitário de Lisboa Norte EPE, Centro Académico de Medicina de Lisboa, Lisbon, Portugal, Lisbon, Portugal

    Introduction: Whole-exome sequencing (WES) is a powerful tool to identify the genetic causes of rare mendelian disorders and can be particularly useful in patients with complex and genetically heterogeneous phenotypes. The authors describe a patient with phenotypic manifestations of two rare genetic diseases: autosomal recessive cerebellar ataxia type 23 (SCAR23, OMIM #616949) and contractures, pterygia, and variable skeletal fusions syndrome-1A (CPSKF1A, OMIM #178110).

    Methods and results: We report a 21-year-old male patient born to non-consanguineous parents, with irrelevant family history. He has language delay, mild to moderate intellectual disability (ID), refractory epilepsy, fine motor skill deficits, short neck, narrow shoulders, mild facial dysmorphisms, hypoplastic hypothenar eminence and hypoplastic flexion creases. His skeletal survey showed C4-C5 fusion. Brain MRI, karyotype, array-CGH and FMR1 testing were normal. WES revealed two variants in TDP2 gene: c.345_348del, p.(IIe117Profs*7) (likely pathogenic) and c.949C>T, p.(Arg317*) (variant of uncertain significance). These variants have not been previously reported and are in a compound heterozygous state. WES also showed a heterozygous deletion encompassing at least exons 4-7 of the MYH3 gene (likely pathogenic).

    Discussion and conclusions: The presence of variants c.345_348del and c.949C>T in TDP2 gene may justify the neurological findings in our patient, namely ID and epilepsy, establishing the diagnosis of SCAR23. On the other hand, the heterozygous deletion of exons 4-7 of the MYH3 gene might explain the dysmorphic and skeletal findings of the patient, whose features are more suggestive of CPSKF1A. This case illustrates the challenge of diagnosing two genetic disorders co-occurring in the same patient.

    M. Rodrigues: None. M.P. Soares: None. P. Dias: None. A.B. Sousa: None.

    E-P09.62 DIO2 Thr92Ala Reduces Deiodinase 2 Activity and Serum T3 Levels in Patients with Schizophrenia

    O. Ozgen1, G. Akan2, A. Colak3, S. Acar4, F. Oncu5, H. Yanbay5, D. Yeşilbursa5, S. Turkcan5, F. Atalar6

    1Istanbul University Medical Faculty, Aziz Sancar Experimental Research Institute, Molecular Medicine Department, Istanbul, Turkey, 2MUHAS Genetics Laboratory, Biochemistry Department, School of Medicine, Muhimbili University of Health and Allied Sciences, Dar es Salaam, Tanzania, United Republic of, 3Department of Biomedical Engineering, Biomedical Engineering Institute, Bogazici University, Istanbul, Turkey, 4Department of Bioengineering, Yildiz Technical University, Istanbul, Turkey, 5Psychiatry Clinics, Turkish Ministry of Health Bakirkoy Research and Training Hospital for Psychiatry, Neurology and Neurosurgery, Istanbul, Turkey, 6Istanbul University Medical Faculty, Medical Genetics Department, Child Health Institute, Istanbul, Turkey

    Background: Thyroid hormone modulation of crucial brain neurotransmitter systems and the misregulation of these pathways are of particular relevance in schizophrenia (SCH). Type II deiodinase enzyme (DIO2) has a critical potency on thyroid metabolism that converts prohormone thyroxine (T4) to the active hormone triiodothyronine (T3) also it seems that can particular relevance in schizophrenia. The aim of this study was to investigate the genetic contribution of the DIO2 gene to SCH by the genotype analysis of DIO2 Thr92Ala and ORFa-Gly3Asp polymorphisms and to compare the serum levels of free triiodothyronine (FT3), free thyroxine (FT4), and thyroid-stimulating hormone (TSH) concentrations in 290 unrelated Turkish SCH patients and 198 healthy controls.

    Method and Results: We genotyped two single nucleotide polymorphisms (SNPs) Thr92Ala and ORFa-Gly3Asp located on DIO2 gene, and performed SNP association analysis along with the thyroid hormonal status in SCH patients and healthy controls. The distribution of Thr92Ala genotypes in SCH was significantly different compared to controls (p=0.045). In men cohort, both allele and genotype frequencies were found significantly different than controls (p=0.03). However, neither allele and nor genotype frequencies of ORFa-Gly3Asp polymorphism were statistically significant in the study group. Decrease of mean FT3 (p<0.001) and TSH (p=0.004) concentrations were observed in SCH patients compared to controls. Thr92Ala genotypes were found to be significantly associated with FT3 and TSH levels (p<0.05, respectively).

    Conclusion: Our results indicate that DIO2 Thr92Ala reduces Deiodinase-2 Activity and FT3 Levels in Turkish SCH patients. Our findings also show that the importance of thyroid hormone metabolism in SCH.

    O. Ozgen: None. G. Akan: None. A. Colak: None. S. Acar: None. F. Oncu: None. H. Yanbay: None. D. Yeşilbursa: None. S. Turkcan: None. F. Atalar: None.

    E-P09.63 Schizophrenia patients have significantly less f-SatIII and more rDNA repeats compared to healthy donors

    V. Sergeeva1, A. Poletkina1, E. Ershova1, N. Veiko1, A. Martynov1, J. Chudakova1, A. Artyushin1, E. Malinovskaya1, A. Filev1, M. Konkova1, L. Bravve2, N. Zakharova2, G. Kostyuk2, O. Agafonova1, G. Shmarina1, S. Kostyuk1

    1FSBI “Research Centre For Medical Genetics”, Moscow, Russian Federation, 2N. A. Alexeev Clinical Psychiatric Hospital №1, Moscow Healthcare Department., Moscow, Russian Federation

    Introduction: Dysregulation of rRNA biogenesis is implicated in some human diseases. rDNAcopy number (CN) in the genome is a factor at play. F-SatIII is an АТ-rich repeat ofpericentromeric heterochromatin in the first chromosome (1q12). rDNA and 1q12 interact ininterphase cells. rDNA CN might correlate with f-SatIII.

    Materials and methods: We analyzed leukocytes of 469 healthy donors (HD) and 777 patientswith schizophrenia (F20.00, SP). CN was determined using non-radioactive hybridization withbiotin-labelled DNA probes.

    Results: Genomes of SP contain increased levels of rDNA CN and decreased levels of f-SatIIIcompared to HD: 532 ± 118 copies with 18,0 ± 5,9 pg/ng of f-SatIII and 413 ± 105 copies with21,6 ± 6,9 pg/ng of f-SatIII, respectively, p < 10 -80. Amount of f-SatIII depends on rDNA CN:DNA of HD and SP containing low (200 - 350) or high (>700) CN of rDNA contained 10 - 30pg/ng of f-SatIII. 55% of SP have 500 - 600 CN of rDNA and 15-20 pg/ng of f-SatIII. Only 15% of HD have the same numbers. 16% of SP have <20 pg/ng of f-SatIII and rDNA CN > 500with their ratio > 40, only 1.5% of HD have this ratio. 26% of HD have rDNA CN <400, f-SatIII> 20 pg/ng and their ratio <20 and only 1, 9% of SP are in this area. Thus, there is acorrelation between rDNA CN and the size if heterochromatin regions.

    Conclusions: SP have significantly less f-SatIII and more rDNA repeats compared to HD.

    V. Sergeeva: None. A. Poletkina: None. E. Ershova: None. N. Veiko: None. A. Martynov: None. J. Chudakova: None. A. Artyushin: None. E. Malinovskaya: None. A. Filev: None. M. Konkova: None. L. Bravve: None. N. Zakharova: None. G. Kostyuk: None. O. Agafonova: None.G. Shmarina: None. S. Kostyuk: None.

    E-P09.65 SORL1 variant associated with familial Parkinson’s disease and dementia in a large Greek pedigree.

    T. Bourinaris1, G. Xiromerisiou2, H. Houlden1, A. Singleton3, SYNaPS study group, J. Hardy1, J. Vandrovcova1

    1UCL Institute of Neurology, London, United Kingdom, 2University of Thessaly, Larissa, Greece, 3National Institute on Aging, Bethesda, MD, United States

    Background: 10% of Parkinson’s disease is caused by certain monogenic forms. Several causal genes have been identified today but the understanding of underlying genetic mechanisms has proved challenging. Many of the affected families remain genetically unsolved.

    Methods: In this study we use molecular techniques to investigate a large pedigree with many affected individuals from an isolated village in central Greece affected by a high incidence of Parkinson’s disease. We utilized whole exome sequencing and linkage analysis to identify coding variants that are of putative significance. We then apply association analysis across a wider population to highlight the significance of these variants in sporadic cases.

    Results: Linkage to chromosome 11 was found with a LOD score of 2.2. The phenotypic spectrum of our patients was not uniform: 3 presented with Parkinson’s disease without dementia, while another 2 presented with dementia that was later classified as Alzheimer’s disease. All patients carried a novel heterozygous variant in SORL1 segregating with disease in the family.

    Conclusions: This is the first report of the discovery of a likely pathogenic variant in SORL1 in a large family with some of the affected individuals presenting with Parkinson’s disease without dementia at disease onset.

    T. Bourinaris: None. G. Xiromerisiou: None. H. Houlden: None. A. Singleton: None. J. Hardy: None. J. Vandrovcova: None.

    E-P09.66 Molecular Complexity of Spastic Ataxias and Hereditary Spastic Paraplegias in Turkey

    G. Simsir1, S. Tekgul1, H. Apaydin2, S. Ertan1, A. Basak1

    1Koç University, Istanbul, Turkey, 2Istanbul University-Cerrahpasa, Istanbul, Turkey

    Introduction: Hereditary spastic paraplegias (HSPs) and autosomal recessive cerebellar ataxias (ARCAs) are neurological diseases that may overlap genetically and clinically. Both can be associated with other neurologic or non-neurologic symptoms and complex phenotypes. Significantly, ARCAs frequently show pyramidal involvement, which results in spasticity. Molecular analysis is challenging due to complex genetics and rarity of these diseases. However, recent developments in next generation sequencing technologies help to understand complex genetic background of these diseases.

    Materials and methods: DNA isolated from peripheral blood was used. 37 probands with spasticity and ataxia were subjected to whole exome sequencing (WES), followed by bioinformatic analysis. Most families were consanguineous.

    Results: 26 mutations (15 novel) in 10 genes were identified (Table1). Table1 Genes and mutations identified by WES in the Turkish cohort under study

    Genes (# of families)MutationsNovel/Reported
    SACS (n=7)c.8867T>C p.Leu2956Ser c.12923_12927delAAGAA p.Lys4308SerfsTer21 c.4192T>C p.Cys1398Arg c.11374C>T p.Arg3792Ter c.7205_7206delTT p.Leu2402ArgfsTer6 c.3484G>T p.Glu1162Ter c.7732_7734delGAT p.Asp2578del and c.3767A>G p.Tyr1256CysNovel Novel Novel Reported Reported Reported Novel-Novel
    SPG7 (n=5)c.1861C>T p.Gln621Ter c.1715C>T p.Ala572Val c.2096T>C p.Met699Thr c.1861C>T p.Gln621Ter / c.1715C>T p.Ala572Val*Novel Reported Novel Novel/Reported
    CAPN1 (n=4)c.759+1G>A c.397C>T p.Arg133Ter c.907T>G p.Trp303Gly c.397C>T p.Arg133TerReported Reported Novel Reported
    SPG11 (n=2)c.7158_7161dupACAA p.His2388ThrfsTer6 c.3809T>A p.Val1270AspNovel Reported
    HSD17B4 (n=2)c.425A>G p.Asp142GlyNovel
    MRE11A (n=1)c.1442C>A, p.Thr481LysReported
    KIF1C (n=1)c.866A>C p.Gln289Pro and c.940+1G>ANovel-Novel
    VPS13D (n=1)c.12629C>T p.Ala4210ValReported
    PNPLA6 (n=1)c.940C>T p.Arg314TrpNovel
    SYNE1 (n=1)c.3371A>G p.Asp1124GlyNovel

    All patients are true homozygotes except one compound heterozygote*

    Conclusions: 25/37 probands were solved, corresponding to 68% diagnostic yield. The genes identified point to a high heterogeneity and complexity of the cohort investigated. The results further reveal the well-known genetic overlap among HSPs and ARCAs.

    G. Simsir: None. S. Tekgul: None. H. Apaydin: None. S. Ertan: None. A. Basak: None.

    E-P09.67 A homozygous pathogenic variant in the STAMBPgene associated with microcephaly-capillary malformation syndrome - the first case report in a Roma patient

    M. Giertlova1, M. Mistrik1, J. Saligova2, E. Zavadilikova2, A. Baranova2, M. Hyblova3, G. Minarik3

    1Alpha medical Inc., Martin, Slovakia, 2Pediatric University Hospital and Medical faculty, University of P. J. Safarik, Kosice, Slovakia, 3Medirex Inc., Bratislava, Slovakia

    Introduction: The gene STAMBP (STAM-binding protein) encoding a deubiquitinating enzyme is associated with microcephaly-capillary malformation syndrome (MIC-CAM) (OMIM 614261). We present a case study of the patient with the MIC-CAM phenotype with a homozygous pathogenic variant in the STAMBP gene.

    Material and methods: The full-term newborn presented with microcephaly (-3.3SD) and small capillary malformations in different areas of the body. Focal myoclonic spasms developed from the 3rd month of age. At the 6th month, the focal EEG abnormalities, brain atrophy and profound developmental delay with hypotonia led to suspicion of the early infantile myoclonic encephalopathy. Similar clinical findings were documented in her older sister deceased at the 9th month of age. Consanguinity was recorded in the family pedigree. The molecular diagnosis was found by whole-exome sequencing (Illumina NextSeq platform) using Human Core Exome Kit (Twist Bioscience) and confirmed by Sanger sequencing. The detected variants were annotated by Ingenuity Variant Analysis (Qiagen) and classified according to the ACMG criteria.

    Results: Homozygous likely pathogenic missense variant in the STAMBP gene was identified (hg20: chr2:73831044A>G; ENST00000394070.7; c.188A>G; p.Y63C). This genetic finding is consistent with the MIC-CAM phenotype observed in our patient.

    Conclusion: Less than 20 cases of MIC-CAM have been reported so far. We present the first case of MIC-CAM syndrome in a Roma origin patient with homozygous c.188A>G; p.Y63C variant in the STAMBP gene. The heterozygous variants occur in gnomAD Exomes exclusively in the European population with frequency 0.000014. The hypothesized founder effect of the variant remains to be clarified.

    M. Giertlova: None. M. Mistrik: None. J. Saligova: None. E. Zavadilikova: None. A. Baranova: None. M. Hyblova: None. G. Minarik: None.

    E-P09.68 Expressivity of mutations in TUBB2B is highly variable

    J. Dekker, K. E. M. Diderich, R. Schot, D. J. Smits, M. Wilke, M. A. van Slegtenhorst, G. M. S. Mancini

    Erasmus MC, Rotterdam, Netherlands

    Microtubules play an important role during cortical development by regulating mitosis and neuronal migration. TUBB2B codes for one the β-isoforms of tubulin and dominant negative mutations in this gene result in malformations of cortical development (MCD) like polymicrogyria, pachygyria, dysmorphic basal ganglia, epilepsy and intellectual disability. However, phenotypic heterogeneity has been reported in cases with isolated congenital fibrosis of extraocular muscles (CFEOM3A) and myoclonus-dystonia. Here we show three individuals in one family with a missense variant in TUBB2B, who exhibit an unusual phenotype. At 21 week of gestation advanced US revealed a foetus with relative small head, enlarged lateral ventricles, borderline hypoplastic cerebellum and a thin corpus callosum, which were less pronounced at MRI. Given the uncertain prognosis, the couple decided to terminate the pregnancy. Exome sequencing on foetal material identified a heterozygous maternally inherited variant in TUBB2B (c.530A>T, p.Asp177Val), not present in GnomAD and predicted damaging. The healthy mother had only a language delay in childhood. The oldest son of the couple was also examined because of mild delay of both motor skills and speech. He follows regular education programme with extra support. The same variant in TUBB2B was confirmed in the son. His MRI revealed decreased supratentorial brain volume, enlarged ventricles, mild cortical dysgyria, thin corpus callosum and dysmorphic vermis and basal ganglia, a pattern typical of tubulinopathies. Although we cannot exclude that the mother is a mosaic carrier, these results illustrate the wide phenotypic heterogeneity of tubulinopathies, including reduced penetrance and very mild expressivity.

    J. Dekker :None. K.E.M. Diderich: None. R. Schot: None. D.J. Smits: None. M. Wilke: None. M.A. van Slegtenhorst: None. G.M.S. Mancini: None.

    E-P09.69 An infant with two de novo variants causing recessive and dominant disorders: Diagnostic challenge

    A. Sezer1, Ö. B. Gündoğdu Öğütlü1, Z. Türkyılmaz2, K. Gücüyener3, G. Kayhan1, F. E. Perçin1

    1Gazi University Department of Medical Genetics, Ankara, Turkey, 2Gazi University Department of Pediatric Surgery, Ankara, Turkey, 3Gazi University Department of Pediatric Neurology, Ankara, Turkey

    Introduction: Inherited Glycosylphosphatidylinositol deficiencies (IGDs) are a subclass of Congenital Defects of glycosylation. Most common findings of IGDs are developmental delay, seizures, and persistent hyperphosphatasia. Moreover GRIN2B mutations cause another rare neurodevelopmental disorder which has overlapping findings with IGDs, e.g. developmental delay, intellectual disability and epilepsy. Herein, it is aimed to present a case diagnosed with two de novo variants in PIGO and GRIN2B genes: one is causing a dominant and the other is causing a recessive disorder.

    Material Method: A seven-month-old girl was presented with hydronephrosis, seizure, microbrachycephaly, bilateral hypoplastic fifth fingernails, abnormal distal phalanx morphology of fingers on radiography and persistent hyperphosphatasia. There was no consanguinity of her parents. Whole-exome sequencing (WES) analysis was performed to evaluate genetic etiology.

    Results: Two rare variants in PIGO (NM_032634.4) gene; c.1944C>G (p.Cys648Trp) and c.2708_2710delTCT (p.Phe903del) were shown by WES analysis. Sanger sequencing performed to the parents, and unveiled that those two variants was maternal and de novo respectively. The variants were evaluated as in trans position, by using a heterozygous polymorphism (rs505297) and NGS readings of WES data. Further, a rare de novo variant was detected in GRIN2B (NM_000834.5) gene: c.1852G>A (rs1428234478) (p.Val618Ile).

    Conclusion: Some prospective and retrospective studies have been shown the underestimated number of multiple molecular diagnosis of which results in phenotypes overlapping or separated. In our case phenotypes of two diagnosis were overlapping. If one of multiple genetic diagnoses had been overlooked, this would change the present or future management options of disorders and genetic counseling to families.

    A. Sezer: None. Ö.B. Gündoğdu Öğütlü: None. Z. Türkyılmaz: None. K. Gücüyener: None. G. Kayhan: None. F.E. Perçin: None.

    E-P10 Neuromuscular Disorders

    E-P10.01 Aicardi-Goutières Syndrome: unexpected another gene mutation which related epilepsy: a case report

    F. Duymus1, B. Goksel Tulgar1, D. Esin1, G. Turkoglu1, M. E. Sarı1, T. Cora1, A. Kartal2

    1Selcuk University Faculty of Medicine, Medical Genetics Department, Konya, Turkey, 2Selcuk University Faculty of Medicine, Pediatric Neurology Department, Konya, Turkey

    Aicardi-Goutières syndrome (AGS) is an inherited encephalopathy that mainly affects the brain, the immune system, and the skin. Several of the genes (TREX1, RNASEH2A, RNASEH2B, RNASEH2C, IFIH1, ADAR, SAMHD1) mutations can cause AGS. The syndrome can be seen as autosomal dominant/recessive. Generally, the onset of AGS occurs within the first few days or months of life. In our case, the most severe neonatal form of AGS1 is typically due to mutation in the TREX1 gene. In addition to our patient, SPTAN1 gene mutation was detected. This gene mutation can cause Early infantile epileptic encephalopathy type 5 which inherited autosomal dominant. We thought that the common point of the two mutations might be severe epilepsy and cerebellar atrophy for our patient. Her epileptic attacks started at about 4 months of age. On the physical examination microcephaly, joint stiffness, dystonia, abnormal eye movements, tetraplegic spasticity, and neuromotor developmental retardation were presented. In cranial MR, cerebral atrophy, intracerebral calcifications, and calcifications of the periventricular area were observed. Epilepsy attacks started at the age of 3 months. We performed RNASEH2B gene sequence analysis in the patient and could not detect a mutation. We detected two mutations with whole-exome sequencing. One of them was homozygous c.13_15dupATC mutation in the TREX gene and the other was heterozygous c.2882 C> T in the SPTAN1 gene. AGS is a very rare disease of unknown frequency. Our aim in presenting this case is to see two rare mutations together and think that the disease can change its severity.

    F. Duymus: None. B. Goksel Tulgar: None. D. Esin: None. G. Turkoglu: None. M.E. Sarı: None. T. Cora: None.A. Kartal: None.

    E-P10.02 Penetrance of Familial Amyloid Polyneuropathy in Huelva. One of the most important foci in worldwide

    Á. Gragera Martínez1, L. Herranz Arriero2, C. Borrachero Garro1, F. Muñoz Beamud1

    1Juan Ramon Jimenez University Hospital, Huelva, Spain, 2Badajoz University Hospital, Badajoz, Spain

    Introduction: Hereditary amyloidosis mediated by transthyretin (hATTR) is a hereditary, neurodegenerative, progressive, highly disabling and life-threatening disease in short term if an early treatment is not established. It is a rare disease, with prevalence less than 1 / 100,000 habitants in worldwide. Huelva is one of the most important endemic foci of the disease worldwide and the second in Spain. Inherited with an autosomal dominant pattern characterized by a reduced penetrance, which varies according to age and geographic area. This poses big problems and big challenges to monitoring patients and their families.

    Objectives: To know the penetrance in the endemic focus of Valverde del Camino, Huelva

    Methodology: A retrospective, observational study was performed. For this work, medical records have been collected and statistically analyzed. Demographic details (sex, age at diagnosis of the disease, age at the onset of symptoms) were obtained

    Results: Data from 112 patients have been analyzed

    Conclusions: The prevalence obtained in our population is quite different between mens and womens. A higher proportion of men develop symptoms, most women with the pathogenic variant are asymptomatic. This could be explained by the presence of polymorphisms in the TTR gene that modulate disease expression as well as clinical symptoms. This is a very interesting field of study that will allow us to better understand the disease.

    Population Penetrance
    Age (years)Overall penetrance %Mens penetrances %Womens penetrance %
    30340
    4010162
    5016209
    60283321
    70344025
    >70516037

    Á. Gragera Martínez: None. L. Herranz Arriero: None. C. Borrachero Garro: None. F. Muñoz Beamud: None.

    E-P10.04 Amyotrophic lateral sclerosis (ALS) in the Faroe Islands, a genealogical approach

    M. Johansen1,2, K. Svenstrup3, Ó. Mortensen4, G. Andorsdóttir4, M. S. Petersen1,2

    1Department of Occupational Medicine and Public Health, The Faroese Hospital System, Tórshavn, Faroe Islands, 2Centre of Health Sciences, University of the Faroe Islands, Tórshavn, Faroe Islands, 3Neurological Department, University Hospital Copenhagen, Rigshospitalet and Bispebjerg Hospital, Copenhagen, Denmark, 4FarGen, The Genetic Biobank of the Faroe Islands, Tórshavn, Faroe Islands

    ALS is a progressive neurodegenerative disease. In 5-10% of cases, a family history is identified. Although the incidence of ALS in the Faroes is similar to other European countries, we have observed an overrepresentation of cases originating from the small geographically isolated island of Suðuroy, which lead to the study aim: estimation of familial ALS in the Faroese population. All ALS cases have been registered since 1987. In this study, 43 patients were included. First, familial ALS was recognized when occurring between first- or second-degree relatives. Secondly, the Faroese Multi Generation Register, which contains information about familial relationships since 1650, was used to construct pedigrees amongst patients to identify risk families (≥3 cases within 3 generations). Fifteen cases originated from Suðuroy where the prevalence of ALS was more than 3 times higher than the nationwide prevalence. Six patients had familial ALS (13.9%) of which four originated from Suðuroy. Through pedigrees, we identified six additional patients with possible familial ALS (28%). This study is suggestive of familial clustering in excess of expected for ALS in Suðuroy and the proportion of familial ALS in the Faroe Islands was high. High levels of inbreeding and genetic substructure have been demonstrated in the Faroese population. Combined with these results, there is strong support of a genetic contribution to ALS in the Faroe Islands and further genetic studies are warranted. Funding: Aage og Johanne Louis-Hansens Fond, Minister Erna Hamiltons Legat for videnskab og kunst, Sjúkrakassagrunnurin, Betri Stuðul, Aase og Ejnar Danielsens Fond.

    M. Johansen: None. K. Svenstrup: None. Ó. Mortensen: None. G. Andorsdóttir: None. M.S. Petersen: None.

    E-P10.05 Efficiency of the MPS panel of 15 genes associated with genetically heterogeneous hereditary neuropathies

    M. D. Orlova, O. A. Schagina, O. P. Ryzhkova, G. E. Rudenskaya, E. L. Dadali, A. V. Polyakov

    Research Centre for Medical Genetics, Moscow, Russian Federation

    Introduction: Charcot-Marie-Tooth disease is a genetically heterogeneous pathology related to hereditary peripheral neuropathies. The purpose of the research is to evaluate the efficiency of panel sequencing for a highly genetically heterogeneous pathology.

    Materials and methods: We have studied the DNA of 43 Russian CMT-patients (25 myelinopathy, 18 axonopathy) after excluding the most common cause of CMT – PMP22 duplications. MPS libraries were prepared with the use of Ion AmpliSeq™reagents and sequencing by Ion S5™System. Panel includes 15 CMT genes: MFN2, MPZ, EGR2, FGD4, LITAF, PMP22, PRX, MORC2, SH3TC2, HINT1, HSPB1, NEFL, NDRG1, GDAP1, GJB1, mutations in which were previously identified as the cause of the disease for at least 2 unrelated Russian families.

    Results: After the targeted MPS sequencing, a definite molecular diagnosis defined as a pathogenic or a likely pathogenic variant, was reached in 16% of cases (n = 7). Variants of unknown significance were found in 16% of cases (n = 7). 68% (n=29) of cases were molecularly undiagnosed. In most cases variants were found in the SH3TC2(5) and MFN2(3) genes. 6 patients had variants in the following genes: MPZ, GDAP1, HINT1, LITAF, PRX, MORC2.

    Conclusion: Diagnoses by the MPS panel were confirmed for 16% of the patients, while the WES is efficient in 19-45% of cases. Thus, small MPS-panel is a useful tool for highly genetically heterogeneous pathology. It helps to avoid consequent tests of frequent genes associated with CMT with the Sanger sequencing while having the efficiency comparable to WES.

    M.D. Orlova: None. O.A. Schagina: None. O.P. Ryzhkova: None. G.E. Rudenskaya: None. E.L. Dadali: None. A.V. Polyakov: None.

    E-P10.06 Rapid exome sequencing with in silico variant prioritizing and the diagostic odyssey of a child with various neurological symptoms

    A. Illés1, K. Árvai1, B. Kocsis-Deák1, Á. Herczegfalvi2, P. Lakatos3, J. Kósa1,3

    1PentaCore Laboratories, Budapest, Hungary, 22nd Department of Pediatrics, Semmelweis University, Budapest, Hungary, 3Department of Internal Medicine and Oncology, Semmelweis University, Budapest, Hungary

    Introduction: The hereditary motor and sensory neuropathies are a heterogenous disease group which could be caused by several gene mutations, such as deletions, duplications and single nucleotide substitutions. The complex genetic etiology could harden the differential diagnostics and lengthen the path to identify the genetic background.

    Material and methods: In our case, a four-year-old boy was examined, who born with hypotonia and showed delayed motor development. At the age of three, EMG analysis showed axonal polyneuropathy and motor nerve conduction could not be detected in his legs. After the analysis of copy number variations of PMP22 and SMN genes, further neuropathies associated genes were sequenced without any results. Finally, whole exome sequencing was performed, and the results were analysed by focusing on primer neuropathy associated genes.

    Results: A pathogenic heterozygous S72L mutation (rs104894621) was identified in the PMP22 gene, which was previously associated with Charcot-Marie-Tooth disease. Sanger sequencing also confirmed the result.

    Conclusions: Based on our result the clinical diagnosis was confirmed and the genetic counsellor could provide adequate information to the parents before the birth of the second child. It is important to highlight that in case of neuropathies, after screening copy number variations, performing whole exome sequencing could shorten and make easier the identification of potential pathogenic mutations in the background of the symptoms. The fast identification of causal variants could contribute to the selection of specific therapy and family planning.

    A. Illés: None. K. Árvai: None. B. Kocsis-Deák: None. Á. Herczegfalvi: None. P. Lakatos: None. J. Kósa: None.

    E-P10.10 A novel mutation of DYSF gene in a patient with Limb Girdle Muscular Dystrophy type 2b

    S. Kocagil1, E. Kaplan2, E. Susam1, B. Durak Aras1, S. Artan1, E. Erzurumluoglu Gokalp1, O. Cilingir1

    1Eskisehir Osmangazi University Medical Genetics Department, Eskisehir, Turkey, 2Eskisehir Osmangazi University Pediatric Neurology Department, Eskisehir, Turkey

    Dysferlinopathy muscular disease spectrum encompasses a group of phenotypes; including Limb Girdle Muscular Dystrophy type 2b, Myoshi myopathy, scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. Biallelic pathogenic variants of DYSF gene is known to be responsible for dysferlinopathies. The prevalence of the disease is unknown but incidence is higher in the populations that consanguineous marriage is observed frequently. Here we report a 17 years-old female patient that was referred to our outpatient clinics for proximal muscle weakness. She had difficulty in walking and climbing stairs for the last 6 months. In her physical examination; her deep tendon reflexes of the lower extremities were diminished, her muscle strength was normal and she could walk on the tip of her toes and stand on her heels. Her serum creatine kinase levels were detected over 20.000 U/L repetitively therefore muscle biopsy was planned. Quadriceps femoris muscle histology revealed positive sarcoglycan proteins but reduced dysferline. Due to the muscle biopsy result we have planned DYSF gene sequence analysis and a novel c.754A>G (p.Thr252Ala) variant was detected in homozygous state. This variant was classified as likely pathogenic according to ACMG criteria and segregation analysis revealed the parents of the proband as carrier. According to her physical examination and the result of the molecular analysis we have concluded that this novel mutation generates a phenotype as Limb Girdle Muscular Dystrophy Type 2b of the dysferlinopathy spectrum.

    S. Kocagil: None. E. Kaplan: None. E. Susam: None. B. Durak Aras: None. S. Artan: None. E. Erzurumluoglu Gokalp: None. O. Cilingir: None.

    E-P10.12 The retrieval of candidate genes of inverse comorbidity between cancer and neurodegeneration considering apoptosis as a key process

    D. Gomboeva1, O. Saik2, E. Bragina1, V. Ivanisenko2, V. Puzyrev1

    1Tomsk National Research Medical Center, Tomsk, Russian Federation, 2Federal Research Center Institute of Cytology and Genetics, Novosibirsk, Russian Federation

    Introduction: Epidemiological studies have revealed the reduced cancer incidence in patients with Huntington disease (HD), indicating a presence of inverse comorbidity or dystropy of HD and cancer. The one of promising biological process, which unites these two groups of diseases, is apoptosis. Cancer is characterized by inhibited apoptosis, while in HD, on contrary, apoptosis is up-regulated. Thus, identification of pro- and anti-apoptotic genes and study of their regulation is hopeful for investigation of inverse comorbidity mechanisms of HD and cancer.

    Materials and methods: The genetic network was reconstructed using ANDSystem (Ivanisenko, 2015). Network included all genes and proteins associated with HD (n=140). The list of genes of apoptosis was retrieved from KEGG (hsa04210 identifier, n=136). Prioritization was carried using ToppGene and functions of ANDSystem. The special criteria were calculated, including: betweenness centrality, stress centrality, closeness centrality, cross-talk centrality and cross-talk specificity (Saik et al., 2018). The search of miRNA was conducted using MirTarBase database.

    Results: 10 genes were identified: APOE, BDNF, HSPA4, HTT, IL6, INS, LEP, PSEN1, SP1, SQSTM1. Through the analysis at the miRNA level, we retrieved 5 common miRNA (let-7c-5p; miR-1-3p; miR-149-5p; miR-22-3p; miR-223-3p) regulate of expression of protein coding genes (SP1, HSPA4, BDNF, IL6). All genes are important for neurodegeneration and associated with cancer: play different roles in carcinogenesis, cancer progression dependent on type of cancer.

    Conclusions: The approach uncovered miRNA- apoptotic genes regulation might give new insights into the mechanisms of inverse comorbidity between cancer and neurodegeneration. This work was supported by the RFBR grant No.19-015-00391.

    D. Gomboeva: None. O. Saik: None. E. Bragina: None. V. Ivanisenko: None. V. Puzyrev: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Russian Foundation for Basic Research.

    E-P10.14 A novel compound heterozygous MPV17 mutation causing axonal sensorimotor polyneuropathy

    D. ESIN1, F. DUYMUS1, B. GOKSEL TULGAR1, G. TURKOGLU1, M. E. SARI1, T. CORA1, A. KARTAL2

    1Selcuk University School Of Medicine, Medical Genetics Department, Konya, Turkey, 2Selcuk University School Of Medicine, Pediatric Neurology Department, Konya, Turkey

    Charcot-Marie-Tooth disease type 2EE is an autosomal recessive sensorimotor peripheral axonal neuropathy that is caused by mutations in the MPV17 gene. MPV17 encodes a channel-forming protein of the inner mitochondrial membrane. In this case, it is aimed to present the first clinical report of MPV17-related axonal sensorimotor neuropathy with compound heterozygous mutation. The patient was a 16-year-old male and these second child of healthy, consanguineous parents. He had severe distal muscle atrophy, pes cavus deformity, foot drop, hammertoes, atrophy of the intrinsic hand muscles and bilateral thenar and hypothenar muscles. Hyporeflexia of upper limbs was observed. The first symptom of the patient was the loss of balance and walking difficulty starting at the age of six. c.122G> A and c.376-9T> A mutations in the MPV17 gene was detected by whole-exome sequencing. The MPV17:c.122G>A variant has already been described as a pathogenic variant. The MPV17:c.376-9T> A variant described as a variant of uncertain significance. To the best of our knowledge, the coexistence of these two heterozygous mutations was not found in the literature review. In this case report, we emphasize that a novel compound heterozygous MPV17 mutation can cause non-syndromic peripheral axonal neuropathy and should be considered in the differential diagnosis of juvenile-adult onset severe axonal sensorimotor neuropathy.

    D. Esin: None. F. Duymus: None. B. Goksel tulgar: None. G. Turkoglu: None. M.E. Sari: None. T. Cora: None. A. Kartal: None.

    E-P10.15 LGMD 2E: using sequence analysis to verify sarco-glycanopathy

    L. Khlunovska1, I. Lastivka1, V. Antsupova2, M. Ryznychuk1, L. Hodovaniuk3

    1HSEE of Ukraine, “Bukovinian State Medical University”, Chernivtsi, Ukraine, 2Bohomolets National medical university, Kyiv, Ukraine, 3Bukovynian Center for Rehabilitation and Integrated Rehabilitation of Children, Chernivtsi, Ukraine

    Introduction: Muscular dystrophy of the lumbar girdle (LGMD) is a heterogeneous group of hereditary progressive neuromuscular diseases.

    Material and Methods: A clinical case of LGMD 2E in a 9 year old child. Clinical, genealogical, laboratory and instrumental and molecular-genetic methods were used.

    Results: Girl K., up to 8 years old, developed in accordance with age norms. At age 8, the mother began to notice motor impairment in the child; at age 9, a duck walk appeared. It became difficult for the child to climb the stairs, squat and jump; there was pain in the calf muscles. The girl complained of fatigue during normal physical activity. Objective data: stimulation neuromyography - a decrease in the muscles of the lower extremities (47% on the right and 61% on the left); a 35-fold increase in creatinekinase levels. To clarify the diagnosis, a molecular-genetic examination was assigned: analysis and testing of the removal/duplication of 123 strength genes (Los Angeles, 2019). Two pathogenic variants c.2T>C and c.341C>T (p.Ser114Phe) were identified in the SGCB gene. The SGCB gene is associated with an autosomal recessive LGMD type 2E. Final diagnosis: LGMD 2E (sarco-glycanopathy).

    Conclusions: Significant difficulties arise in the diagnosis of genetic variants of neuromuscular diseases only on the basis of a clinical study. The use of sequence analysis makes it possible to clarify the type of muscular dystrophy. Given the hereditary nature of the disease, it is necessary to recommend genetic counseling and molecular genetic screening for the purpose of prophylaxis and/or prognosis of offspring.

    L. Khlunovska: None. I. Lastivka: None. V. Antsupova: None. M. Ryznychuk: None. L. Hodovaniuk: None.

    E-P10.18 Screening of SMA carrier status in Republic of Moldova

    I. Coliban1, N. Ușurelu2, V. Sacară1

    1Laboratory of Human Molecular Genetics, Institute of Mother and Child,, Chisinau, Moldova, Republic of, 2Laboratory Prophylaxis of Hereditary Pathologies, Institute of Mother and Child,, Chisinau, Moldova, Republic of

    Introduction: Spinal muscular atrophy (SMA) is an autosomal-recessive disease, with a frequency of carriers of 1:35 up to 1: 117 in the Caucasian population. The prevalence of SMA in the Republic of Moldova constitutes 8.43±0,15:100000 population which is significantly higher than the data from Orphanet (2,93) and Russia (0,31- 3,91). 95% of SMA is caused by deletion of exon 7 of SMN1. If both persons in a couple are carriers, they have a 1-in-4 chance of having a child with SMA.

    Materials and methods: 30 persons that formed 15 couples who addressed for family planning, without a family history of SMA were diagnosed for determining the status of exon 7 SMN1 by qPCR method, melting curve. The DNA concentration was measured by spectrophotometry. For PCR reaction each DNA sample was used as 2 replicates for SMN1 exon 7 and 1 replicate for the external standard (ALB, exon 12). EvaGreen was used as a DNA-binding dye.

    Results: For all DNA samples, amplification occurred for both exon 12 ALB and exon 7 SMN1. According to the melting curves, for 22 persons the exon7 SMN1 was determined to be present and for 8 persons was determined heterozygous status (5 women and 3 men). Among those who are heterozygous, 2 people form the same couple.

    Conclusions: Following the Hardy-Weinberg equilibrium (0,23) for 26% of the patients, the status of carriers of the deletion was established. Screening of SMA carriers is an important step in assessing the risk of giving birth to an affected child.

    I. Coliban: None. N. Ușurelu: None. V. Sacară: None.

    E-P10.19 A case of Spinal Muscular Atrophy with Congenital Bone Fractures 2 expands ASCC1 prenatal presentation and mutational spectrum

    G. Mastromoro1, M. Giuffrida2, V. Guida2, D. Guadagnolo1, E. Marchionni1, F. Di Palma1, M. Truglio2, M. Fabbretti2, B. Torres2, T. Mazza2, A. De Luca2, M. Roggini1, L. Bernardini2, A. Pizzuti1

    1Sapienza University of Rome, Rome, Italy, 2Casa Sollievo della Sofferenza IRCCS Foundation, San Giovanni Rotondo, Italy

    Introduction: Spinal muscular atrophy with congenital bone fractures 2 (SMABF2) is a rare autosomal recessive neuromuscular disorder characterized by arthrogryposis multiplex congenita and prenatal fractures. Reported patients present biallelic loss-of-function single-nucleotide variants in ASCC1 gene, encoding a subunit of the transcriptional coactivator ASC-1 complex. We describe the first SMABF2 case with documented prenatal disease evolution, caused by an in-frame microdeletion and a nonsense nucleotide variant in a stillbirth.

    Materials and methods: The stillbirth, born from non-consanguineous parents, presented hydrops, lower limbs hyperextension with bending of the hips, bilateral club-foot and congenital fractures. Prenatal ultrasound had showed bilateral club-foot, closed fists and fetal biometric parameters at middle-lower limits. Microarray analysis was performed on DNA extracted from umbilical cord. Data were analyzed by CytoGenomics software. Next Generation Sequencing analysis was performed using the TruSightOne sequencing panel kit. NGS data were processed and analyzed using an in-house implemented pipeline.

    Results: A 64Kb microdeletion, involving four exons of ASCC1, was detected by microarray analysis. NGS disclosed a single-nucleotide variant of the same gene (c.1027C>T; p.Arg343*), resulting in a premature termination codon.

    Conclusions: This is the first case of ASCC1 due to an exonic microdeletion and a nucleotide variant in compound heterozygosity, expanding the mutational spectrum of this gene. This case provides further evidence that exonic copy number variants are an underestimated cause of disease-alleles and that the integrated use of the last generation genetic analysis tools, together with careful clinical evaluations, are fundamental for the characterization of rare diseases even in prenatal setting.

    G. Mastromoro: None. M. Giuffrida: None. V. Guida: None. D. Guadagnolo: None. E. Marchionni: None. F. Di Palma: None. M. Truglio: None. M. Fabbretti: None. B. Torres: None. T. Mazza: None. A. De Luca: None. M. Roggini: None. L. Bernardini: None. A. Pizzuti: None.

    E-P10.20 An interesting case: 30-year-old male patient with myotonic dystrophy typeI has got normal CTG repeats sequence in the DMPK gene, but it does not comply with its clinical features

    S. Tutgun Onrat1, M. Elmas1, H. Demirbaş2

    1Afyon Health Science University, Faculty of Medicine, Department of Medical Genetics, Afyonkarahisar, Turkey, 2Afyon Health Science University, Faculty of Medicine, Department of Neurology, Afyonkarahisar, Turkey

    Introduction: Myotonic dystrophy type 1 DM1 is inherited in an autosomal dominant pattern a multisystem disorder, caused by expansion of a CTG trinucleotide repeat in the 3′-untranslated region of the DMPK gene, with pathogenic alleles ranging from around 50 to over 1000 CTG triplets repeats (1). Some features include skeletal muscle weakness and myotonia. The age at onset is extremely variable in DM1, and inversely correlates with the expansion size and individual-specific differences in somatic instability (2-4).

    Materials and methods: We want to present most interestingly our patient-male (30 years) with Myotonic Dystrophy Type I disease, the exact number of repeats of the CTG trinucleotide for both alleles of the DMPK1 gene was detect by PCR-Fragman analysis. Afterwards, the age of the disease, the clinical severity of the disease, radiological and laboratory findings were compared with these patients. In addition, detailed pedigree analysis of the patients was performed and thus anticipation and variable expressivity of the disease was determined.

    Results: We find a result of the important in terms of myotonic dystrophy; he has got clinically myotonic discharges in EMG(electromyography) diagnosed as myotonic dystrophy, but when examined in terms of the number of repeats, the DMKP1 gene was a normal number of repeats in terms of 8/17 for both alleles.

    Conclusions: Myotonic dystrophies represent the most variable clinical phenotypes, so treatment stratification is key for any modern therapeutic approach. We still need much more understanding of the signs and symptoms of Myotonic dystrophies patients in correlation to their molecular origins.

    S. Tutgun Onrat: None. M. Elmas: None. H. Demirbaş: None.

    E-P11 Multiple Malformation/Anomalies Syndromes

    E-P11.001 16p13.11 microduplication in a patient with seizures: A case report about an elusive syndrome

    M. S. Yildirim, A. B. Arslan, A. G. Zamani

    Necmettin Erbakan University, Konya, Turkey

    Background: The short arm of chromosome 16, (16p) and especially the 16p13.11 region is involved in many structural variants. To date, deletions of this region is mostly considered as pathogenic; yet duplications are still controversial. Here a patient with 16p13.11 duplication that have findings concordant with previous reports and two additional findings is presented, aiming to further enhance our understanding of the nature of 16p rearrangements.

    Materials and methods: After the DNA was isolated from the peripheral blood sample of the patient, the data obtained by microarray using the “afyymetrix cytoscan optima array kit” were analyzed for gain or loss according to the GRCh37 (hg19) reference genome using ChAS 3.1.1.27 (Chromosome Analysis Suite) software.

    Case Report: Patient is a 5 years and 2 months old female, admitted to pediatric neurology department with the complaints of seizures and speech delay. She was diagnosed with epilepsy and atypic autism. A peripheral blood karyotyping was normal (46,XX). Microarray result of the patient revealed a 1833 kbp-long microduplication, involving the 16p13.11 region. (arr[hg19] 16p13.11 (14,897,804-16,730,375)x3)

    Discussion: 16p13.11 duplications were previously described as rare benign variants whereas there are also some reports of pathogenicity; relating it to a phenotypic spectrum involving autism, intellectual disability, hypotonia, motor and speech delay, seizures, abnormal MRI and cardiac malformations and this spectrum applies for our patient as well. Additionally, upslanting palpebral fissures and preauricular skin tag are important phenotypic findings of our patient that were not reported before.

    M.S. Yildirim: None. A.B. Arslan: None. A.G. Zamani: None.

    E-P11.004 Phenotypic features in a patient with 1p36 deletion syndrome

    F. Stipoljev1,2, A. Vicic1,3, R. Gjergja-Juraski4,2

    1Clinical Hospital “Sveti Duh”, Zagreb, Croatia, 2Faculty of Medicine, Josip Juraj Strossmayer University of Osijek, Osijek, Croatia, 3Univesity of Applied Health Sciences, Zagreb, Croatia, 4Children’s Hospital Srebrnjak, Zagreb, Croatia

    Monosomy 1p36 is characterized by variable size deletions, while the phenotypic features include intellectual disability, developmental delay, distinctive facial dysmorphic features, hypotonia, seizures, cardiac defects, hearing impairment and ophthalmologic problems. Herein we present a patient with 1p36 deletion syndrome. The girl was born with muscular VSD and the Pierre Robin sequence. She was operated due to the Pierre Robin at the early age and got tracheal canulla up to 3 years of age. MRI of the neuroaxis later revealed the syrinx of the spine. She has distinctive facial features including microbrachycephaly, deep-set eyes with straight eyebrows; midface hypoplasia with broad, flat nose and philtrum. Ears are low-set, rotated backwards and abnormally shaped. Compared to other described cases, her chin is rather small. There are no abnormalities of gastrointestinal system, kidneys, or genitalia. She is hypotonic, with severe intellectual disability, refractory epilepsy and temper tantrums; having vision, hearing and speech problems. Array CGH analysis using SurePrint G3 Human CGH 8x60K microarray revealed 4.3 Mb loss in the region 1p36.33-p36.32. Deletion was confirmed with FISH analysis using subtelomeric 1p probe, and a karyotype was designated as 46,XX,del(1)(p36.32)dn. Cytogenetic analysis of parental peripheral blood revealed normal female karyotype in mother and a 46,XY,inv(10)(p11.2q21.2) karyotype in father, while FISH analysis showed normal distribution of signals characteristic for subtelomeres 1p in both parents. In conclusion, our case emphasizes the significance of molecular cytogenetic analysis in order of establishing accurate diagnosis and patient management, as well as counseling parents regarding future pregnancies.

    F. Stipoljev: None. A. Vicic: None. R. Gjergja-Juraski: None.

    E-P11.005 Identification of clinical features to predict 22q11.2 deletion syndrome, proven by multiplex ligation-dependent probe amplification

    K. Rojnueangnit1, T. Khetkham1, P. Onsod2, T. Chareonsirisuthigul2

    1Thammasat University, Klong-Luang, Thailand, 2Mahidol University, Bangkok, Thailand

    Introduction: 22q11.2 deletion syndrome (22q11.2 DS) is the most common microdeletion syndrome with a wide variety of clinical features. However, there are no clinical criteria for diagnosis; confirmation is solely by genetic tests. Normally, these tests are only performed if clinicians recognize signs and symptoms; therefore, we aimed to identify any clinical features that may help clinicians be aware of 22q11.2 DS.

    Materials and methods: Participants with at least two anomalies were enrolled from June 2015 - May 2018 at Thammasat University Hospital. Complete patient history and physical examinations were done; multiplex ligation-dependent probe amplification analysis for 22q11.2 were performed with blood samples.

    Results: Out of 48 participants, we identified 11 (23%) with 22q11.2 DS. Palate anomalies, hypocalcemia, and ≥ 3 affected body systems were highly significant presentations in the 22q11.2 DS group versus the group without deletion (p <0.05). Conotruncal cardiac defects alone were insufficient for 22q11.2 DS prediction but sufficient when accompanied with other anomalies.

    Conclusion: A comprehensive physical examination is crucial at identifying any subtle features which may lead to testing and a definite diagnosis. Grant from Thammasat University (Grant No.2/32/2558)

    K. Rojnueangnit: None. T. Khetkham: None. P. Onsod: None. T. Chareonsirisuthigul: None.

    E-P11.006 Diverse phenotypes in a family of six all with 22q11.2 duplication or double duplication

    A. Zagorac1, A. Golub1, B. Zagradišnik1, A. Erjavec Škerget1, D. Krgović1, Š. Stangler Herodež1, A. Osterc Koprivšek1, N. Kokalj Vokač1,2

    1University Medical Centre Maribor, Maribor, Slovenia, 2Medical Faculty Maribor, University Maribor, Maribor, Slovenia

    Introduction: 22q11.2 duplications may be largely undetected, as a result of less-distinct, unpredictable, and/or milder phenotype. Double duplications 22q11.2 are extremely rare. We describe the family of six, all with 22q11.2 duplication or double duplication. The boy proband with duplication had a global developmental delay, seizures and dysmorphic features. The girl proband with double duplication, had sensorineural hearing loss, mild intellectual disabilities, mild speech delay and minor dismorphic features. Other relatives were unaffected, except for very mild possible manifestations in the mother.

    Materials and methods: aCGH analysis using 8x60K array, microsatellite segregation analysis and QF-PCR for the informative marker on peripheral blood for all family, were performed. Clinical exsom analysis by NGS of the affected boy and the girl, were done.

    Results: aCGH revealed 3 copies, approximately 2,8Mb, of 22q11.2 in both parents, affected boy and one unaffected girl and 4 copies of the same region in one affected girl and another unaffected girl. Segregation microsatellite analysis and QF-PCR confirmed that both parents carry the duplication (2:1), two children inherited duplication from their mother, another two daughters inherited two copies of 22q11.2 (2:2) from each parent, it’s a double duplication. NGS analysis didn’t identify any additional mutations that would be clinically characterized as being pathogenic.

    Conclusions: The family described illustrates the phenotypic variability associated with 22q11.2 duplication or double duplication. It provides support for the view that the 22q11.2 duplication/double duplication may not be pathogenic on its own and require additional genetic, epigenetic or nongenetic factors, to express the phenotype.

    A. Zagorac: None. A. Golub: None. B. Zagradišnik: None. A. Erjavec Škerget: None. D. Krgović: None. Š. Stangler Herodež: None. A. Osterc Koprivšek: None. N. Kokalj Vokač: None.

    E-P11.007 A homozygous WDR91 nonsense variant responsible of severe form of 3C syndrome

    N. BOURGON1,2, M. LEFEBVRE1,2, A. BRUEL1,2, J. THEVENON1,2, J. RIVIERE1,2, C. POE1,2, M. CHEVARIN1,2, T. JOUAN1,2, Y. DUFFOUR1,2, L. FAIVRE1,2,3,4, C. THAUVIN1,2,3,4

    1UMR 1231, GAD team, DIJON, France, 2FHU TRANSLAD, Dijon, France, 3Centre de Génétique, CHU Dijon Bourgogne, Dijon, France, 4Centre de référence Anomalies du Développement, Dijon, France

    Introduction: 3C syndrome is a rare genetic syndrome characterized by craniofacial anomalies, cardiac and cerebral related to WSHC5 (MIM # 220210) and CCDC22 (MIM # 300963) variants. Molecular bases of some cases suspected of 3C syndrome remained identified.

    Patients and methods: We report 4 fetuses with 3C syndrome from a unique consanguineous family. Case 1 had a fetal hydrops with hygroma coli, cerebellar hypoplasia, severe tetraventricular hydrocephalus with macrocephaly, facial dysmorphia and interventricular septal defect. The 3 other cases have been suspected with fetal hydrops during the first trimester associated with brain abnormalities.

    Results: ES performed in case 1 identified a homozygous WDR91 nonsense variant (NM_014149.3:c.240C>G, p.Tyr80*) in a homozygous region. Family segregation confirmed the homozygous status of this variant in all affected fetuses and in the heterozygous status in both parents, as well as two healthy children and absence in the third healthy child. International datasharing and targeted sequencing of a cohort of 3C syndrome patients have so far failed to identify other patients with WDR91 variants. WDR91 interacts with WDR81 in the endosome-lysosome pathway for early-to-late endosome conversion. WDR91 appears to be essential, particularly for neuronal and brain development.

    Conclusion: Identification of a homozygous WDR91 nonsense variant in several fetuses with 3C syndrome in a consanguineous family suggests that WDR91 is a new gene responsible for this syndrome. Identification of new similar cases thanks to international datasharing would allow us to conclude on the implication of this gene in a severe form of 3C syndrome.

    N. Bourgon: None. M. Lefebvre: None. A. Bruel: None. J. Thevenon: None. J. Riviere: None. C. Poe: None. M. Chevarin: None. T. Jouan: None. Y. Duffour: None. L. Faivre: None. C. Thauvin: None.

    E-P11.008 Allan Herndon Dudley syndrome due to a novel pathogenic variant in the SLC16A2 gene

    T. N. Delchev, H. M. Kathom, D. M. Avdjieva-Tzavella

    Medical University-Sofia, Sofia, Bulgaria

    Introduction: Allan-Herndon-Dudley syndrome (AHDS) is a rare, X-linked condition caused by various pathogenic variants in the SLC16A2 gene. In hemizygous males AHDS is characterized by dysthyroidism, hypotonia and feeding difficulties (in infancy), developmental delay and drug-resistant seizures. Additional findings may include pyramidal and extrapyramidal signs as well as intellectual disability. Heterozygous females are rarely affected.

    Materials and methods: We present a 9 month old boy with facial dysmorphism, psychomotor delay and myoclonus in addition to hypomyelination findings on brain MRI. Dysthyroidism (elevated T3, low T4, fT4 levels and normal TSH) alongside poor weight gain, irritability and axial hypotonia were also found. Based on those findings a targeted SLC16A2 gene sequencing was performed.

    Results: A novel hemizygous variant, c.695del (p.Asn232Metfs*35), was identified in SLC16A2 confirming the diagnosis - Allan-Herndon-Dudley syndrome (MedGen UID: 208645). This variant is neither present in population databases (ExAC no frequency) nor reported in the literature in individuals with SLC16A2-related conditions. This sequence change creates a premature translational stop signal and has been classified as pathogenic.

    Conclusions: Allan-Herndon-Dudley syndrome, however rare, should be considered in children manifesting the typical clinical, phenotypic, laboratory and imaging findings. In our case we found a specific constellation of developmental delay and dysthyroidism which lead to targeted sequencing analysis and the correct diagnosis. We hope that this novel pathogenic variant in SLC16A2 will provide additional information about AHDS and its genotype-phenotype correlations.

    T.N. Delchev: None. H.M. Kathom: None. D.M. Avdjieva-Tzavella: None.

    E-P11.009 Clinical characterization of Aicardi-Goutières Syndrome 7 in an extreme preterm infant, due to a recurrent IFIH1 variant

    E. Phillips, M. Kerr, A. Khan

    Departments of Medical Genetics and Pediatrics, University of Calgary Cumming School of Medicine, Alberta Children’s Hospital Research Institute., Calgary, AB, Canada

    Introduction: Aicardi-Goutières Syndrome (AGS) is a genetically heterogeneous disorder of interferon 1 upregulation. Approximately 10% of patients present at birth with a congenital infection-like syndrome with hepatosplenomegaly, thrombocytopenia, neurologic abnormalities and brain calcifications. Characterization of this disorder in premature infants is limited, and diagnosis in this group is challenging. We present a case of AGS type 7 in an extreme preterm infant, and highlight the role of whole exome sequencing (WES) in providing a timely diagnosis.

    Materials and methods: A female infant was delivered at 27+2 for pre-eclampsia, IUGR, and abnormal Dopplers. From birth, she had refractory thrombocytopenia necessitating almost-daily transfusions, as well as anemia, progressive hepatosplenomegaly, cholestasis, pulmonary hypertension, respiratory insufficiency, poor feeding, and punctate brain calcifications. Screening for TORCH infections and autoimmune thrombocytopenia was negative. She was treated twice for presumed culture-negative sepsis, with minimal clinical improvement. In the face of worsening multi-organ dysfunction, palliative measures were instituted and she died at 54 days.

    Results: Singleton WES identified a likely pathogenic variant in IFIH1: c.2159G>A, p.(Arg720Gln). This missense variant has been reported twice in ClinVar, and published in 6 individuals with variable AGS. Pathogenic variants in IFIH1 cause autosomal dominant AGS7, and account for 3-5% of cases.

    Conclusion: AGS7 presents with a variable phenotype, including a neonatal-onset form. Phenotypic overlap with common disorders of prematurity complicates diagnosis in critically ill, extreme preterm infants. Rapid WES in such cases can provide a timely diagnosis, and inform counselling on prognosis, recurrence, and end-of-life decision making. Grant: MITO-FIND, funding from MITOCANADA

    E. Phillips: None. M. Kerr: None. A. Khan: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; MITO-FIND. F. Consultant/Advisory Board; Modest; MITOCANADA.

    E-P11.010 The third family with TAF6-related phenotype: Alazami-Yuan syndrome

    E. Tuc1, F. B. Bengur1, A. Aykut2, O. Sahin2, Y. Alanay3

    1Acibadem Mehmet Ali Aydinlar University School of Medicine, Istanbul, Turkey, 2Marmara University School of Medicine, Department of Ophthalmology, Istanbul, Turkey, 3Acibadem Mehmet Ali Aydinlar University School of Medicine, Department of Pediatrics, Pediatric Genetics Unit, Istanbul, Turkey

    Introduction: Homozygous variants in TAF6 gene cause an autosomal recessive intellectual disability syndrome with Cornelia de Lange syndrome (CdLS)-like features, namely Alazami-Yuan Syndrome (ALYUS;MIM#617126). We report the sixth patient from a third family with additional ocular and behavioral features.

    Clinical Report: The proband was evaluated after family members with congenital nystagmus were referred. He is an 18-years-old male with moderate intellectual disability, mild dysmorphic features and stereotypic behaviors. His movements stop when verbally distracted and he responds with single words. Bilateral nystagmus was noticed in childhood. Flash electroretinogram recordings of cone and rod function were normal. Ophthalmological evaluation of other family members with congenital nystagmus demonstrated decreased visual acuity and impaired cone and rod function.

    Results: Whole exome sequencing (WES) in family members revealed two different causative genetic conditions. Homozygous missense pathogenic variant, c.323T>C;p.(Ile108Thr) in TAF6 (NM_001190415.1) and heterozygous missense variant of uncertain significance, c.1708G>A;p.(Val570Met) in PDE6C (NM_006204.3) were identified in the proband. His sister and her son were both homozygous for the variant in PDE6C gene.

    Conclusion: The proband shares the same homozygous missense variant, c.212T>C;p.(Ile71Thr) in TAF6, previously reported in a Saudi family by Alazami et al. Three siblings from the same Saudi family and a Turkish patient were simultaneously published by Yuan et al. Comparison of WES data from the proband and the published Saudi family revealed a shared haplotype of 3Mb in the region including TAF6 gene. This finding supports pathogenicity of this homozygous variant and suggests an ancient founder effect.

    E. Tuc: None. F.B. Bengur: None. A. Aykut: None. O. Sahin: None. Y. Alanay: None.

    E-P11.014 The First Case Report Coexistence of Asymmetric Crying Face, Congenital Ptosis And Isotretinoin Embryopathy

    M. Seven1, A. Kalayci Yigin1, M. T. Alay1, S. Sozer Tokdemir2

    1Department of Medical Genetics, Cerrahpasa Medical Faculty, Istanbul University-Cerrahpasa, Istanbul, Turkey, 2Department of Genetics, Aziz Sancar Research Institute of Experimental Medicine, Istanbul, Turkey

    Introduction: Isotretinoin is categorized as X group of drug by Food and Drug Administration (FDA). Teratogenic effects are well defined and mainly includes: craniofacial abnormalities, cardiovascular, central nerve system, thymic/parathyroid anomalies and ear abnormalities [1]. Asymmetric crying face (ACF) is very rare finding of 0.2-0.6% and mimics the sign of peripheral facial paralyses. Generally, associated with left-sided predominance.

    Clinical Findings and method: 28-day baby referred to our clinic for dysmorphological examination. Her mother was followed-up in our teratology clinic for isotretinoin usage during the pregnancy. On baby’s physical examination; congenital ptosis in the right eye, ACF, nevus flammeus in the glabella, cleft in the right earlobe, retro-micrognathia, bilateral sandal gap, radial deviation in wrist and metatarsus adductus were detected. The right lower lip of the patient was observed to be moving down, when crying. ACF was identified. In order to exclude facial nerve paralysis, electromyelography (EMG) was performed. His karyotype was normal.

    Conclusion: In the literature, there is only one case report about isotretinoin embryopathy with ACF which was not confirmed by EMG. Congenital ptosis is a common sign and maybe associated with many abnormalities, however, to the best of our knowledge coexistence of congenital ptosis and ACF with isotretinoin embryopathy is the first reported case in here.

    M. Seven: None. A. Kalayci Yigin: None. M.T. Alay: None. S. Sozer Tokdemir: None.

    E-P11.015 Au-Kline syndrome due to a de novo missense variant in HNRNPK

    C. Fauth1, U. Albrecht2, E. Maurer1, J. Zschocke1

    1Institute of Human Genetics, Medical University Innsbruck, Innsbruck, Austria, 2Department of Pediatrics I, Medical University Innsbruck, Innsbruck, Austria

    Introduction: Haploinsufficiency of HNRNPK, which encodes the heterogeneous nuclear ribonucleoprotein K, has recently been identified as cause of Au-Kline syndrome (MIM #616580). Major findings include muscular hypotonia, developmental delay, intellectual disability, cardiac, urogenital and skeletal abnormalities, and a characteristic facial gestalt. With one exception, all patients with Au-Kline syndrome published so far have loss-of-function mutations. There is only a single patient with a de novo missense variant (p.L155P) which is located in KH2, the second of three K-homology RNA-binding (KH) domains of HNRNPK which ensure sequence-specific RNA and DNA binding. Due to the limited number of patients, the phenotypic consequences of missense variants in HNRNPK remain to be defined.

    Methods and results: We report a second patient with a de novo missense variant in HNRNPK and typical features of Au-Kline syndrome. The 10 year-old girl has severe global developmental delay, muscular hypotonia, cleft palate, a branchial cyst, hydronephrosis, vertebral segmentation anomalies and facial dysmorphism. Based on the clinical phenotype Au-Kline syndrome was suspected and confirmed by Sanger sequencing which revealed a de novo missense variant c.146C>T, p.L49P in HNRNPK [NM_0021404]. This variant affects a moderately conserved amino acid, locates to KH1, the first K-homology RNA-binding domain of HNRNPK, is not listed in GnomAD and is predicted to be pathogenic by in silico tools. Together with the typical clinical phenotype this strongly suggests that the variant is disease-causing.

    Conclusion: Our observation confirms that HNRNPK missense variants affecting KH domains can lead to the characteristic clinical phenotype of Au-Kline syndrome.

    C. Fauth: None. U. Albrecht: None. E. Maurer: None. J. Zschocke: None.

    E-P11.016 Clinical and molecular characterization of a rare case diagnosed with Bardet Biedl Syndrome

    I. O. Focsa1, M. Budisteanu2,3,4, C. Burloiu2, L. C. Bohiltea1, M. Balgradean5,6

    1"C.Davila" University of Medicine and Pharmacy, Bucharest, Bucharest, Romania, 2Prof. Dr. Alex. Obregia Clinical Hospital of Psychiatry, Bucharest, Romania, 3Victor Babes National Institute of Pathology, Bucharest, Romania, 4Titu Maiorescu University, Bucharest, Romania, 5Marie Curie Children’s Clinical Hospital, Bucharest, Romania, 6Carol Davila University of Medicine and Pharmacy, Bucharest, Romania

    Bardet Biedl syndrome (BBS) is a rare, pleiotropic ciliopathy caused by mutations in 21 genes. BBS 12 gene mutations are responsible for 5-6% from molecular diagnosed cases. Clinical spectrum is highly variable in- and between families. The main features are: rod cone dystrophy, polydactyly, obesity, cognitive impairment, renal anomalies and urogenital malformations. We report on a new case of BBS caused by BBS12 mutation. The 7 years old girl is the first child, born at 42 weeks from healthy, unrelated, gypsy parents. Physical parameters at birth were normal. Post axial polydactyly in all four members, brachydactyly and 2-3 fingers syndactyly, were noted. Last physical exam reveals macrocephaly (OFC >2SD), obesity (weight >6SD), dysmorphyc features, rod cone dystrophy, genital malformations, severe intellectual disability, and behavior abnormalities (self aggressive behavior, hyperkinesia, food intake abnormalities). Over the last year, renal dysfunction and hypertension have occurred. Clinical diagnosis was established due to presence of more than four primary features included in consensus criteria. Molecular genetic tests confirmed the diagnosis, identifying an homozygous nonsense mutation in BBS12 gene (c.1063C>T; p.Arg355*). The mutation was reported first in 2007 in two French gypsy families. Later, other two patients were reported. Our patient brings new evidence in the phenotype caused by this rare mutation. Further studies are needed for a better understanding of genotype-phenotype relation. Albeit there is a little experience in predicting the phenotype severity taking into account the mutational load, an early clinical and molecular diagnosis may be helpful for a good management of these patients.

    I.O. Focsa: None. M. Budisteanu: None. C. Burloiu: None. L.C. Bohiltea: None. M. Balgradean: None.

    E-P11.017 Improving the phenotype description of Basel-Vanagaite-Smirin-Yosef syndrome, MED25-related: the relevance of neuroimaging findings.

    I. Maini1, E. Errichiello2, S. Caraffi1, S. Rosato1, V. Bizzarri1, M. Pollazzon1, G. Trimarchi1, G. Contrò1, C. Gelmini1, M. Napoli3, R. Pascarella3, S. Rizzi4, C. Fusco5, O. Zuffardi6, L. Garavelli1

    1Medical Genetics Unit, Department of Maternal and Child Health Department, AUSL-IRCCS of Reggio Emilia, Reggio Emilia, Italy, 2Unit of Medical Genetics, Department of Molecular Medicine, University of Pavia,, Pavia, Italy, 3Neuroradiology Unit, AUSL-IRCCS of Reggio Emilia, Reggio Emilia, Italy, 45. Child Neuropsychiatry Unit, AUSL-IRCCS of Reggio Emilia, Reggio Emilia, Italy, 5Child Neuropsychiatry Unit, AUSL-IRCCS of Reggio Emilia, Reggio Emilia, Italy, 6Unit of Medical Genetics, Department of Molecular Medicine, University of Pavia, Pavia, Italy

    Introduction: Basel-Vanagaite-Smirin-Yosef syndrome (BVSYS) is an extremely rare autosomal recessive genetic disorder characterized by severe developmental delay and variable congenital anomalies, caused by variants in the MED25 gene. Since 2015, 17 patients have been described with common clinical features and homozygous variants in the MED25 gene, leading to a better definition of the phenotype associated with BVSYS.

    Materials and methods: Here we report two young sisters, of consanguineous parents, presenting typical dysmorphic features and neuroimaging findings of BVSYS, plus polymicrogyria.

    Patient 1 showed features of BVSYS at physical examination (strabismus, large and overhanging nasal tip, short philtrum, down-turned corners of the mouth, micrognathia, bilateral 2nd-3rd toe syndactyly Y-shaped) and a delayed psychomotor development. Brain MRI showed bilateral perisilvian polymicrogyria, thin corpus callosum, temporal and parietal atrophy, cyst of the cavum septum pellucidum and cavum vergae, enlargement of the third and lateral ventricles.

    Patient 2 (patient 1’s sister) show similar clinical features at physical examination and brain MRI; she died at 1 year of age and authoptic investigations were not performed. Results (patient 1): Karyotype and array-CGH were normal; WES identified an homozygous frameshift variant c.1778_1779delAG in MED25. The variant leads to stop coding formation and results in a loss of function protein.

    Conclusions: Our cases showed among neuroimaging findings also perisilvian polymicrogyria. which has never been described before in BVSYS. We suggest including it among the possible cerebral anomalies of BVSYS and emphasize the importance of a detailed clinical and neuroradiological evaluation of these patients.

    I. Maini: None. E. Errichiello: None. S. Caraffi: None. S. Rosato: None. V. Bizzarri: None. M. Pollazzon: None. G. Trimarchi: None. G. Contrò: None. C. Gelmini: None. M. Napoli: None. R. Pascarella: None. S. Rizzi: None. C. Fusco: None. O. Zuffardi: None. L. Garavelli: None.

    E-P11.018 Concurrent hypomethylation in both IC loci found in a Beckwith-Wiedemann syndrome case

    V. Anastasiadou1, I. Kyprianou2, A. Miltiadous2, P. Gerasimou2, J. Chi3,2, I. Savvidou1, P. Costeas2,3

    1Department of Clinical Genetics, Archbishop Makarios III Medical Centre, Nicosia, Cyprus, 2Molecular Hematology-oncology, Karaiskakio Foundation, Nicosia, Cyprus, 3The Center for the Study of Haematological Malignancies, Nicosia, Cyprus

    Introduction: Beckwith-Wiedemann syndrome (BWS) is a clinically heterogeneous overgrowth syndrome associated with an increased risk of embryonal tumour development. BWS incidence ranges from 1 in 10,000-15,000 newborns with 85% of the cases sporadic. Genetic or epigenetic alteration within two domains of imprinted growth regulatory genes on chromosome 11p15, IC1 (H19DMR) or IC2 (KvDMR), lead to deregulation and BWS phenotype. Other known causes of BWS are uniparental disomy (UPD), trisomy 11p15, mutations in the CDKN1C gene, as well as small deletions and translocations.

    Materials and methods: We describe a 2-year-old girl, referred because of global developmental delay. On examination we noted macrosomia, midface and scalp hemangiomas and a protruding tongue. She suffers of choking episodes. Speech is limited. She is the first child and a product of sperm donation. Macrosomia was noted on prenatal ultrasound. Neonatal hypoglycemia was not reported. MS-MLPA analysis (MRC Holland) was performed to look for epimutations in the imprinted 11p15 region associated with BWS (IC2 loss of methylation or IC1 gain of methylation). The results were confirmed with a second sample from the proband.

    Results: Concurrent hypomethylation on both imprinting loci, IC1 and IC2, was observed on chromosome 11p15. No copy number chromosomal abnormalities were detected.

    Conclusions: We discuss the clinical and molecular findings of this case because of the rarity of simultaneous loss of methylation pattern in both IC1 and IC2 loci. Relevant literature is currently limited.

    V. Anastasiadou: None. I. Kyprianou: None. A. Miltiadous: None. P. Gerasimou: None. J. Chi: None. I. Savvidou: None. P. Costeas: None.

    E-P11.020 New heterozygous pathogenic variant in ABCC9 gene identified in two patients diagnosed with Cantu syndrome

    K. Wojciechowska1, A. Tarkowska2, M. Kacprzak3, D. Loska3, A. Pietrzyk4, M. Babicz5, M. Holweg5, A. Mroczkowska5, P. Skowera5, B. Styka5, D. Winnicka5, M. Lejman5, J. Kowalczyk1

    1Department of Pediatric Hematology, Oncology and Transplantology, Children’s University Hospital, Lublin, Poland, 2Department of Neonate and Infant Pathology, Children’s University Hospital, Lublin, Poland, 3MedGen Medical Centre,, Warsaw, Poland, 4Department of Clinical Genetics and Patomorphology, University of Zielona Gora, Zielona Gora, Poland, 5Laboratory of Genetic Diagnostic, Children’s University Hospital, Lublin, Poland

    Introduction: Cantu syndrome is characterized by congenital hypertrichosis, characteristic craniofacial dysmorphic features, cardiomegaly and osteochondrodysplasia. It is caused by mutations in ABCC9 or KCNJ8 genes. We would like to report two new cases of Cantu syndrome: 33-year-old patient and her 3-month-old daughter. Mother during adolescence was diagnosed with hypogonadotropic hypogonadism. She had distinctive facial features, hypertrichosis on the face and polycystic ovaries. Neither signs of cardiomegaly nor osteochondrodysplasia were observed. Her daughter had similar coarse facial features, generalized hypertrichosis and enlarged tongue. She was born on time with normal length and weight parameters. After genetic consultation Whole Exome Sequencing was performed.

    Materials and methods: The sequencing of isolated, enriched genomic DNA was performed on NovaSeq 6000. Raw sequences in fastq format were mapped to hs37d5 reference. The following in silico prediction software programs were used to assist with interpretation of pathogenicity of detected variant: SIFT, MutationTaster, PolyPhen-2 as embedded in Alamut visual v 2.9.0. The presence of the variant in control populations was checked in 1000Genomes, the ExomeVariantServer, and the Exome Aggregation Consortium and gnomAD. Sanger sequencing was also performed.

    Results: A new missense variant Arg1116Pro was found in one allele of ABCC9 gene. Considering the symptoms and the detected variant patients were diagnosed with Cantu syndrome.

    Conclusion: We would like to present two patients- mother and her daughter with some distinctive clinical features for Cantu syndrome and new pathogenic variant in ABCC9 gene. Our report is a valuable contribution in expanding molecular and clinical spectrum of Cantu syndrome.

    K. Wojciechowska: None. A. Tarkowska: None. M. Kacprzak: None. D. Loska: None. A. Pietrzyk: None. M. Babicz: None. M. Holweg: None. A. Mroczkowska: None. P. Skowera: None. B. Styka: None. D. Winnicka: None. M. Lejman: None. J. Kowalczyk: None.

    E-P11.022 Further delineation of putative CDK10 loss-of-function variants: a new form of ciliopathy phenotype

    G. Forzano1, R. Artuso2, E. Andreucci2, V. Palazzo2, A. Pagliazzi1, F. Vanderwert1, G. Gori1, F. Di Giovanni1, E. Fiorentini1, S. Giglio3

    1Medical Genetics Unit, University of Florence, Florence, Italy, 2Medical Genetics Unit, Meyer Children’s University Hospital, Florence, Italy, 3Medical Genetics Unit, University of Florence, Meyer Children’s University Hospital, Florence, Italy

    CDK10 encodes a protein kinase which interacts with cyclin to form a heterodimeric protein kinase that plays a central role in the regulation of cellular growth, ciliogenesis and primary cilium elongation. Bi-allelic loss-of-function CDK10 mutations have been recently reported associated with a distinct disorder, named Al-Kaissi syndrome, described so far in only 10 patients from 6 distinct families. We report the case of a 5-year-old boy with a complex phenotype: growth retardation, global developmental delay with absent speech, thin corpus callosum and paucity of white matter visible at the brain MRI, vertebral anomalies and a typical facial appearance (triangular face, bilateral epicanthic folds, hypertelorism, depressed nasal bridge, low-set and posteriorly rotated ears, small chin); besides these features, our patient was born with ostium secundum atrial septal defect and pulmonary valve stenosis. Array-CGH and CHD7 molecular analysis were normal. Trio whole exome sequencing (WES) disclosed a homozygous splice site variant in the CDK10 gene. Our patient’s phenotype resembles the clinical features described in patients affected by Al Kaissi syndrome, except for the congenital heart defect (CHD): none of the patients with the same mutation as our case were reported to have any heart anomalies; to date, only one patient with Al-Kaissi syndrome showed patent ductus arteriosus. The WES analysis excluded further variants of the genes described in association with heart malformations and therefore our case is likely to allow us to expand the clinical phenotype of a syndrome which is not yet fully characterised.

    G. Forzano: None. R. Artuso: None. E. Andreucci: None. V. Palazzo: None. A. Pagliazzi: None. F. Vanderwert: None. G. Gori: None. F. Di Giovanni: None. E. Fiorentini: None. S. Giglio: None.

    E-P11.024 A nonsense mutation in the first exon of CHD8 causes a multi-organ disease phenotype: Is it a novel syndrome or a detection of an additional gene resulting in CHARGE syndrome

    T. Atik, S. Simsir, E. Isik, F. Ozkinay

    Ege University Faculty of Medicine, Department of Pediatrics, Izmir, Turkey

    Developments in the genomic era and large-scale exome/genome sequencing studies have identified mutations in several members of the CHD (Chromodomain Helicase DNA-binding protein) gene family in neurodevelopmental disorders. Especially the group III CHD family consisting of CHD6, CHD7, CHD8 and CHD9 has well-documented roles in transcription regulation, impacting in organogenesis. These four enzymes are similar in their constituent domains. While mutations in the CHD2 and CHD8 have been linked to autism and intellectual disability. Additionally, CHD7 has been found to be associated with CHARGE syndrome which is a well-known congenital malformation syndrome. Here in this report, we present a case having intellectual dysability, autism and several congenital anomalies and a de-novo nonsense mutation in CHD8 gene as a possible cause of the clinical phenotype. A 5,5 year-old boy with macrocephaly, autism, intellectual disability and congenital anomalies including severe hypospadias, ventricular septal defect, inguinal hernia, cryptorchidism, anal atresia and hemivertebrae(T12) was referred to our department. He has also been treating for hypothyroidism. Trio whole exome sequencing(WES) was performed, and a de-novo heterozygous nonsense c.727C>T(p.Arg243*) mutation in the first exon of CHD8 was detected and it was found to be likely pathogenic according to ACMG 2015 criteria. We consider that the mutation found in the patient could be responsible for a congenital malformation syndrome similar to CHARGE syndrome, causing a disruption in CHD7-CHD8 complex. Further functional analysis is planned. As a conclusion, mutations in CHD8 gene, especially disrupting CHD7-CHD8 complex, could be responsible for a congenital malformation syndrome similar to CHARGE.

    T. Atik: None. S. Simsir: None. E. Isik: None. F. Ozkinay: None.

    E-P11.025 Chromoanasynthesis with involvement of chromosome 21: rare cause for dysmorphic features and developmental disorder

    J. Lisfeld1, M. Pettersson2, S. Rudolph3, S. Fuchs1, J. Eisfeldt2, M. Hempel1, A. Lindstrand2

    1Institute of Human Genetics, University Medical Center Hamburg-Eppendorf, Hamburg, Germany, 2Department of Molecular Medicine and Surgery, Karolinska Institutet and Department of Clinical Genetics, Karolinska University Hospital, Stockholm, Sweden, 3Gemeinschaftspraxis für Humangenetik und Genetische Labore, Hamburg, Germany

    Background: Although various complex chromosomal rearrangements have been described, the underlying pathomechanisms are still not fully understood. One of the models discussed is chromoanasynthesis, a replication-based process that forms complex rearrangements during numerous cycles of fork stalling and template switching (FoSTeS) and microhomology-mediated break-induced replication (MMBIR). A commonly acknowledged mechanism for catalyzing these events is DNA polymerase slippage, which could lead to both inter- and intrachromosomal rearrangements.

    Case report: We report on a 22-year-old man with moderate global developmental delay, short stature, microcephaly, severe hearing impairment and dysmorphic features resembling patients with Down syndrome. Brain MRI and echocardiography results were normal.

    Methods and results: Chromosome analysis revealed a derivative chromosome 21. CGH array analysis could delineate one duplication on 21p and five duplications on 21q. Follow-up analysis using short-read paired-end whole-genome sequencing (WGS) revealed a complex rearrangement consisting of a total of seven duplications on chromosome 21. Four out of the total seven breakpoint junctions could be delineated on the nucleotide level and provided evidence of DNA polymerase slippage and errors during DNA replication as the underlying mechanism of formation. Chromosome analyses and WGS data for both parents were unremarkable, thereby indicating a de novo rearrangement.

    Discussion: The patient described here is affected by a complex chromosomal rearrangement consisting of multiple partial duplications within chromosome 21. Duplications were mostly rearranged and one was inverted.

    J. Lisfeld: None. M. Pettersson: None. S. Rudolph: None. S. Fuchs: None. J. Eisfeldt: None. M. Hempel: None. A. Lindstrand: None.

    E-P11.026 Clinical results of chromosome 15 copy number variations

    H. Gurkan1, E. Atlı1, S. Yalcıntepe1, E. &. Atlı1, S. Demir1, Y. Özen1, H. Tozkır2

    1Trakya University, Medical Faculty, Department of Medical Genetics, Edirne, Turkey, 2Tekirdag, Namık Kemal University, Medical Faculty, Department of Medical Genetics, Tekirdag, Turkey

    Chromosome 15 spans more than 102 million DNA base pairs and represents more than 3 percent of the total DNA in cells. Chromosome 15 likely contains 600 to 700 genes that provide instructions for making proteins. These proteins perform a variety of different roles in the body. Changes in the number or structure of chromosome 15 can cause intellectual disability, delayed growth and development, hypotonia, and characteristic facial features. These changes include an extra copy of part of chromosome 15 in each cell, a missing segment of the chromosome in each cell, and a circular structure called ring chromosome 15. Sixteen patients who have a CNV on 15th chromosome as a result of the arrayCGH analysis made using 180K CGH + SNP oligoarray after they had been directed to Trakya University Hospital, Genetic Diseases Diagnosis Center between 2016-2019, were included in our study. The indications of the patients were intellectual disability, hypotonia, microcephaly, developmental delay, increased nuchal translucency, intrauterine growth retardation etc. Nine patients had 15q partial deletion and 7 patients had 15q partial duplication. As a result of the segregation analysis, 3 patients were diagnosed with Angelman Syndrome, one patient was diagnosed with Ring15. It was determined that 4 patients (del. in 2 patients, dup. in 2 patients) with CNV on chromosome 15q had inherited the CNV from a parent. As a result of segregation analysis, the diagnoses of the 8 patients, 4 having a deletion and the other 4 having a duplication, will be confirmed.

    H. Gurkan: None. E. Atlı: None. S. Yalcıntepe: None. E.&. Atlı: None. S. Demir: None. Y. Özen: None. H. Tozkır: None.

    E-P11.027 Distal 18q deletion syndrome in girl

    O. Gumeniuk, Y. Chernenkov, S. Sanaeva, P. Golobokova, T. Ilysova

    Saratov State Medical University, Saratov, Russian Federation

    Distal 18q deletion syndrome is a rare hereditary with piece distal section of the long (q) arm of chromosome 18 is missing. Syndrome can lead to a wide variety of signs and symptoms. Purpose. To study the features distal 18q deletion syndrome in girl. Patient and methods. 14-year-old girl with physical and sexual delayed development, language delay, learning difficulties, muscle weakness, deformation of the foot, frequent non-diabetic ketoacidosis. Physical and instrumental examination, conventional chromosomal analysis was carried out. Results. Girl was born full term with normal birth weight, following a pathological pregnancy. Tetralogy of Fallot was diagnosed in neonatal period. Family History: congenital cataract in the mother and in the grandfather on the mother’s side. She attends a special needs school and has poor school performance, with difficulty in attention, concentration, comprehension and obeying orders. She had delayed physical and sexual development, microcephaly, poor subcutaneous fat, asymmetric wide chest, long arms, short shoulders, gait disturbance, deformity of the foot on the right (Friedreich foot) and specific facial dysmorphies: wide nose bridge, hypertelorism, epicantum, thin upper lip, "carp mouth". Her IQ (intelligence quotient) was 53, and he showed mild mental retardation. Laboratory examination: increased level of TSH, a decrease in T4 (primary congenital hypothyroidism, late form). Abdominal ultrasound: echo-signs gallbladder agenesis characteristic. Conventional chromosomal analysis on 30 metaphases from peripheral blood lymphocyte cultures showed two cell lines: 46, XX, del(18)(q21q21). Conclusions. The clinical features of the case were frequent non-diabetic ketoacidosis, gallbladder agenesis, severe heart disease and late genetic diagnosis.

    O. Gumeniuk: None. Y. Chernenkov: None. S. Sanaeva: None. P. Golobokova: None. T. Ilysova: None.

    E-P11.028 A complex duplication/triplication of 20q

    M. Souto1, P. Botelho1, M. Martins2, O. Moutinho3, R. Pinto Leite1

    1Laboratório de Genética, Centro Hospitalar Trás-os-Montes e Alto Douro, Vila Real, Portugal, 2Consulta de Genética, Centro Hospitalar Trás-os-Montes e Alto Douro, Vila Real, Portugal, 3Serviço de Ginecologia e Obstetrícia, Centro Hospitalar Trás-os-Montes e Alto Douro, Vila Real, Portugal

    Introdution: Partial duplication of the long arm (q) of chromosome 20 occur very rarely. The phenotype usually consists of brachycephaly, epicanthus, anteverted nostrils, short neck, vertical chin dimple, and congenital heart defect or murmur. Some cases have development growth, speech, motor, and social interactions delay. The authors present a case of partial trisomy 20q.

    Clinical Report: 8-year-old girl with short stature, minor dysmorphic features and global developmental delay. Blood culture and cytogenetic analysis were performed according standards protocols. Cytogenetics analysis revealed a chromosome marker in all metaphases analyzed. Parents karyotype were normal. Fluorescence in situ hybridization (FISH) technique identified the extra material as chromosome 20. Array Comparative Genomic Hybridization (aCGH) technique revealed a gain in the 20q13.33 region: three copies of 400Kbp (without genes), four copies of 406Kbp (involving CDH4 gene), three copies of 543Kbp (containing three genes: CDH4, MIR125, TAF4) and four copies of 2.304Mbp, comprising TAF4 and 86 more genes.

    Discussion: In the present case conventional and molecular cytogenetics detected a marker chromosome derived from chromosome 20. The array clarified the amount and the segment involved. The extra chromosome comprised a complex duplication/triplication in the 20q13.3 region. The girl has some dysmorphic features and global developmental delay consistent with 20q duplication syndrome. Nevertheless, to our knowledge this is the first case involving only this region. Every new case of a rare chromosomal alteration should be reported in order to obtain a more precise genotype/ phenotype correlation, improving risk evaluation and genetic counselling.

    M. Souto: None. P. Botelho: None. M. Martins: None. O. Moutinho: None. R. Pinto Leite: None.

    E-P11.030 A Rare Case Report: Cloves Syndrome

    M. T. Alay1, A. Kalayci Yigin1, B. Uyanik2, M. Seven1

    1Department of Medical Genetics, Cerrahpasa Medical Faculty, Istanbul University-Cerrahpasa, Istanbul, Turkey, 2Department of Medical Genetics, University of Health Sciences, Bakirkoy Dr. Sadi Konuk Training and Research Hospital, Istanbul, Turkey

    Introduction: Clove(s) syndrome (CS) is one of the rare syndromes characterized with congenital adipose tissue excessive size, vascular malformation, epidermal nevus and scoliosis/ spinal malformation. Although the etiology of the disease is not fully understood, it usually occurs as a result of post-zygotic mutations that function in the PIK3CA gene. CS syndrome can affect soft tissue, blood vessels, bone, and internal organs. Its symptoms vary widely between mild and severe anomalies.

    Clinical Findings: A 3-year-old girl was referred to our outpatient clinic with a preliminary diagnosis of vascular malformation. In her physical examination, there was progressive growth in the abdomen, pigmented skin lesions in the left half of the body from birth, and capillary malformation (nevus flammeus) in the right lower limb and perivulvar region. Scoliosis, left hemihypertrophy, sandal gap and macrodactyly were detected in the toes.

    Results: In the Clinical Exom DNA sequence analysis from the blood sample taken from the patient, a Heterozygous c.436G˃A p.(Val146Ile) mutation was detected and confirmed by Sanger sequence. The PIK3CA gene is named as an oncogene encoding 23 exons, located on the PI3K/AKT signal pathway.

    Conclusion: As a result of changes in the PIK3CA gene, congenital lipamatosis has been reported to cause anomalies and syndromes such as overgrowth, vascular malformations, epidermal nevus. Applying the diagnostic criteria of Keppler- Noreuil et al., our case was found to be compatible with the diagnosis of CS. CS is the first case reported in our country supported by molecular analysis.

    Keywords: Cloves Syndrome, PIK3CA gene, Clinical Exome.

    M.T. Alay: None. A. Kalayci Yigin: None. B. Uyanik: None. M. Seven: None.

    E-P11.031 Cockayne Syndrome: a previous described heterozygous variant in homozygosity

    M. Marques1, P. M. Almeida1,2, S. M. Ribeiro1, F. Ramos1, L. Ramos1,2

    1Hospital Pediátrico, Centro Hospitalar e Universitário de Coimbra, Coimbra, Portugal, 2Faculty of Health Sciences, University of Beira Interior, Covilhã, Portugal

    Cockayne syndrome (CS), is a rare autosomal recessive multisystem disorder, mainly characterised by postnatal growth failure, progressive neurological dysfunction, microcephaly, impaired vision and hearing, skeletal abnormalities and premature ageing. CS is caused by mutations in ERCC6 and in ERCC8 gene. Studies performed thus far have failed to delineate clear genotype-phenotype relationships.

    We present a one-year-old girl, from consanguineous parents, referred due to congenital cataracts, microcephaly, short stature and arthrogryposis. She had a history of reduced fetal movements, intrauterine growth restriction and hydramnios. At 6 months of life she had microcephaly (-3,0SD), growth failure and severe developmental delay. Brain MRI showed diffuse hypomyelination of the cerebral white matter, hypoplastic corpus callosum and small lens. We performed a broad gene panel analysis that identified a probably pathogenic missense variant [c.611C>T (p.Thr204Lys)] in homozygous form, on ERCC8 gene. Parental study confirmed that they are heterozygous for this variant.

    CS belongs to the family of NER (nucleotide excision repair)-related disorders existing a large variation in severity. Our patient has CS type 2, which is a neonatal severe form, typically lethal in the first decade of life. Our patient has a homozygous probably pathogenic missense variant in the ERCC8 gene that was already described in a compound heterozygous state (c.611C>A; c.1122+1delG) who has CS type I, without congenital cataracts, small lens, severe arthrogryposis and intrauterine growth restriction. The homozygous state in our patient can be the cause of the severe phenotype that was not described before.

    M. Marques: None. P.M. Almeida: None. S.M. Ribeiro: None. F. Ramos: None. L. Ramos: None.

    E-P11.032 Two Twin Sister With Cohen Syndrome And Hirsutism: A Case Report

    F. Ozdemir1, A. Kalayci Yigin1, Z. Ocak2, M. Seven1

    1Department of Medical Genetics, Cerrahpasa Medical Faculty, Istanbul University-Cerrahpasa, Istanbul, Turkey, 2Department of Medical Genetics, Medical Faculty, University of Istinye, Istanbul, Turkey

    Introduction: Cohen syndrome is a genetic disease characterized by a rare neurodevelopmental delay, microcephaly and hypotonia. While phenotypic findings may differ among patients, it may appear normal in the neonatal period, as facial features are not evident. The first clinical signs include nutritional difficulties, hypotonia, microcephaly, neuromotor developmental retardation and joint hypermobility. Due to neutropenia, upper respiratory infections and oral aphthae could be observed. The disease has an autosomal recessive inheritance pattern and is caused by mutations in the VPS13B gene.

    Clinical Findings and Method: In this study, we present two twin sister cases with hirsutism findings and neuromotor developmental retardation, microcephaly, mega sisterna magna in cranial MR and prominent antihelix, low hairline, camptodactyly and dysmorphic findings such as narrow forehead. DNA were isolated from peripheral blood samples taken from two siblings. The mutation was detected as a result of clinical exom analysis and confirmed by Sanger sequence. The results were evaluated with American College of Medical Genetics (ACMG) criterias and compared with genetic databases.

    Result: As a result of the analysis, c.412+1G> T pathogenic variant was detected homozygous in the VPS13B gene in both sisters. Conclusion: This mutation supports Cohen’s syndrome with clinical findings.

    Keywords: Cohen Syndrome, Hirsutism, Clinical Exome Sequencing.

    F. Ozdemir: None. A. Kalayci Yigin: None. Z. Ocak: None. M. Seven: None.

    E-P11.036 A large homozygous deletion in two sibs suffering from multiple congenital disorders

    S. Seyedhassani1, M. Ebrahimi1, M. Tavakoli1, L. Najafi2, M. Neshan1,3

    1Dr. Seyedhassani medical genetic center, Yazd, Iran, Islamic Republic of, 2Islamic azad university, Tehran, Iran, Islamic Republic of, 3National institute for genetic engineering and biotechnology, Tehran, Iran, Islamic Republic of

    One family was referred to genetic counseling center because of multiple disabilities. They had three involved children resulting from consanguineous marriage with inbreeding coefficient about 6.25%. A 10 months boy and a 8 years old girl suffering from delayed development, high crying, irritability, decreased head circumference, visual and hearing impairment and finally quadriplegic mental retardation. Another girl was dead in 11 years old with similar manifestations. This family had three normal children and was pregnant too.

    Chromosomal study and CGH array were normal. Whole Exome Sequencing were used to enrich all exons of protein-coding genes as well as some important other genomic regions. Next generation sequencing was performed to sequence close to 100 million reads on Illumina Sequencer. In this test, point mutations and micro-insertion/deletions and duplication (<20bp) can be simultaneously detected. A large homozygous deletion around following region was predicted: chr11:653904-710516, about 56600 bp, including genes: TMEM80, EPS8L2, DEAF1. DEAF1 gene acts as a regulator of transcription. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with cognitive disability. EPS8L2 is a Protein Coding gene. Diseases associated with EPS8L2 include Deafness. TMEM80 is target gene of DEAF1 and decreased mRNA levels were observed for Tmem80 throughout the brain of DEAF1 knockout mice. Clinical manifestations were seen in involved sibs appeared as a result of dysfunction of deleted genes individually and interaction with other related genes. Prenatal diagnosis was done and fetus born in normal condition.

    S. Seyedhassani: None. M. Ebrahimi: None. M. Tavakoli: None. L. Najafi: None. M. Neshan: None.

    E-P11.037 Recessive inheritance of DISP1 variants in holoprosencephaly spectrum patients

    A. Lavillaureix1,2, C. Dubourg3,2, C. Quelin1, B. Keren4, S. Whalen5, Y. Hendriks6, J. Bos6, V. David3,2, V. Dupe2, S. Odent1,2

    1Service de génétique clinique, Centre de Référence Maladies Rares, CLAD-Ouest, Centre Hospitalier Universitaire de Rennes, ERN-ITHACA, Rennes, France, 2Rennes University, Institute of Genetics and Development of Rennes (IGDR) UMR6290 CNRS, Rennes, France, 3Service de Génétique Moléculaire et Génomique, Centre Hospitalier Universitaire de Rennes, Rennes, France, 4APHP, GH Pitié Salpêtrière, Department of Genetics, Unit of Development Genomics, Paris, France, Paris, France, 5Unité Fonctionnelle de génétique clinique, Hôpital Armand Trousseau, Assistance publique-Hôpitaux de Paris, Centre de Référence Maladies Rares des anomalies du développement et syndromes malformatifs, Paris, France, 6Department of Clinical Genetics, Amsterdam UMC - Locatie VUMC, Amsterdam, Netherlands

    Holoprosencephaly (HPE; MIM# 236100) is the most frequent congenital brain malformation (1 in 10,000 live births, 1 in 250 conceptuses). It results from incomplete midline division of the prosencephalon between 18th and 28th day of gestation, affecting both the forebrain and the face. The clinical spectrum is very wide, ranging from severe HPE with a single cerebral ventricle and cyclopia to clinically unaffected carriers in familial HPE. The full spectrum of HPE includes also microforms characterized by midline defects, with cleft lip/palate, hypotelorism, coloboma and/or single maxillary median incisor (SMMI). HPE is phenotypically and genetically heterogenous and was previously considered as a dominant disease with variable expression and incomplete penetrance. From the use of High Throughput Sequencing Technologies, it emerges that the penetrance and the phenotypic variability have digenic or oligogenic origin. To date, at least 18 genes are implicated in HPE and are all associated with key pathways of forebrain development including sonic hedgehog (SHH) pathway. Interestingly, among these genes, DISP1 appears to have a specific mode of inheritance. DISP1 is a positive factor necessary for efficient secretion of the SHH morphogen and thus the establishment of its concentration gradient along the midline of the neural tube. We describe the clinical characteristics of three families with severe HPE or microform associated to compound heterozygous variants in DISP1. We will review the literature and discuss the genotype-phenotype correlations.

    A. Lavillaureix: None. C. Dubourg: None. C. Quelin: None. B. Keren: None. S. Whalen: None. Y. Hendriks: None. J. Bos: None. V. David: None. V. Dupe: None. S. Odent: None.

    E-P11.038 Detection of the pathogenic CNVs in the Macedonian patient with profound developmental delay

    V. Anastasovska1, E. Sukarova-Angelovska1, D. Nestoroska1, N. Zdraveska2, G. Ilieva1, M. Pesevska1

    1Genetic Laboratory, Skopje, Macedonia, The Former Yugoslav Republic of, 2Department of Neonatology, Skopje, Macedonia, The Former Yugoslav Republic of

    Introduction: The array Comparative Genomic Hybridization (aCGH) is now recognised as a first tier diagnostic test for patients with wideranging phenotypes and has led to greater sensitivity in the detection of sub-microscopic genomic changes and pathogenic copy number variants (CNVs).

    Materials and methods: aCGH was performed in the Macedonian patient with clinical signs of dysmorphia and developmental delay using the Affymetrix® CytoScanTM 750K Array (Applied Biosystems), that comprises 550 k non-polymorphic and 200 k SNP markers. The data was analysed using Chromosome Analysis Suite (ChAS) Software (v4.0).

    Results: We describe a 2.5-year-old girl with dysmorphia and developmental delay. She has midfacial hypoplasia, facial asymmetry, prominent cheeks, deep set eyes, narrow rima oculi, short bulbous nose, simple and lop ears, round face and brachydactyly. Congenital hypothyroidism was detected at newborn screening, therefore she was on continuous l-thyroxine therapy. At the age of 2 weeks the baby developed hemolytic crises, followed by apnoic episodes. Developmental delay was noticed at 6 months of age, both for global and fine motor skills. She started to walk at 2 years of age, and no speech development so far. Her height and weight are below 3 percentile. Karyotype was 46,XX, del18p- (11.1-pter). aCGH analysis was showed pathogenic 3 copies of the chromosomes 6q13q14.1 (4.081 kb) and 19p13.3 (650 kb) and one copy of chromosome 18p11.32p11.21 (14.919 kb), according to aDGV and ClinVar databases.

    Conclusions: The array CGH analysis has become a widely accepted tool that supplements conventional karyotyping in patients with an unexplained phenotype.

    V. Anastasovska: None. E. Sukarova-Angelovska: None. D. Nestoroska: None. N. Zdraveska: None. G. Ilieva: None. M. Pesevska: None.

    E-P11.039 EBF3-related neurodevelopmental disorder - case report of female with phenotypic expansion and review of the literature

    C. A. Chang1, W. Al-Hertani2, M. Innes1

    1Alberta Children’s Hospital, Calgary, AB, Canada, 2Boston Children’s Hospital, Boston, MA, United States

    EBF3-related disorders were first described in 2017 (Sleven et al, Harms et al, Chao et al, Tanaka et al, Blackburn et al). Commonly reported features include global delays, mild-severe intellectual disability, ataxia, hypotonia, and mild facial dysmorphisms. Additional findings include high pain tolerance, febrile seizures, brain malformations, strabismus, feeding difficulties, scoliosis, genitourinary anomalies, short stature, perseverative social behaviours and motor stereotypies.

    Herein, we report on a 19-year old female patient with a de novo likely pathogenic heterozygous variant in EBF3, c.487C>T, p.(Arg163Trp). Our patient shows many symptoms of EBF3-related disorders, including cognitive delay, mental health concerns, hypotonia, strabismus, autonomic dysfunction, poor feeding, complex renal anomaly, neurogenic bladder, febrile seizures, unstable gait, and an unusual coronal pattern of sulcation in the cerebellar tonsils. Additionally, she had two unexplained episodes of significant elevation in AST and ALT (4000-6000 U/L), not previously reported.

    Our report provides further expansion of the phenotypic spectrum of EBF3- related disorders. Long term outcomes are not well described; our patient represents the third oldest individual in the literature. The elevated liver transaminases remain unexplained and could be related to her EBF3-related disorder, but the possible underlying mechanism is unknown. EBF3 encodes a member of the early B-cell factor transcription factor family. Haploinsufficiency has been proposed as a mechanism of EBF3-related disease (Lopes et al. 2017). This report contributes to the understanding of the long-term outcomes and health surveillance for affected individuals, and further supports the finding of multiple pleiotropic effects seen in EBF3-related disorders.

    C.A. Chang: None. W. Al-Hertani: None. M. Innes: None.

    E-P11.040 Expansion of phenotypic spectrum of EP300 mutations

    R. Kosaki1, K. Kosaki2

    1Division of Medical Genetics, National Center for Child Health and Development Hospital, Setagaya, Tokyo, Japan, 2Center for Medical Genetics, Keio University School of Medicine, Tokyo, Japan

    Rubinstein-Taybi syndrome (RSTS) is a congenital malformation syndrome characterized by typical facial appearance, broad thumbs and halluces, and intellectual disability. Heterozygous mutations in CREBBP (50-60%) or EP300 (8-10%) have been detected. Recently, a heterogeneous group of patients with CREBBP or EP300 mutations who have clinical features atypical for RSTS have been reported though exome analysis. We here report four unrelated patients with EP300 mutations to expand phenotypic spectrum. [Methods] Informed consent from the parents and approval from the local institutional review board were obtained. Medical exome analysis was performed. [Results] All the four patients had heterozygous mutation of EP300. Patient 1) 5-month-old male with some of RSTS including intellectual disability(ID), broad thumbs, and ventricular septal defect. Nonsense mutation p.Gln965* was detected. Patient 2) 2-year-old female with atypical features of RSTS including ID and normal thumbs. Missense mutation p.Val1656Ala was detected. Patient 3) 11-month-old female with double outlet right ventricle, myelomenigocele, hydrocephalus, imperforate anus, coloboma, and hearing impairment. Dual mutations were detected: EP300 frameshift mutation p.Gln2048Thrfs*24 and SOS1 Thr778Pro mutation. Patient 4) 6-year-old female with PDA, PS, coloboma, and hearing impairment.: EP300 frameshift mutation p.Gln2048Thrfs*24 was detected.[Discussion] We demonstrated the clinical variability of patients with EP300 mutations. The combination of coloboma and imperforate anus has been reported in a patient with a frameshift mutation (p.H815Tfs*128) in EP300 (Masuda et al. 2015). Recurrence of such a specific combination of defects suggests causal relationship. Phenotypic spectrum of EP300 mutations may be much broader than has been previously appreciated.

    R. Kosaki: None. K. Kosaki: None.

    E-P11.042 Deletion 2p24 and Feingold Syndrome Type 1

    C. Schell-Apacik1, S. Rauschke2, A. Weber2, M. Blankenburg2, L. Mulahasanovic3, H. Gabriel3, S. Biskup3, M. Stumm2

    1Medicover Human Genetics Berlin-Westend MVZ, Berlin, Germany, 2Medicover Genetics GmbH, Berlin, Germany, 3Praxis für Humangenetik Tuebingen, Tuebingen, Germany

    Introduction: Feingold Syndrome Type 1 (FS1 - OMIM #164280) is a very rare syndromic microcephaly entity for which MYCN is the major disease-causing gene. The incidence of FS1 is currently unknown. About 10% of FS1 patients have deletions encompassing all or part of the MYCN gene. We report an additional FS1 case, carrying a 4.9 Mb de novo microdeletion of the chromosomal region 2p24.

    Clinical data: The boy is the only child of unrelated parents. He was born in the 32th (31+5) gestational week by Caesarean after preeclampsia. At the age of two days, a duodenal stenosis was treated surgically. Ultrasound revealed an agenesis of the left kidney, and a pancreas anulare. At the age of 9 months, he presented with microbrachycephaly, triangular facies, iris coloboma on both eyes, low-set ears, and partial cutaneous syndactyly of the 4th and 5the toes on the left foot, consistent with previous reports of patients with FS1.

    Methods: Conventional chromosomal analysis (CA), array-CGH, quantitative PCR (qPCR) and Whole Trio Exome Sequencing (Trio-WES) were performed.

    Results: GTG karyotyping showed a normal male result. Array CGH detected a 4.9 Mb microdeletion of chromosome region 2p24.3 to 2p24.1, resulting in haploinsufficiency of MYCN. qPCR segregation analyses of the index patient and his parents demonstrated a de novo deletion. No pathogenic variants beside the 2p24 microdeletion were revealed by Trio-WES of the patient and his parents.

    Conclusion: Our results confirm that FS1 can be caused by microdeletions of the chromosomal region 2q24 as single abnormality.

    C. Schell-Apacik: None. S. Rauschke: None. A. Weber: None. M. Blankenburg: None. L. Mulahasanovic: None. H. Gabriel: None. S. Biskup: None. M. Stumm: None.

    E-P11.044 Ocular phenotype inpatients withGNB5variantsandimpact of variants onGbeta5 expressionand function

    Z. Shao1,2, A. Tumber3, J. Maynes4, E. Tavares3, S. Hewson2, A. Schulze2, P. Kannu2, A. Vincent3

    1Post-Graduate Medical Education, University of Toronto, Toronto, ON, Canada, 2Division of Clinical and Metabolic Genetics, Hospital for Sick Children, Toronto, ON, Canada, 3Department of Ophthalmology and Vision Sciences, Hospital for Sick Children, Toronto, ON, Canada, 4Division of Molecular Medicine, The Hospital for Sick Children Faculty of Medicine, University of Toronto, Toronto, ON, Canada

    Biallelic mutations in G protein subunit beta 5 (GNB5) gene were first reported to cause a multi-system disorder with cardinal characteristics that include global developmental delay, seizures, generalized hypotonia, early-onset sinus node dysfunction and eye disease. We have previously reported the unique electroretinal signal of a 3-year-old female with a homozygous null variant in GNB5 (GNB5-L; NM_016194.3:c.1032C>A/p.Y344* and GNB5-S; NM_006578.3:c.906C>A/ p.Y302*) representing dual retinal signalling defects that constitutes features of bradyopsia and rod ON-bipolar dysfunction. Subsequently, another female patient was identified with a homozygous missense variant in GNB5 (NM_016194.3:c.920T>G/p.L370R) through whole exome sequencing (WES). Furthermore, this patient also has a homozygous missense variant in MCCC1 (c.1394C>T p.T465I) that represents 3-methylcrotonyl-CoA carboxylase deficiency. The 3-MCC deficiency was confirmed enzymatically. Another heterozygous Hemoglobin E variant of codon 26 (GAG>AAG) [HBB c.79G>A] that represents HbE trait was also identified, consistent with patient’s clinical presentation of splenomegaly. We therefore conducted a deep phenotypic analysis to segregate the contribution of each genetic variant with a focus on her ocular phenotype which involves high myopia. We also set out to study the impact of the GNB5 variants on gene expression, translation and protein-protein interaction using primary fibroblast culture from the patient. With increased use of WES in genetic diagnosis, more patients are found to have multiple molecular variants in syndromes with overlapping phenotypes. This study highlights the importance of detailed phenotyping and need of functional assays to aid variant classification. This work is supported by the Rare Disease Foundation and the BC Children’s Hospital Foundation Microgrant.

    Z. Shao: None. A. Tumber: None. J. Maynes: None. E. Tavares: None. S. Hewson: None. A. Schulze: None. P. Kannu: None. A. Vincent: None.

    E-P11.045 Mutations in SALL1, TCL1 and TCL1B genes in patients with Goldenhar syndrome

    B. A. Marszalek-Kruk

    Department of Genetics, Wroclaw University of Environmental and Life Sciences, Wroclaw, Poland

    Introduction: Goldenhar syndrome (GHS) is a rare inherited syndrome. The incidence of this disease is between 1:5600 to 1:25000. Syndrome is a multiple congenital disorder characterized by malformed ears, micrognathia, oral cavity malformations and dermal cysts. Due to malformation patients usually have problem with airway.

    Materials and methods: DNA was isolated from peripheral blood leukocytes from the patients. Exons of genes SALL1 TCL1 and TCL1B were amplified by polymerase chain reaction (PCR) under optimal conditions, using specific primers. The PCR products were subjected to RFLP analysis and were purified on the DNA Gel Out columns followed by direct sequencing method.

    Results: During examination were detected 3 substitutions. The c.3720G>A mutation in exon 3 of the gene SALL1 which is a silent mutation (A1240A). Another of the described mutation is c.166G>A in exon 2 of TCL1 causing the conversion of V56I and c.277G>A in exon 2 of TCL1B causing G93R. Additionally 4 polymorphisms were identified in introns: deletions c.76+36delAC in intron 1 SALL1 gene, c.120+42G>T in intron 1 of TCL1 and c.298_34C>T in intron 2 of TCL1 gene and substitution of c.393+36T>A in intron 3 of TCL1B gene.

    Conclusions: Molecular evaluation is of extreme importance for families with a history of GHS. Diagnosis, early detection of the syndrome and good management make possible of normal life of the patient.

    B.A. Marszalek-Kruk: None.

    E-P11.046 45,X/46,XY gonosomal mosaicism as an unexpected finding in a patient with lymphoproliferative disease

    J. Stellmachova1, V. Curtisova1, P. Rohon2, R. Vrtel1, P. Vrtel1, K. Adamova1, D. Vrbicka1, M. Prochazka1, M. Palova3

    1Department of Medical Genetics University Hospital and Palacky University, Olomouc, Czech Republic, 2Palacky University, Olomouc, Czech Republic, 3Department of Hematooncology University Hospital and Palacky University, Olomouc, Czech Republic

    Introduction: We present a case of delayed diagnosis of a mixed gonadal dysgenesis in a 53 old woman.

    Case presentation: The patient had short stature (150cm), obesity, coarse facial features, mild male pattern hair loss, primary amenorrhea and borderline intellect. Her short stature and primary amenorrhea were never investigated. She was ascertained following a diagnosis of follicular lymphoma during a preventive mammography. Cytogenetic examination of the bone marrow detected complex changes including 46,XY clones prompting a request for genetic examination with following results: Karyotype from peripheral blood:45,X [12]/46,XY[38] (24% monosomy X), FISH native peripheral blood: ish (DXZ1x1)[40]/(DXZ1x DYZ3x1)[160] (20% monosomy X), FISH buccal smear: ish (DXZ1x1)[68]/(DXZ1x DYZ3x1)[132] (34% monosomy X). Her gonads were removed, and presence of both 45,X and 46,XY clones was detected by FISH. Patients with "45,X/46,XY mixed gonadal dysgenesis" syndrome can present with small stature have an increased risk of gonadoblastoma and congenital abnormalities of heart and kidneys (similar like Turner syndrome).

    Conclusion: Early diagnosis of gonosomal mosaicism 45,X/46,XY enables multidisciplinary cooperation and treatment. Although the Czech Republic has a very good and longstanding tradition of primary care which enables the diagnosis in most cases to be reached by puberty there are still some adult patients who remain undiagnosed. This case highlights the usefulness of karyotype examination in women with unexplained primary amenorrhea and/or short stature.

    Supported by MH CZ - DRO (FNOl, 00098892)

    J. Stellmachova: None. V. Curtisova: None. P. Rohon: None. R. Vrtel: None. P. Vrtel: None. K. Adamova: None. D. Vrbicka: None. M. Prochazka: None. M. Palova: None.

    E-P11.048 HDAC2 as a potential ‘second hit’ to KIAA0586. Novel ‘two hit hypothesis’ vs Digenic inheritance (DI) ?

    S. Kupchik1, S. Lau1, O. Beckett1, K. McWalter2, E. Normand3, Y. Kogelman1, P. Campeau4

    1Maimonides Medical Center, Brooklyn, NY, United States, 2Gene Dx, Gaithersburg, MD, United States, 3Gene Dx, Gaithesburg, MD, United States, 4University of Montreal, Montreal, QC, Canada

    An 11 year old female with short stature, repaired open neural tube defect (NTD) and post axial polydactyly (PAP) was found on trio exome sequencing to have two frameshift variants, a paternally inherited pathogenic AR variant in KIAA0586: c.428delG:p.Arg143LysfsX4 and a de novo variant of unknown significance in HDAC2: c.1359_1362delAACA: p.Thr454ArgfsX51.KIAA0586 encodes a conserved centrosomal protein essential for ciliogenesis. Bi-allelic pathogenic variants in KIAA0586 result in a spectrum of autosomal recessive (AR) ciliopathy disorders ranging from short rib thoracic dysplasia with polydactyly-14 to Joubert syndrome. HDAC2, not currently known causative of disease, is a mammalian zinc finger transcription factor histone deacetylase 2 protein that acts both as positive and negative regulator of transcription. HDAC2 found expressed in mouse brain may play a role in normal proliferation and differentiation of neural precursor cells. There are reports of a de novo HDAC2 missense variant in an individual with a Cornelia de Langue syndrome like phenotype, NTD and PAP who also exhibited a 15q11.2-q11.3 duplication and in an individual with intellectual disability (ID). We hypothesize our patient’s phenotypic manifestations could be explained by either digenic inheritance (DI) or by a novel ‘two hit hypothesis’ in which a single AR pathogenic allele reaches threshold of clinical expression due to presence of an additional de novo variant in a significant regulatory transcript namely HDAC2. If confirmed, it could have significant genetic counseling and genetic mechanisms of disease causation implications. A collaboration is under way to characterize phenotypic and biochemical consequences of HDAC2 mutations.

    S. Kupchik: None. S. Lau: None. O. Beckett: None. K. McWalter: A. Employment (full or part-time); Significant; Gene Dx. E. Normand: A. Employment (full or part-time); Significant; GeneDx. Y. Kogelman: None. P. Campeau: None.

    E-P11.049 New case of Bardet Bield Syndrome caused by novel biallelic mutations in IFT172 gene

    M. Sánchez Soler1, M. Ballesta-Martínez2, A. Serrano-Antón1, V. López-González2, L. Rodríguez-Peña1, E. Guillén-Navarro2

    1Medical Genetic Sección, H. Clinic Universitary V. Arrixaca, IMIB-Arrixaca, El Palmar, Spain, 2Medical Genetic Sección, H. Clinic Universitary V. Arrixaca, IMIB-Arrixaca. CIBERER, El Palmar, Spain

    Introduction: IFT172 is part of the intraflagellar transport (IFT), a bidirectional mechanism allowing the protein motility within the cilia and biallelic mutations in this gene have been described in patients with isolated retinosis pigmentosa, short-rib thoracic displasia 10 with or without polydactyly, joubert syndrome, recently with oro-fagio-digital syndrome and only in three cases of Bardet Bield syndrome (BBS).

    Material and methods: Description of a new case of BBS caused by two novel mutations in IFT172 gene. Results5 years-old boy, first child of healthy non consanguineous parents. He had retinosis pigmentosa, myopia, language delay, obesity (weight p>99 + 4.8SD), OFC p>99 (2.7SD), generalized brachydactyly, abnormal palmar creases, round face, short palpebral fissures, small teeth and one cafe au lait spot. Cardiac and renal anomalies were ruled out and the hearing was normal. ArrayCGH and molecular study of Prader-Willi were normal. Firstly, commom mutations associated with BBS were studied without positive result. NGS of genes associated with retinosis pigmentosa detected two variants probably damaging in IFT172 gene: c.2635G>A and c.4540-6C>G. The first was present in the mother and the second in the father, supporting their pathogenity.

    Conclusions: We report on a new case of BBS due to biallelic mutations in IFT172 gene supporting its implication in this syndrome. We describe two new mutations in this gene. Achieving molecular diagnosis with NGS permits adequate genetic counseling in families.

    M. Sánchez Soler: None. M. Ballesta-Martínez: None. A. Serrano-Antón: None. V. López-González: None. L. Rodríguez-Peña: None. E. Guillén-Navarro: None.

    E-P11.050 Father-daughter incest: 30-year-old woman with Seckel-like microcephaly and homozygous STIL pathogenic variant

    C. Ding1, J. Spranger2, S. Diederich1, D. Galetzka1, S. Schweiger1, O. Bartsch1

    1Institut Institute of Human Genetics, University Medical Centre of the Johannes Gutenberg University, Mainz, Germany, 2Children’s Hospital, University Medical Centre of the Johannes Gutenberg, Mainz, Germany

    Among children resulting from incestuous matings, mental retardation and congenital malformations are known to be very common (PMID: 6779972, 5127404), but molecular studies to identify the underlying defects in these children are still scarce or lacking (PMID: 26320005, 20509080). We report here a woman resulting from a forced incestuous conception (father-daughter incest). For many years, her diagnosis had been Seckel syndrome due to extreme primary microcephaly (-10 SD), pre- and postnatal growth retardation (-5 SD), prominent nose, and severe developmental retardation. Upon re-examination at age 30 years, she also displayed profound intellectual disability, absent speech, most severe behavioral abnormalities resulting in blindness (due to head banging and eye scratching) as well as tetraplegia. Microarray analysis revealed a highly increased loss of heterozygosity (LOH 25.3%), consistent with incest. Of note, LOH >50% was detected for eight chromosomes. Whole exome sequencing revealed a homozygous variant c.3377A>G p.Tyr1126Cys in the STIL gene.

    Pathogenic STIL variants result in non-syndromic autosomal recessive primary microvephaly type 7 (MCPH7, OMIM #612703). The degree of intellectual disability among reported patients is very variable, ranging from mild to severe, and seems not to be genotype specific. Several features observed in the proband (including stereotypic behavior, tetraplegia, and profound global retardation) are not typical findings in MCPH7, suggesting that additional unrecognized recessive variants could possibly have contributed to the more complex phenotype in the patient, adding to the classic form of MCPH7.

    C. Ding: None. J. Spranger: None. S. Diederich: None. D. Galetzka: None. S. Schweiger: None. O. Bartsch: None.

    E-P11.054 The problem of identifying syndromes with a high degree of genetic heterogeneity and clinical polymorphism

    V. A. Galkina, A. V. Marakhonov, R. A. Zinchenko

    Research Center for Medical Genetics, Moscow, Russian Federation

    Diagnosis and verification of multiple congenital dysmorphism (MCD) syndromes is often difficult due to the variety of clinical forms and inter- and intrafamilial clinical polymorphism. It is known that in sporadic cases, the diagnosis will be most reliable with the full range of phenotypic sings. Differential diagnosis of MCD syndromes can also be difficult due to the similarity of phenotypic features in different syndromic forms. In such cases, the problem of clarifying the diagnosis and resolving the issue of the possibility of conducting a prenatal diagnosis of the disease in the fetus in the family during subsequent pregnancy can be solved by the use of high-throughput DNA sequencing methods. Proband, a boy born in 2013, was first consulted with the aim of diagnosis at the age of 2 years old regarding complaints of short stature, congenital ptosis, nystagmus, severe hypotrichosis, renal hypoplasia, violation of pronation-supination (radio-lunar synostosis?), lobar holoprosencephaly, delayed development. Cartilage-hair hypoplasia and Noonan syndrome were excluded clinically. CMA was negative. The NGS revealed a small deletion in KIAA0556 gene (c.2373delC) in a homo- or hemizygous state. Thus, the diagnosis of Joubert syndrome (JS) type 26 was established. JS is a heterogeneous disease - 36 genetic forms are presented in the OMIM, all with AR type of inheritance which have far from classical phenotypic manifestations of this syndrome. A stricter approach to the description of phenotypes will probably solve the problem of such a high genetic heterogeneity. Supported by RFBR grant 18-015-00090.

    V.A. Galkina: None. A.V. Marakhonov: None. R.A. Zinchenko: None.

    E-P11.055 Co-occurrence of mutations in KIF7 and KIAA0556 in Joubert syndrome with ocular coloboma, pituitary malformation and growth hormone deficiency

    M. Niceta1, M. L. Dentici1, A. Ciolfi1, R. Marini2, S. Barresi1, F. R. Lepri1, A. Novelli1, E. S. Bertini1, M. Cappa2, M. C. Digilio1, B. Dallapiccola1, M. Tartaglia1

    1Genetics and Rare Diseases Research Division, Ospedale Pediatrico Bambino Gesù, Rome, Italy, 2Unit of Endocrinology, Academic Department of Pediatrics, Ospedale Pediatrico Bambino Gesù, Rome, Italy

    Introduction: Joubert syndrome is a recessive neurodevelopmental disorder characterized by clinical and genetic heterogeneity. Clinical hallmarks include hypotonia, ataxia, facial dysmorphism, abnormal eye movement, irregular breathing pattern cognitive impairment and, the molar tooth sign is the pathognomonic midbrain-hindbrain malformation on magnetic resonance imaging. The disorder is predominantly caused by biallelic mutations in more than 30 genes encoding proteins with a pivotal role in morphology and function of the primary cilium. Oligogenic inheritance or occurrence of genetic modifiers has been suggested to contribute to the variability of the clinical phenotype. We report on a family with peculiar clinical spectrum Joubert syndrome molecularly and clinically dissecting a complex phenotype, in which hypogonadism, pituitary malformation and growth hormone deficiency occur as major features.

    Case Description and Methods: A 7 year-old male was enrolled in a dedicated “Undiagnosed Patients Program” for a peculiar form of Joubert syndrome complicated by iris and retinochoroidal coloboma, hypogonadism pituitary malformation, and growth hormone deficiency. The molecular basis of the complex phenotype was investigated by whole exome sequencing.

    Results: The concomitant occurrence of homozygosity for mutations in KIF7 and KIAA0556 was identified, and the assessment of major clinical features associated with mutations in these two genes provided evidence that these two independent events represent the cause underlying the complexity of the present clinical phenotype.

    Conclusion: Beside the clinical variability of Joubert syndrome, co-occurrence of mutations in ciliopathy-associated genes may contribute to increase the clinical complexity of the trait.

    M. Niceta: None. M.L. Dentici: None. A. Ciolfi: None. R. Marini: None. S. Barresi: None. F.R. Lepri: None. A. Novelli: None. E.S. Bertini: None. M. Cappa: None. M.C. Digilio: None. B. Dallapiccola: None. M. Tartaglia: None.

    E-P11.056 Neurodevelopmental disorders and chromatin remodeling dysregulation: the lessons from Kabuki syndrome spectrum and clinical presentation of Tunisian cases

    N. B. ABDELMOULA, B. Abdelmoula, R. Louati, F. Abid, T. Sammouda, W. Smaoui, N. Abdellaoui, K. Trigui, O. Kaabi, W. Ltaif, S. Aloulou, S. Mallek, S. Kammoun, UR17ES36 members

    Medical University, Sfax, Tunisia

    Objective: Kabuki syndrome (KS) [MIM: 147920] is linked to dysregulated lysine degradation and chromatin organization pathways. Here, we report four Tunisian patients, who fulfilled clinical criteria of KS, including neurodevelopmental deficits.

    Clinical Presentation: During our genetic couselling at the medical university of Sfax (Tunisia), we recorded four patients with KS distinct face, neurodevelopmental deficit, congenital heart disease, and skeletal/dental malformations. Our patients have respectively partial atrio-ventricular septal defect, double outlet right ventricle, left ventricular hypertrophy and atrio-ventricular septal defect with atrial isomerism. Neurodevelopmental deficits were constant but variable with respectively developmental delay, behavioural troubles with autistic traits, perceptive sensory deafness, mental retardation and delayed speech with abnormal voice; learning disabilities and behavioural troubles; developmental delay, psycho-motor retardation, delayed speech, and mental retardation; and finally learning disabilities and hypernasal speech.

    Conclusion: KS is a clinically recognizable syndrome and most patients have a pathogenic variant in the KMT2D or KDM6A genes. The five cardinal manifestations of KB defined in 1988 have been revisited recently (2018). The new consensus diagnostic criteria propose that a definitive diagnosis can be made in an individual of any age with a history of infantile hypotonia, developmental delay and/or intellectual disability, and one or both of other major criteria like pathogenic molecular variant. In fact, either with or without molecular genetic confirmation, it seems to be possible to go on toward a correct clinical diagnosis. The phenotypic variability is linked to the nature of the involved protein in the epigenetic machinery (readers, writers, erasers, or chromatin remodelers).

    N.B. Abdelmoula: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. B. Abdelmoula: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. R. Louati: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. F. Abid: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. T. Sammouda: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. W. Smaoui: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. N. Abdellaoui: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. K. Trigui: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. O. Kaabi: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. W. Ltaif: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. S. Aloulou: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. S. Mallek: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36. S. Kammoun: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; Research Unit UR17ES36.

    E-P11.059 Lacrimo-auriculo-dento-digital LADD syndrome: first case report of a Georgian patient

    T. Tkemaladze1,2, E. Abzianidze1, E. Kvaratskhelia1, M. Ghughunishvili2,1, V. Skrahina3, A. Rolfs3

    1Tbilisi State Medical University, Tbilisi, Georgia, 2Givi Zhvania Pediatric Academic Clinic, Tbilisi, Georgia, 3CENTOGENE AG, Rostock, Germany

    Background: Lacrimo-auriculo-dento-digital (LADD) syndrome is extremely rare genetic disorder with only about 100 cases reported worldwide. LADD syndrome occurs due to pathogenic changes FGFR2, FGFR3 or FGF10 genes. Clinical signs and severity may vary, but almost uniformly there is involvement of the lacrimal systems, cup-shaped ears, dental and digital abnormalities.

    Case Report: Here we report of a 9 years old girl with LADD syndrome from Georgia. At birth she presented with malformed left hand, ventricular-septal defect, congenital inguinal hernia and kidney aplasia. Dysmorphic features include lacrimal duct obstruction, low-set and cup-shaped ears, dental aplasia and salivary gland malformation. Her hearing loss started from 2,5 years and is slowly progressive. Interestingly she developed generalized seizures from 2,5 years which is not a common feature of LADD syndrome. Patient was on anti-epileptic treatment for 3 years and is now seizure-free and drug-free for already 4 years.

    Methods: Whole exome sequencing (WES) was performed and c.1547C>T p.(Ala516Val) variant was identified in FGFR2 gene. In silico tools predict the change disrupts normal function of the FGFR2 protein. Additionally, parental testing confirmed de novo status of the variant.

    Discussion: This is the first genetically confirmed case of LADD syndrome in Georgia, presenting with epilepsy as a new feature. Genetic testing lead to more accurate genetic and recurrence risk counseling. Our case expands the phenotypic and mutational spectrum of FGFR2 and confirms application of WES as a first-line diagnostic test in individuals with multiple congenital anomalies. More studies are needed to define whether genotype-phenotype correlations exist.

    T. Tkemaladze: None. E. Abzianidze: None. E. Kvaratskhelia: None. M. Ghughunishvili: None. V. Skrahina: None. A. Rolfs: None.

    E-P11.060 TGM1 mutation spectrum in patients with lamellar ichthyosis

    F. Ozkinay1, H. Onay1, G. OZTURK1, E. ISIK1, D. AYYILDIZ EMECEN1, E. ARSLAN1, F. HAZAN2, T. Atik1

    1Ege University Faculty of Medicine, Izmir, Turkey, 2S.B.U. DR.BEHCET UZ CHILDREN’S EDUCATION AND RESEARCH HOSPITAL, Izmir, Turkey

    Aim: Autosomal recessive congenital ichthyosis (ARCI) is a heterogeneous group of keratinization disorders, caused by mutations in at least 13 different genes. Lamellar icthyosis (LI) which is one of the phenotypic features of ARCI presents with dark brown, plate-like scale with no erythroderma. TGM1 mutations is the most common cause of the classic LI phenotype. In this study, we investigated the clinical and molecular findings of eleven LI patients who had mutations in TGM1 gene.

    Method: Ten patients clinically diagnosed as LI and two consangineous carrier parents (their child with LI had died) having mutations in TGM1 gene were included in the study. All patients (including death child) were examined by an experienced dermatologist and clinical geneticist. Patient histories; including demographic, clinical and laboratory findings, were obtained from hospital records. TGM1 gene analysis was performed using a next generation sequencing platform (Illumina MiSeq).

    Results: Six patients were female, five male. Plate-like scale with no eritroderma, the typical features of LI, was defined in all patients. Eleven different mutations were identified; eight were missense, two frameshift and one nonsense. While ten patients carried the same mutations in both alleles, one was compound heterozygous (c.160C>T; c.1469A>G). Three of the eleven mutations (c.1148T>G, c.889G>A. C.2189delG) in the TGM1 gene had not previously been reported in the literature.

    Conclusion: By defining three novel mutations, this study enriched the molecular spectrum of ichthyosis, and also provided a further insight for genetic counselling.

    F. Ozkinay: None. H. Onay: None. G. Ozturk: None. E. Isik: None. D. Ayyildiz emecen: None. E. Arslan: None. F. Hazan: None. T. Atik: None.

    E-P11.061 The Rare LIG4 Syndrome: A case report

    J. Chi1, P. Gerasimou1, A. Miltiadous1, I. Kyprianou1, L. Koumas1, L. Loizou2, E. Papachristodoulou2, E. Karaoli2, A. Loizou2, P. Costeas1

    1Molecular Hematology-oncology, Karaiskakio Foundation, Nicosia, Cyprus, 2Pediatric Oncology-Hematology, Archbishop Makarios III Hospital, Nicosia, Cyprus

    Introduction: The LIG4 syndrome is a rare hereditary disorder associated with impaired DNA double-strand break repair mechanisms. Patients show unusual facial features, microcephaly, growth and/or developmental delay, various skin abnormalities and pancytopenia, which is associated with combined immunodeficiency.

    Case Description: 12-year old patient with obvious syndromic features with severe microcephaly, very short stature and a very low body weight. Bird-like facial features, resembling Seckel’s syndrome or Fanconi anemia patients. He had no signs of acute illness nor malignancy. The patient is of Syrian descent and is the second child of a six-member family. Parents are first-degree relatives, both reported healthy.

    Methodology: A custom HaloPlexHS (Agilent) NGS panel was used to investigate mutations in genes involved in Bone Marrow Failure/Severe Combined Neutropenia, Anemias and Chromosome Breakage Syndrome. Sanger sequencing performed parental carrier status.

    Interpretation: Two variants in the LIG4 gene were identified, c.2440C>T p.(Arg814Ter) and c.1273_1278delAGAGAA p.(Arg425_Glu426del). LIG4 c.2440C>T is a nonsense heterozygous variant which prematurely terminates the protein and is classified as pathogenic and LIG4 c.1273_1278del is an in-frame deletion classified as likely pathogenic according to ACMG recommendations. Compound heterozygous mutations in the LIG4 gene have been associated to LIG4 syndrome, an autosomal recessive disorder caused by homozygous or compound heterozygous mutations. Parental testing revealed that LIG4 c.2440C>T variant was maternally inherited and the LIG4 c.1273_1278delAGAGAA variant was paternally inherited.

    Conclusion: The patient is compound heterozygous for the pathogenic (c.2440C>T) and likely pathogenic (c.1273_1278del) variants in the LIG4 gene, consistent with LIG4 syndrome diagnosis. Parental testing confirmed compound heterozygosity.

    J. Chi: None. P. Gerasimou: None. A. Miltiadous: None. I. Kyprianou: None. L. Koumas: None. L. Loizou: None. E. Papachristodoulou: None. E. Karaoli: None. A. Loizou: None. P. Costeas: None.

    E-P11.062 A case ofantenatal Bartter’s Syndrome with a novel MAGED2 variant manifesting with severe polyhydramnios and intrauterine fetal death

    M. Nagasaka1,2, S. Nakago1, C. Nagano2, N. Morisada2, K. Nozu2, K. Iijima2

    1Takatsuki General Hospital, Takatsuki, Japan, 2Kobe University Graduate School of Medicine, Kobe, Japan

    Introduction: Polyhydramnios is caused by various factors. Recently, the MAGED2 gene located on the X chromosome has been reported to be responsible for antenatal Bartter syndrome with most severe polyhydramnios.

    Case: The patient was a girl died in utero at 31 weeks of gestation. The mother was a 29-year-old woman (gravida 3, para 2). The first child died in utero at 37 weeks of gestation without polyhydramnios. The second child was normally delivered at 36 weeks of gestation. She presented with severe polyhydramnios during the third pregnancy. Fetal development was good and no cardiac or morphological abnormalities were noted by fetal ultrasound. On fetal MRI at 27 weeks of gestation, no brain malformation or gastrointestinal obstruction was noted, but the bladder was large. She had been treated with amnioreduction six times in total, but the fetus died suddenly in utero at 31 weeks of gestation. The child was a girl weighing 1980 g, and she had no apparent morphological abnormalities.

    Genetic testing: Sequencing of DNA from the frozen umbilical cord of the third child revealed a de novo nonsense MAGED2 variant with heterozygosity. Skewed X-chromosome inactivation was observed via HUMARA assay.

    Conclusion: We believe that our case showed a severe phenotype of antenatal Bartter’s syndrome due to MAGED2 truncating variant and skewed X-chromosome inactivation.

    M. Nagasaka: None. S. Nakago: None. C. Nagano: None. N. Morisada: None. K. Nozu: None. K. Iijima: None.

    E-P11.066 Intra-uterine fetal death in Meier-Gorlin Syndrome due to compound heterozygous variants of ORC6 gene with a novel mutation: a case report

    H. Thorn1, S. Drunat2, C. Fleury3, E. Alanio4, J. Bory5, S. Bonneau5, M. Doco-Fenzy6, M. Blocquaux7, C. Jacquin6, C. Poirsier8, M. Mozelle-Nivoix1

    1Medical Genetic Service, CH Simone VEIL, Troyes, France, 2Laboratory of Molecular genetics, Hôpital Robert Debré, PARIS, France, 3Anatomical Pathology Laboratory, CHU de Reims, Reims, France, 4Anatomical Pathology laboratory, CHU de Reims, Reims, France, 5Obstetrics and Gynaecology Departments, CHU de Reims, Reims, France, 6Medical Genetic Service, CHU de Reims, Reims, France, 7Cytogenetics Laboratory and Laboratory of Molecular Genetics, CHU de Reims, Reims, France, 8Medical Genetic Service, CHU de Reims, Troyes, France

    The Meier-Gorlin Syndrome (MGS) is a rare autosomal recessive disorder with characterized malformatives features. Among mutations of the pre-replication complex (ORC1, ORC4, ORC6, CDT1, CDC6), ORC1 and ORC4 mutations appear to be responsible of the most severe phenotypes. However, ORC6 mutations can lead to a severe abnormal embryological development.

    We present the case of an intrauterine fetal death at 32 weeks during dichorionic diamniotic twin pregnancy. The fetus had a compound heterozygous ORC6 mutation, inherited from both parent.

    At 16 weeks, a severe inadequate intra-uterine growth associated with a genu recurvatum and oligohydramnios were observed for one of the twins (ultrasound identification of the fetal sex: female). There was no family background aside the mother which presented neurofibromatosis type I. The parents were unrelated.

    Fetal karyotype by amniocentesis on the pathological fetus was 46,XY. The genetic exploration was completed by MLPA. No quantitative chromosomal abnormalities were detected.

    After caesarean delivery at 37 weeks, the fetal anatomopathological examination observed a male fetus with major inadequate intra-uterine growth, bilateral microtia, external genital hypoplasia and probable hypospadias, associated with abnormal joint morphology and skeletal malformations evoking a MGS. His twin brother was healthy.

    A panel of genes responsible for primary microcephaly was performed and highlighted 2 ORC6 heterozygous VUS: c.449+5G>A variant, previously described in patients with Meier-Gorlin syndrome, and a new c.360-1G>T variant, never described before and that could also be responsible for Meier-Gorlin syndrome according to splicing prediction software. Study of alternative splicing confirmed the pathogenicity of the two variants.

    H. Thorn: None. S. Drunat: None. C. Fleury: None. E. Alanio: None. J. Bory: None. S. Bonneau: None. M. Doco-Fenzy: None. M. Blocquaux: None. C. Jacquin: None. C. Poirsier: None. M. Mozelle-Nivoix: None.

    E-P11.068 A novel GTPBP2 splicing mutation in two siblings affected with microcephaly, generalized muscular atrophy, and hypotrichosis

    E. Akbariazar, I. Abdi Rad, A. Vahabi

    Urmia University of Medical Sciences, Urmia, Iran, Islamic Republic of

    Background: One of the challenging pitfalls in the genetic counseling of patients with syndromic microcephaly is a definite clinical diagnosis to determine its etiology. Any unknown syndromic microcephaly necessitates piling up of clinical and molecular genetics data in the hope of getting a genotype-phenotype correlation.

    Materials and methods: In this study, we identified a novel splice site mutation in the GTPBP2 gene by Whole Exome Sequencing in two siblings with microcephaly and progressive generalized muscular atrophy associated with hypotrichosis.

    Results: This splice site mutation in the GTPBP2 gene is predicted to disrupt the highly conserved acceptor splice site of exon 4 in the GTPBP2 gene.

    Conclusion: We describe syndromic microcephaly related to GTPBP2 gene in two siblings with an autosomal recessive pattern of inheritance, and to the best of our knowledge, is the first report of the GTPBP2 related hypotrichosis microcephaly with generalized muscular dystrophy.

    Grant references: This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

    E. Akbariazar: None. I. Abdi Rad: None. A. Vahabi: None.

    E-P11.071 Genotypes and phenotypes in 6p25 deletion syndrome

    I. Bader1, I. Reindl2, G. Sander1, G. Kronberger1, A. Pleyers1, H. Mayr2, J. Koch2, J. Atzwanger2, C. Frenzel2, E. Haschke-Becher3, D. Kotzot1, W. Sperl2

    1Unit for Clinical Genetics, Paracelsus Medical University Salzburg, Salzburg, Austria, 2Department of Pediatrics; Paracelsus Medical University, Salzburg, Austria, 3Department of Medical and Chemical Laboratory Diagnostics, Paracelsus Medical University Salzburg, Salzburg, Austria

    We report the phenotype and genotype of two children with a microdeletion in 6p25:

    1. 1.

      A 4 years and 11 months old boy with a cMRI showing large bifronto-temporal arachnoidal cysts and multifocal white-matter-lesions involving the periventricular, deep, and subcortical cerebral white matter. The phenotype of the boy included mild developmental delay, strabism, slightly dysmorphic features and mild hearing impairment.

      Molecular karyotyping detected a ~ 3,9 Mb heterozygous microdeletion in 6p25.3 - 6p25.2 deleting 34 genes, 18 of which were OMIM annotated including the transcription factor FOXC1.

    2. 2.

      A 13 year old girl with Axenfeld-Rieger anomaly who developed glaucoma at the age of 12 years and had surgery for ASD II in the first year of life. The phenotype of the girl included typical dysmorphic features. She performs extremely well at high school (Gymnasium) and in sports. Molecular karyotyping detected a ~ 2,35 Mb heterozygous Deletion in 6p25.3-6p25.2 deleting 17 genes, 8 of which are annotated in OMIM, including FOXC1.

    From our cases and from review of the literature we conclude that a microdeletion in 6p25 should be considered as the cause in patients with unclear multifocal cerebral white matter abnormalities or Axenfeld-Rieger syndrome when additional dysmorphic features and congenital anomalies are present, even when intellectual abilities are within the normal range (Vernon et al. 2013).

    I. Bader: None. I. Reindl: None. G. Sander: None. G. Kronberger: None. A. Pleyers: None. H. Mayr: None. J. Koch: None. J. Atzwanger: None. C. Frenzel: None. E. Haschke-Becher: None. D. Kotzot: None. W. Sperl: None.

    E-P11.074 A novel deletion in ZEB2 and biallelic frameshift variants in CNKSR1 identified in a patient dysmorphologically diagnosed with Mowat-Wilson syndrome

    T. Kaname1, K. Yanagi1, M. Takeshita1, M. Omata1, N. Kobayashi1, Y. Abe1, K. Naritomi2, Y. Matsubara1

    1National Center for Child Health and Development, Tokyo, Japan, 2Okinawa Nanbu Rehabilitation and Medical Center, Naha, Japan

    Mowat-Wilson syndrome (MOWS) is an autosomal dominant disorder characterized by distinctive facial appearance, intellectual disability, delayed motor development, microcephaly and short stature. It is known that most patients with MOWS have heterozygous mutations in the ZEB2 gene. We encountered a 3-year-old female patient with distinctive facial appearance (narrow bifrontal diameter, frontal bossing, telecanthus, epicanthal folds, prominent antihelices, prominent ears, uplifted earlobes, prominent nasal bridge), intellectual disability, delayed motor development, hypotonia and short stature. She was clinically diagnosed with MOWS. However, since direct sequencing for ZEB2 coding exons displayed no pathogenic variants in the patient, we performed whole exome analysis for trio in the family. No pathogenic SNVs in ZEB2 but biallelic frameshift variants (p.Thr282fs from mother and p.Ala503fs from father) in CNKSR1 were identified in the patient. There are two reports that a recognizable autosomal recessive intellectual disability was caused by disruption of CNKSR1. The p.Thr282fs was recurrent and the p.Ala503fs was novel. However, clinical manifestations of the patient did not match the phenotypes of CNKSR1 mutations, which were previously reported. In addition, a homozygous variant of p.Pro284HisfsTer74 in CNKSR1 was registered 224/273,674 in the gnomAD. Thus, copy number analysis was performed using whole exome data. We found an approximately 360kb deletion around intron 7 of ZEB2 in the patient, which was de novo. The deletion was confirmed by the brakepoint analysis using PCR and direct Sanger-sequencing. Based on these findings, we concluded that the patient was clinically and genetically diagnosed with MOWS caused by the novel deletion in ZEB2.<!--EndFragment-->

    T. Kaname: None. K. Yanagi: None. M. Takeshita: None. M. Omata: None. N. Kobayashi: None. Y. Abe: None. K. Naritomi: None. Y. Matsubara: None.

    E-P11.075 7q11.23 duplication in a Mayer-Rokitansky-Kuster-Hauser syndrome patient

    G. C. R. Cunha1, M. V. Zuben1, A. Lofrano-Porto1, M. Soares2, P. Moretti1, R. S. Bonadio1, S. F. De Oliveira1, J. Mazzeu1, A. Pic-Taylor1

    1University of Brasilia, Brasilia, Brazil, 2Hospital Universitario de Brasilia, Brasilia, Brazil

    Mayer-Rokitansky-Küster-Hauser syndrome (MRKH) is a rare congenital disorderaffecting approximately 1:4000-5000 women. This condition is the second most common cause of primary amenorrhea and is characterized by absence or hypoplasic uterus, absence of the upper part of vagina and normal or hypoplasic fallopian tubes. A sex-limited (female) dominant autosomal inheritance with incomplete penetrance and variable expressiveness has been suggested. A range of gene and genomic alterations have been described and contributed to the identification of possible causative genes. For example, mutations in WNT4 and LHX1 and CNV regions, especially 1q21.1, 16p11.2, 17q12, 22q11.21 and Xp22, were described in affected patients. Here we described a patient with MRKH presenting a single CNV known to cause the 7q11.23 microduplication syndrome. The 29 year old patient, born from unrelated parents, present primary amenorrhea, absence of uterus and a short vagina, characteristics of the MRKH syndrome, but also grade II hepatic steatosis, dorsal convex sinus scoliosis, anterolateral marginal osteophytes, ocular problems (myopia, astigmatism and strabismus), obesity and facial dysmorphisms, features that fit to 7q11.23 microduplication syndrome. The CMA (CytoScanTM 750k platform, Thermo Fisher Scientific, Affymetrix) revealed a 1,404 Kb duplication of 7q11.23 including 24 genes, the same recurrent duplication described in the 7q11.23 duplication syndrome. As the patient has MRKH and some of the features of 7q11.23 duplication syndrome, we propose that duplication of genes in this region might also be involved the etiology of MRKH in our patient

    G.C.R. Cunha: None. M.V. Zuben: None. A. Lofrano-Porto: None. M. Soares: None. P. Moretti: None. R.S. Bonadio: None. S.F. De Oliveira: None. J. Mazzeu: None. A. Pic-Taylor: None.

    E-P11.079 Variant of unknown clinical significance in the Verheij syndrome gene (PUF60) in a 5 months old boy with multiple neonatal anomalies

    V. Radoi1,2,3, L. Pop3, L. Bohiltea1, N. Suciu3, R. Ursu1,2,3

    1”Carol Davila” University of Medicine and Pharmacy, Department of Medical Genetics, Bucharest, Romania, 2Synevo Romania, Central Reference Laboratory, Department of Medical Genetics, Bucharest, Romania, 3National Institute for Mother and Child Health "Alessandrescu-Rusescu”, Bucharest, Romania

    Reclassifying variants of unknown significance (VUS) coming from NGS sequencing is in many cases extremely challenging, needing a series of supporting criteria. We present the case of a 5 months old boy with a complex neonatal symptomatology including generalized hypotonia, global developmental delay, growth delay, hearing impairment, eye abnormalities, renal agenesis, a.o. The family history of the patient revealed a brother with polydactyly. The clinical suspicion at referral was CHARGE syndrome, with recommendations for genetic testing. Whole Exome Sequencing was performed on an Illumina platform. The results of the genetic analysis invalidated the CHARGE syndrome clinical suspicion, but revealed the presence of the heterozygous c.1604G>C / p.Arg535Pro variant of unknown clinical significance (VUS, class 3 variant) in the PUF60 gene (Poly-U-Binding Splicing Factor, OMIM #604819) on chromosome 8q24.3. The variant is a missense substitution and has never been described in literature before. Pathogenic variants in the PUF60 gene are documented to cause the autosomal dominant Verheij syndrome (OMIM #615583), disorder with a complex but highly variable symptomatology with onset at birth which includes growth retardation, global developmental delay, eye abnormalities, renal agenesis. Considering the patient`s phenotype and the clinical symptomatology of the syndrome produced by pathogenic mutations in the PUF60 gene, the identified c.1640A>G variant may be reclassified as a class 4 (Likely Pathogenic) mutation. Parental testing for the identified mutation has been recommended, but also genetic testing of the brother with polydactyly might possibly be adviced.

    V. Radoi: None. L. Pop: None. L. Bohiltea: None. N. Suciu: None. R. Ursu: None.

    E-P11.080 A novel splice-variant in NONO in a boy with non-compaction cardiomyopathy and corpus callosum aplasia

    V. Strehlow1, T. Bartolomaeus1, F. Cavallo2, M. Karnstedt1, S. Schubert1, M. Weidenbach2

    1Institute of Human Genetics, University of Leipzig Medical Center, Leipzig, Germany, 2Department of Pediatric Cardiology, Heart Centre Leipzig, University of Leipzig, Leipzig, Germany

    We describe a 6 month old boy with non-compaction cardiomyopathy (NCC), multiple VSDs, Ebstein’s anomaly and aplasia of the corpus callosum. Prenatal examination revealed a VSD and corpus callosum aplasia. The boy was born at 38 weeks of gestation with low birth weight (-1.64 SD) and normal length and head circumference. The newborn needed respiratory support postnatally but could be discharged home at the age of 2 weeks. He was admitted to Heart Centre Leipzig at the age of 2.5 months due to failure to thrive and congestive heart failure. Echocardiography showed NCC of both ventricles, multiple ventricular septal defects and mild Ebstein’s anomaly resulting in severe tricuspid regurgitation. Pulmonary artery banding was performed at the age of 4 months. Postsurgical course was prolonged but finally the child could be transferred to a specialized rehabilitation hospital at the age of 5 months. In the course of time the child showed a developmental delay, reduced spontaneous body movements and central hearing impairment. Exome sequencing revealed the hemizygous splice-variant c.651-1G>C, p.? in the NONO-gene. In the segregation analysis, a carriership for the NONO-variant of the asymptomatic mother could be proven. RNA analysis of the NONO-gene revealed a splice effect on exon 7 and proved the pathogenic effect of the splice-variant. In summary, we report a case with a novel NONO variant (16 variants reported so far) and extend the phenotypic spectrum by NCC of both ventricles and corpus callosum aplasia.

    V. Strehlow: None. T. Bartolomaeus: None. F. Cavallo: None. M. Karnstedt: None. S. Schubert: None. M. Weidenbach: None.

    E-P11.081 Expanding the clinical and genetic spectrum of the Hermansky Pudlak syndrome type 9

    M. M. Golas, S. von Hardenberg, T. Ripperger, J. Lentes, B. Schlegelberger, D. Steinemann, S. Morlot, B. Auber

    Department of Human Genetics, Hannover Medical School, Hannover, Germany

    Introduction: The Hermansky Pudlak syndrome (HPS) is a multi system autosomal-recessive disease that results from a dysfunction of lysosome-related organelles. HPS manifests as oculocutaneous albinism, bleeding diathesis and variable additional symptoms. Based on the causative gene, ten HPS subtypes have been described. HPS type 9 (HPS9) being caused by loss-of-function variants in BLOC1S6 is an exceedingly rare HPS subtype, and up to now, only three patients have been reported to be affected by HPS9.

    Materials and methods: A DNA sample of the index patient was analyzed by whole exome sequencing and array comparative genomic hybridization (array-CGH).

    Results: The 19-year-old female patient presented with oculocutaneous albinism, a bleeding disorder, and susceptibility to infections; however, the patient was neither affected by gastrointestinal nor pulmonary symptoms. On clinical examination, the patient presented with pale skin, blond hair as well as fair eyebrows and eyelashes. Nystagmus and photophobia were noted. Genetic analyses using whole exome sequencing identified a novel splice-site variant of BLOC1S6, c.83-2A>G p.? (ENST00000220531), in combination with a deletion of the second BLOC1S6 allele, which was confirmed as novel interstitial microdeletion using array-CGH (arr[GRCh37] 15q21.1(45821145_46319127)x1). Based on the genetic analyses, the patient was diagnosed with HPS9 (MIM#614171).

    Conclusions: Our case suggests that immune deficiency may be associated with HPS9 and thus expands the clinical spectrum of HPS9. Rigorous genetic testing, including analyses for copy number alterations, is recommended for patients suspected for HPS to guide the clinical management and to define follow-up examinations based on the clinical spectrum of the HPS subtype.

    M.M. Golas: None. S. von Hardenberg: None. T. Ripperger: None. J. Lentes: None. B. Schlegelberger: None. D. Steinemann: None. S. Morlot: None. B. Auber: None.

    E-P11.084 Unusual clinical findings in a case with PACS2-related syndrome

    D. Avdjieva-Tzavella1, S. Atemin2,3, T. Todorov4, H. Kathom1, X. Cao5, S. Wadhwa6, Y. Lei5, V. Mitev3, R. H. Finnell6,7, A. Todorova4,3

    1Department of Clinical Genetics, University Pediatric Hospital, Medical University, Sofia, Bulgaria, 2Genetic Medico-Diagnostic Laboratory “Genica", Sofia, Bulgaria, 3Department of Medical Chemistry and Biochemistry, Medical University, Sofia, Bulgaria, 4Genetic Medico-Diagnostic Laboratory “Genica”, Sofia, Bulgaria, 5Center for Precision Environmental Health, Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, 77030,, TX, United States, 6Center for Precision Environmental Health, Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, 77030, TX, United States, 7Departments of Molecular and Human Genetics and Medicine, Baylor College of Medicine, Houston, TX, United States

    Introduction: Developmental and epileptic encephalopathies (DEE) are a heterogeneous clinical and genetic group of neurodevelopmental diseases. Recently, PACS2 gene mutations have been implicated in DEE with cerebellar dysgenesis and facial dysmorphism. Almost all described patients presented with a recurrent de novo missense mutation, c.625G>A (p.Glu209Lys). Their phenotype was characterized by early-onset epilepsy, cerebellar dysgenesis, dysmorphic facial features, moderate to severe developmental delay, and autism. We report the first Bulgarian case of this rare syndrome.

    Case Report: The patient, a 17-month-old boy, was referred to genetic evaluation because of the developmental delay and neonatal convulsions started during the first week of life. He was born at term after complicated pregnancy. Birth weight was 3920 g and length was 51 cm. Physical examination showed facial dysmorphism including hypertelorism, down-slanted palpebral fissures, broad nasal root, broad flat nasal bridge, broad nasal tip, posteriorly rotated ears, downturned corners of the mouth and thin lips. Additional features include micropenis, inverted widely spaced nipples, one hypopigmented skin spot, one café au lait spot, nevus flammeus on the neck and coloboma of the iris.

    Results: The molecular genetic analysis was performed by whole exome sequencing (WES) of trio. The data interpretation revealed a pathogenic variant c.625G>A;p.Glu209Lys in the PACS2 gene. The variant was confirmed by Sanger sequencing.

    Conclusions: Our study expands the clinical spectrum of PACS2 mutations. The coloboma of the iris is an unusual feature and it is difficult to determine whether it is etiologically related to this newly recognized syndrome or represents a coincidental finding.

    D. Avdjieva-Tzavella: None. S. Atemin: None. T. Todorov: None. H. Kathom: None. X. Cao: None. S. Wadhwa: None. Y. Lei: None. V. Mitev: None. R.H. Finnell: None. A. Todorova: None.

    E-P11.086 Pendred syndrome in a 32-year-old woman- case report

    P. M. Pachniak, M. Malarska, H. Moczulska, A. Lewandowska- Polak, J. Makowska, M. Borowiec

    Medical University of Lodz, Lodz, Poland

    Background: Pendred syndrome is an autosomal recessive inherited disease characterized by by congenital sensorineural hearing loss, hypothyroidism and Hashimoto’s disease. There are significant problems with maintaining balance due to disturbances in the vestibular system of the internal ear.

    Case: The patient is a32-year-old woman with rheumatoid arthritis, rheumatoid factor, ANA and anti CCP antibodies present in high titers, HLA-B27 negative. Patient has Hashimoto’s disease, hyperinsulinemia with insulin resistance, problems with balance and permanent ear implants due to congenital hearing loss of unexplained cause. The 35delG heterozygote status was detected at the age of 18. Diagnostics was expanded adding exclusion of other deletions and insertions in the 12-72bp region of the 2nd exon of the GJB2 gene, with a particular indication of the exclusion of the 167 T deletion, the 314 deletion and the 333 deletion. The 1555A> G mitochondrial mutation was not found. The patient at the time was in good condition, with full verbal contact, actively working professionally. Due to presence of goiter, Hashimoto’s disease, hyperinsulinemia and vestibular dysfunction, periodic dizziness Pendred’s syndrome was clinically suspected. Genetic testing to confirm the syndrome is ongoing.

    Conclusions: The pedrina protein mutations occurs in the thyroid follicles, internal ear, kidneys, brain, liver, as well as in semen. The disease picture can be very diverse. One should always remember to think about Pendred syndrome after excluding the most common genetic causes of hearing defects, because through adequate iodine supplementation, the development of goiter can be prevented or regress.

    P.M. Pachniak: None. M. Malarska: None. H. Moczulska: None. A. Lewandowska- Polak: None. J. Makowska: None. M. Borowiec: None.

    E-P11.087 Familial pericentric inversion of chromosome 3 predisposing to de novo interstitial microdeletion 3p14.3-p21.31

    R. V. Vazharova1, I. Bradinova2, S. Andonova2, S. Bichev2, A. Savov2

    1Sofia University St. Kliment Ohridski, Faculty of Medicine, Department of Biology, Medical genetics and Microbiology, Sofia, Bulgaria, 2Medical University Sofia, UHOG “Maichin dom”, National genetic laboratory, Sofia, Bulgaria

    Introduction: Pericentric chromosome inversions are rare (except the polymorphic inv(9)(p11;q12)) and are a known cause of reproductive failure or birth of individuals with chromosome imbalance. Here we report clinical and molecular findings of individuals from a family with a pericentric inversion of chromosome 3.

    Materials and methods: The family was revealed as part of a study of CNVs in a cohort of patients with intellectual disability and/or multiple congenital anomalies. According to the study protocol genetic tests included karyotyping, MLPA and arrayCGH. Array CGH analysis was performed using custom designed whole-genome oligonucleotide arrays (OGT, UK) with a median probe spacing of about 2.5 kb and median resolution of about 10 kb. CytoSure Interpret (OGT, UK) software was used for CNV detection.

    Results: In the reported family several relatives in four generations were found to carry an apparently balanced pericentric inversion of chromosome 3 - inv(3)(p21;q21). Four inversion carriers presented complex clinical features including mild/moderate intellectual disability, epilepsy, occult spina bifida and facial dismorphism. By arrayCGH the affected family members were found to carry a heterozygous 4.35 Mb interstitial microdeletion (arr3p21.31p14.3(50,963,804-55,318,121)x1) encompassing a total of 79 genes and disrupting the DOCK3 gene.

    Conclusions: Unusual findings in this family are that no carrier reported reproductive problems like infertility or miscarriages, all affected family members share the same interstitial microdeletion which occurred as de novo event in progenies of four different inversion carriers. This work was supported by funding from the Bulgarian Ministry of Education and Science / FNI, Grant: DTK02-51/2009.

    R.V. Vazharova: None. I. Bradinova: None. S. Andonova: None. S. Bichev: None. A. Savov: None.

    E-P11.088 A Japanese girl with a novel variant of PIK3R1 showed deterioration of insulin resistance to biguanide treatment

    K. Yanagi1, S. Toguchi2, K. Satou1, M. Inoue2, K. Nritomi3, Y. Matsubara4, T. Kaname1

    1Genome Medicine, National Center for Child Health and Development, Tokyo, Japan, 2Department of Pediatrics, Naha City Hospital, Okinawa, Japan, 3Okinawa Nanbu Habilitation and Medical Center, Okinawa, Japan, 4National Center for Child Health and Development, Setagaya, Japan

    SHORT syndrome (MIM#269880) is defined by its acronym; short stature, hyperextensibility of joints or inguinal hernia or both, ocular depression, Rieger anomaly, and teething delay. Since the name was given by Gorlin (1975), fewer than 50 cases have been reported in the literature. About 10 heterozygous pathogenic variants of the PIK3R1 gene in patients with SHORT syndrome have been reported to date. Here we report a Japanese girl with clinically and genetically diagnosed as SHORT syndrome. A patient is 17-year-old girl born to non-consanguineous parents at 40 weeks and 6 days with birth weight of 1,484g, height of 37.5 cm and head circumstance of 34 cm. She had most of the clinically typical features of SHORT syndrome. Extensibility of joints were mild. Her face was triangular with telecanthus, deep-set eyes, wide nasal bridge, downturned corners of the mouth and large ears. Speech delay and hearing loss were also observed. Her bone age was equivalent to her age. Partial lipodystrophy of the face and upper limbs were recognizable. She had insulin-resistant diabetes whose blood glucose was difficult to control by biguanide treatment. A novel heterozygous missense variant in the PIK3R1 gene (NM_181523) was identified in the patient by whole exome analysis. It was de novo. The variant was located in PI3K regulatory subunit P85 inter-SH2 domain. A recent report shows that biguanide worsen insulin resistance in SHORT syndrome with a PIK3R1 mutation. Her blood glucose became well controlled after changing medication of biguanide to mecarmin.

    K. Yanagi: None. S. Toguchi: None. K. Satou: None. M. Inoue: None. K. Nritomi: None. Y. Matsubara: None. T. Kaname: None.

    E-P11.090 New polydactyly phenotypes apparently associated with homozygous GLI3 variants

    G. Van Winckel1, A. El Mouatani2, T. Attie-Bitach2, K. Zaafrane-Khachnaoui3, A. Superti-Furga1, H. Fodstad1, F. Giuliano1

    1Division of Genetic Medicine, Lausanne University Hospital (CHUV), Lausanne, Switzerland, 2Division of Genetics, Necker Hospital for Sick Children, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France, 3Medical Genetics Unit 2, L’Archet Hospital, Nice, France

    Heterozygous variants in GLI3 are involved in a clinical spectrum of polydactyly. Greig cephalopolysyndactyly and Pallister-Hall syndromes are the two main syndromic forms. Several isolated forms of postaxial or preaxial polydactyly are also recognized.

    We report three unrelated individuals, all from consanguineous parents. An Afghan 10-year-old girl, presented bilateral postaxial polydactyly of the hands associated with developmental delay and multiple malformations. NGS disclosed a homozygous variant, c.668G>A (p.Ser223Asn), in GLI3. A newborn boy of Tunisian origin presented with an apparently isolated bilateral hand and feet postaxial polysyndactyly. He was found to have a homozygous variant c.1673C>T (p.Ser558Leu) in GLI3. Finally, an adult male was diagnosed with bilateral mesoaxial polydactyly of the hands associated with intellectual disability and multiple malformations. NGS disclosed an homozygous variant in GLI3, c.565_567delinsTCT (p.Pro189Ser).

    To the best of our knowledge, only GLI3 monoallelic variants have been implicated in “GLI3 morphopathies” so far. Given (1) the similarity of the polydactyly phenotypes in our patients to those of classic GLI3 morphopathies, (2) the rarity of the variants observed, and (3) the absence of other pathogenic variants, we suggest that these homozygous variants in GLI3 could be causative. Of note is that the parents of these children, who are heterozygous for these GLI3 variants, are clinically unremarkable. This would indicate when monoallelic, these variants do not reach a pathogenic threshold necessary for clinical expression.

    G. Van Winckel: None. A. El Mouatani: None. T. Attie-Bitach: None. K. Zaafrane-Khachnaoui: None. A. Superti-Furga: None. H. Fodstad: None. F. Giuliano: None.

    E-P11.091 Prader-Willi syndrome caused by novel 3-7 exons deletion of SNRPN gene

    R. Traberg, I. Nasvytiene, M. Sukys, V. Asmoniene

    Lithuanian University of Health Sciences, Medical Academy, Department of Genetics and Molecular Medicine, Kaunas, Lithuania

    We report a 6 month old boy who was referred to clinical genetics consultation because of global development delay and failure to thrive. He was 4th child of non-consanguine Lithuanian couple. Older brother died due to sudden infant death syndrome at 12 months of age. The pregnancy was non complicated, full term and finished with caesarean section due to placental abruption. Muscular hypotonia and feeding difficulties noticed soon after birth. Basic biochemical blood tests, abdomen ultrasound scan, brain ultrasound scan were normal. Neurologic examination showed normal tendon reflexes but muscular hypotonia. On physical examination (6 months old): height 67 cm (25‰), weight 6400 g (<3‰), head circumference 42 cm (10‰). The patient was dysmorphic: almond-shaped eyes, narrow bifrontal diameter, narrow nasal bridge and thin vermilion of the upper lip, small hands and feet, unilateral cryptorchidism. We performed methylation specific multiplex ligation-dependent probe amplification (MS-MLPA) (SALSA MLPA Probemix ME028 Prader Willi/Angelman kit, MRC Holland) of 15q11-q13 region. The analysis showed 3-7 exons deletion of SNRPN gene with maternal methylation profile. Based on symptoms, clinical examination and molecular testing results the diagnosis of Prader-Willi syndrome was confirmed. The patient died at 8 months of age due to infection complications and there is no further data about clinical course of that case. There are only few reports about intragenic SNRPN gene variants that cause Prader-Willi syndrome. We present 3-7 exons deletion of SNRPN gene as novel, not reported in scientific literature, possible cause of Prader-Willi syndrome.

    R. Traberg: None. I. Nasvytiene: None. M. Sukys: None. V. Asmoniene: None.

    E-P11.092 Report and investigation of regions of homozygosity in the autosomal genome of Brazilian individuals with intellectual disability and (or) multiple congenital anomalies previously investigated by chromosomal microarray analysis

    G. R. Correia-Costa1, S. Spineli-Silva1, I. C. Sgardioli1, A. P. dos-Santos1, J. R. Marques-Prota1, R. Secolin1, N. Leijsten2, M. H. A. Ruiterkamp-Versteeg2, N. de Leeuw2, I. Lopes-Cendes1, V. L. Gil-da-Silva-Lopes1, T. P. Vieira1

    1Department of Medical Genetics and Genomic Medicine, School of Medical Sciences, State University of Campinas, Campinas, Brazil, 2Department of Human Genetics, Radboud University Medical Center, Nijmegen, Netherlands

    Introduction: Regions of homozygosity (ROH) in the genome may be due to uniparental disomy or identity-by-descent and may be clinically relevant. The aim of this study was to report the frequency of ROH ≥10Mb or >1% in the autosomal genome of individuals with intellectual disability (ID) and (or) multiple congenital anomalies (MCA), and compare these data with a control group from the Brazilian population, including individuals from the BIPMed repository (www.bipmed.org).

    Materials and methods: Calls of homozygosity from 265 patients and 289 controls tested with CytoScan™ 750K, CytoScan™ HD or SNP 6.0™ arrays (Thermo Fisher Scientific Inc., Life Technologies, Carlsbad, CA, USA) were analyzed using the Chromosome Analysis Suite - ChAS (version 4.0.0.385 (r28959) - Affymetrix®) (hg19) with filters set as a minimum of 500 markers and size of 1,500kb. For complementary investigation, to date, whole exome sequencing (WES) was performed for 4 individuals with increased ROH in the genome.

    Results: Single large ROH ≥10Mb were detected in 1.9% of patients compared to 0.3% in the control group. ROH >1% in the autosomal genome was detected in 7.2% of patients compared to 1.4% in the control group. WES revealed three pathogenic homozygous variants (ASPM, CTNS and DHCR7) in one patient with 5.56% of ROH.

    Conclusion: We found a higher proportion of ROHs in individuals with ID and (or) MCA. These results highlight the importance of investigating ROHs in this group of patients which with complementary tests, such as WES, can improve diagnostic yield. Financial support: CNPq, FAPESP(#2018/08890-9), CAPES, FAEPEX-Unicamp.

    G.R. Correia-Costa: None. S. Spineli-Silva: None. I.C. Sgardioli: None. A.P. dos-Santos: None. J.R. Marques-Prota: None. R. Secolin: None. N. Leijsten: None. M.H.A. Ruiterkamp-Versteeg: None. N. de Leeuw: None. I. Lopes-Cendes: None. V.L. Gil-da-Silva-Lopes: None. T.P. Vieira: None.

    E-P11.093 A case with novel missense c.425T>C mutation in RIPK4 Gene: Bartsocas Papas Syndrome

    A. Yılmaz1, F. I. Karan2, U. Abur3, H. C. Aygün2

    1Ondokuz Mayıs University Medical Faculty, Department of Pediatric Genetics, Samsun, Turkey, 2Ondokuz Mayıs University Medical Faculty, Department of Neonatology, Samsun, Turkey, 3Ondokuz Mayıs University Medical Faculty, Department of Medical Genetics, Samsun, Turkey

    Backgound: Bartsocas Papas Syndrome (BPS) is a form of lethal popliteal pterygium syndrome, caused by homozygous mutation in the RIPK4 gene. Although BPS is described lethal, review of the literature reveals individuals who survive into childhood with this condition.

    Case presentation: The patient was born after induction due to preeclampsia at 36 weeks gastation. The patient had cleft limb, small nose, cloudy cornea, popliteal and inguinal pterygia, complet syndactyly of all fingers and toes, absent of nails, pes equinovarus and ambigious genitale. Abdominal and transfontanelle ultrasonography was normal and no congenital heart malformation was detected on echocardiographic examination. Percutaneous gastrostomy tube was placed due to feding difficulty and tracheostomy was performed for apropriate follow up. BPS was considered with clinical findings. Next generation sequencing of RIBK4 revealed a novel homozygous missense mutation in exon 2 (c.425T>C; p.Leu142Pro).

    Conclusions: BPS is rare and lethal form of popliteal pterygium sendrome, characterized by cutaneous webbing across one or more major joints, cleft lip/palate, syndactyly, genital hypoplasia, ankyloblepharon, and ectodermal defects, absent eyelashes and eyebrows, and brittle nails. Our patient had a novel missense c.425T>C mutation in RIBK4 gene. This mutation is predicted as pathological by in silico programs. Missense and nonsense mutations cause both the lethal and nonlethal recessive forms of multiple pterygium syndrome, characterized by severe organ anomalies of ectodermal origin. Although supportive treatments can be done life span is short so detection of mutation in lethal genetic diseases is very important for prenatal diagnosis and patient management in subsequent pregnancies.

    A. Yılmaz: None. F.I. Karan: None. U. Abur: None. H.C. Aygün: None.

    E-P11.094 Novel missense mutation c.1784A>G, p.Tyr595Cys in RPS6KA3 gene responsible for Coffin Lowry Syndrome in a family with variable features and diabetes 2.

    T. YAMMINE 1,2

    1Medical Genetics Unit, Beirut, Lebanon, 2Saint Joseph University, Beirut, Lebanon

    Coffin Lowry syndrome (CLS) is an X-linked rare disorder, characterized by cognitive impairment, craniofacial dysmorphism, digit abnormalities, skeletal malformations, paroxysmal movement disorders and cardiac abnormalities. The gene altered in this disease is RPS6KA3 (ribosomal protein S6 kinase), located on Xp22.12. Previously identified mutations are distributed throughout the 22 exons of the gene. A large Lebanese family with several affected members, was referred to our Medical Genetics Unit for genetic evaluation. Analysis of RPS6KA3gene revealed the presence of a novel likely pathogenic variant, c.1784A>G, p.Tyr595Cys in exon 19. This variant is located in the catalytic and ribosomal domain of the protein with a highly conserved amino acid. The physico-chemical difference between Tyrosine and cysteine are very significant. The variant was identified in all affected males and carrier females all displaying clinical features of variable severity, consistent with CLS. It is noteworthy that most of the affected or carrier individuals in the family developed diabetes type 2; further studies are required for a better delineation of the disorder and in order to investigate the correlation between type 2 diabetes and CLS.

    T. Yammine: None.

    E-P11.095 A novel PIK3R1 mutation in a Chinese female with SHORT syndrome and literature review

    Q. Zhang1, X. Wang1, L. Sun2, Q. Li1, Y. Tang1, Y. Wang1, X. Li1, N. Li3, J. Wang3

    1Department of Endocrinology and Metabolism, Shanghai Children’s Medical Center, Shanghai Jiaotong University School of Medicine, Shanghai, China, 2Department of Pediatric and Adolescent Gynecology, The Children’s Hospital of Zhejiang University School of Medicine, Hangzhou, China, Hangzhou, China, 3Department of Medical Genetics and Molecular Diagnostic Laboratory, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, Shanghai, China

    Introduction: SHORT syndrome is a rare genetic disease named with the acronyms of short stature, hyper-extensibility of joints, ocular depression, Rieger anomaly and teething delay. It is inherited in an autosomal dominant manner confirmed by the identification of heterozygous mutations in PIK3R1. Only 43 cases have been confirmed with gene sequencing in the worldwide.

    Materials and methods: Whole exome sequencing was performed on the patient and sanger sequencing confirmed the variant comparing to her parents. We made a literature review of all reported SHORT syndrome cases online before February 2020, trying to illustrate the genotype-phenotype correlations.

    Results: The patient was a 15-year-old female with intrauterine growth restriction, short stature, teething delay, characteristic facial gestalts, hirsutism and thyroid disease. Sequencing result indicated c.1960C>T, a novel de novo nonsense mutation, leading to the termination of protein translation (p. Gln654*). We also thoroughly reviewed and presented the clinical manifestations of SHORT syndrome in 43 patients according to the mutations in different exons/introns and in different domains of PIK3R1.

    Conclusions: We reported the first patient with SHORT syndrome in China, who was also the first patient with thyroid disease. Features described in the acronym of SHORT syndrome are not universally seen. Thyroid disease may be a new clinical symptom of patient with SHORT syndrome although it need more evidence to support.

    Q. Zhang: None. X. Wang: None. L. Sun: None. Q. Li: None. Y. Tang: None. Y. Wang: None. X. Li: None. N. Li: None. J. Wang: None.

    E-P11.096 The importance of molecular diagnosis in Silver Russell syndrome for the management of an adult patient

    L. Caba1, R. Popescu1, N. Gorduza2, M. Gramescu1, M. Panzaru1, M. Vicol3, C. Rusu1, E. Gorduza1

    1University of Medicine and Pharmacy “Grigore T. Popa”, Medical Genetics Department, Iasi, Romania, 2“St. Spiridon” Hospital, Endocrinology Department, Iasi, Romania, 3University of Medicine and Pharmacy "Grigore T. Popa", Bioethics Department, Iasi, Romania

    Introduction: Silver–Russell syndrome (SRS) is a rare disease associated with prenatal and postnatal growth retardation, characteristic craniofacial dysmorphic features (relative macrocephaly, prominent forehead), body asymmetry and feeding difficulties (Netchine-Harbison Clinical Scoring System). SRS is characterized by genetic heterogeneity because it could be determined by: hypomethylation of the imprinted control region 1 (ICR1) at 11p15.5, maternal uniparental disomy of chromosome 7 (mUPD7), duplications, deletions or translocations involving the imprinted region of chromosome 7. We present a case with molecularly confirmed diagnosis of SRS at the age of 23 years.

    Materials and methods: The patient was clinically diagnosed at 3 years of age with SRS based on delayed prenatal and postnatal growth, relative macrocephaly, triangular face, prominent forehead, dental malposition, facial and limb asymmetry, bilateral finger V clinodactyly. The karyotype was normal 46,XX. In time, bone changes of osteoarthritis of the elbow joint, osteopenia, and hypothyroidism were added. At age of 23 years, the patient was molecularly tested by MLPA technique. We used SALSA MLPA kit ME030 BWS/RSS (MRC Holland, Amsterdam, The Netherlands). The MLPA result confirmed the hypomethylation of H19/IGF2 IG-DMR at 11p15.5. In this situation, the recurrence risks in sibs of the proband and in offspring of the proband are low.

    Conclusions: Although the Netchine-Harbison Clinical Scoring System is a sensitive diagnostic scoring system, molecular testing is especially important in adulthood for genetic counseling and the risk of recurrence, also for establishing the optimal prenatal diagnosis methods depending on the mechanism of disease.

    L. Caba: None. R. Popescu: None. N. Gorduza: None. M. Gramescu: None. M. Panzaru: None. M. Vicol: None. C. Rusu: None. E. Gorduza: None.

    E-P11.100 RBM10 (likely) pathogenic variants are associated with a broad phenotypic spectrum, beyond the classic TARP syndrome features.

    C. Kumps1, E. D’Haenens1, S. Vergult1, B. Menten1, J. Leus2, R. Van Coster3, A. Jansen4, K. Devriendt5, A. Oostra6, O. Vanakker1

    1Center for Medical Genetics, Ghent University Hospital, 9000 Ghent, Belgium, 2Medisch Centrum Maria Middelares, 9050 Gentbrugge, Belgium, 3Department of Pediatrics, Division of Pediatric Neurology and Metabolism, Ghent University, 9000 Ghent, Belgium, 4Pediatric Neurology Unit, Department of Pediatrics, UZ Brussel, 1090 Brussels, Belgium, 5Center for Medical Genetics, Katholieke Universiteit Leuven, 3000 Leuven, Belgium, 6Department of Pediatrics, Division of Pediatric Neurology and Metabolism, University Hospital Ghent, 9000 Ghent, Belgium

    Introduction: TARP syndrome (Talipes equinovarus, Atrial septal defect, Robin sequence and Persistent left superior vena cava) is a rare X-linked disorder caused by mutations in the RBM10 gene. So far, 22 patients have been reported. We present two novel patients with likely pathogenic RBM10 variants.

    Case reports: The first male proband was born preterm with average low birth parameters. Postnatally, a VSD, aspecific brain abnormalities and optical nerve hypoplasia was noted. He displayed facial dysmorphism with telecanthus, upslanting palpebral fissures, a large mouth with downturned mouth corners and retrognathia. There was a growth and development delay. An RBM10 frameshift variant (c.413_416del, p.Ser138Trpfs*60) was identified, which was inherited from a mosaic (13%) mother. The second male proband was born preterm with average birth measurements. After birth, limb contractures, a pectus carinatum, scoliosis and arachnodactyly were noted. Facial features included frontal bossing, crumpled ears and microretrognathia. A diagnosis of congenital contractural arachnodactyly (CCA) was made based on a FBN2 missense mutation. Upon follow-up, he displayed severe growth and developmental delay and brain abnormalities, atypical for CCA. Further investigations revealed a maternally inherited c.1888+4A>C splice site variant in the RBM10 gene, that caused exon 15 skipping.

    Conclusion: Initially RBM10 mutations were described in patients who featured the four cardinal features of TARP syndrome. However, recurrent clinical characteristics appear to include severe developmental delay, growth deficiency, heart defects, central nervous system, vision, skeletal and facial abnormalities. These 2 additional cases illustrate the highly pleiotropic nature of RBM10 mutations, beyond the classic TARP syndrome features.

    C. Kumps: None. E. D’Haenens: None. S. Vergult: None. B. Menten: None. J. Leus: None. R. Van Coster: None. A. Jansen: None. K. Devriendt: None. A. Oostra: None. O. Vanakker: None.

    E-P11.101 TBL1XR1 gene (#608628) ¿Different phenotypes related to same variant?

    A. Serrano Antón1,2, M. Sánchez Soler1,2, M. Ballesta Martínez1,2, V. López González1,2, L. Rodríguez Peña1,2, L. Rausell3, M. García Hoyos3, E. Guillén Navarro1,2

    1Sección Genética Médica. Hospital Clínico Universitario Virgen de la Arrixaca, IMIB-Arrixaca, Murcia, Spain, 2Grupo Clínico Vinculado al Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER), Instituto de Salud Carlos III (ISCIII), Madrid, Spain, 3Departamento de Genética Médica. Instituto de Medicina Genómica (IMEGEN), Valencia, Spain

    Introduction: Pierpont syndrome (PS) is a syndromic intellectual disability that comprises developmental delay, short stature, dysmorphic features and distal limb anomalies with deep palmar and plantar creases. Recurrent de novo missense variant (p.Tyr446Cys) in TBL1XR1 gene was identified as disease-causing. Recently, two patients with Pierpont-like syndrome and different de novo missense variants in TBL1XR1 have been reported.

    Materials and methods: We describe the case of a 14-year-old girl, born to healthy non-consanguineous parents. Pregnancy and neonatal period were uneventful. Postnatal growth with height at eighth centile and normal weight. She presented mild truncal hypotonia with psychomotor and expressive language delay. She attends to special school with major support and speech therapy. Clinical phenotype with narrow palpebral fissures, depressed nasal bridge, broad nose, long upper lip with flat philtrum, everted lower lip and prominent chin. Short and broad hands and feet with deep-set grooves in his palms and soles.

    Results: Brain MRI, ophthalmological examination, renal ultrasound, metabolic analysis, Array-CGH, Fragile-X and targeted exome sequencing yielded normal results. Whole exome sequencing revealed a de novo heterozygous missense variant c.734A>G; p.Tyr245Cys in TBL1XR1 gene.

    Conclusions: We report on a new case characterized by clinical phenotype of PS and de novo missense variant c.734A>G in TBL1XR1 gene. This variant has been prior reported in patient given with developmental delay, short fingers and toes but who does not share distinctive facial features of PS. Hitherto, only ten patients with PS have been published. So, our report provided additional clinical and molecular data.

    A. Serrano Antón: None. M. Sánchez Soler: None. M. Ballesta Martínez: None. V. López González: None. L. Rodríguez Peña: None. L. Rausell: None. M. García Hoyos: None. E. Guillén Navarro: None.

    E-P11.103 Multi-country teamwork to investigate an infant with 45,X/46,X der(Y)t(Y;14), whirl-pooledtype pigmentary mosaicism, and ambiguous genitalia

    V. I. Romero Aguilar1, J. Pozo1, A. Llanos2, C. Hubner3, K. Hosomichi4, A. Tajima4

    1Universidad San Francisco de Quito, Cumbaya, Ecuador, 2Department of Genetics, Hospital General de las Fuerzas Armadas, Quito, Ecuador, 3Institut für humangenetik, Universitätsklinikum Jena, Jena, Germany, 4Department of Bioinformatics and Genomics, Kanazawa University, Kanazawa, Japan

    Introduction: A newborn baby was born in Ecuador from a young non-consanguineous couple, with pigmentary mosaicism in whirl-pooled hyperpigmentation along the body, ambiguous genitalia with no visible testicles and a positive screening for suprarenal hyperplasia. A karyotype showed a trisomy 14 with an additional section on the extra chromosome. Trisomy 14 is one of the aneuploidies compatible with live in a mosaic state and many cases of rearrangements with chromosome 14 had been described in the literature. The predominant phenotype of trisomy 14 mosaicism includes prenatal and postnatal growth failure, ear abnormalities, congenital heart disease, developmental delay and genitourinary abnormalities. Our patient only shared some of phenotypic characteristics making additional genetic tests compulsory.

    Materials and methods: We performed a multi-country teamwork investigation including karyotype in Ecuador, FISH in Germany and WES in Japan

    Results: Karyotype and FISH results concluded 45,X/46,X der(Y)t(Y;14). WES identified no pathogenic nor likely pathogenic variants in the genes associated to suprarenal hyperplasia

    Conclusions: Our case is the first report of an infant with a 45,X/46,X der(Y)t(Y;14). The pigmentary mosaicism is a common feature on trisomy 14. The ambiguous genitalia were the result of the mosaicism which included Turner syndrome and an abnormal male cell-line. Finally, even though there was a positive test for suprarenal hyperplasia, WES analysis reported there were no damaging variants and steroids were suspended.

    V.I. Romero Aguilar: None. J. Pozo: None. A. Llanos: None. C. Hubner: None. K. Hosomichi: None. A. Tajima: None.

    E-P11.104 Partial trisomy 1q42.11-q44 clinical and molecular cytogenetic characterization. Case presentation

    E. Braha1, F. Nedelea2, I. Nedelcu1, O. Popa1

    1National Institute of Endocrinology "CI Parhon", Bucuresti, Romania, 2Clinical Hospital Filantropia, Bucuresti, Romania

    Partial 1q trisomy syndrome is an extremely rare chromosomal abnormality, with only a few cases reported. Frequent features were short stature, multiple minor anomalies, congenital heart defects especially for terminal duplication, learning difficulty, speech and developmental delay. Our goal is to contribute to clinical observation of 1q terminal duplication. We report a male infant (4 months old) with negative family history. Clinical features include intrauterine growth retardation with short stature at the time of clinical evaluation (-2.04 SD), mild facial dysmorphia (microretrognathia, thick eyebrows, hypertelorism, short nose, long smooth philtrum, thin upper lip vermillion, tented upper lip, dysplastic ears with small triangular earlobe), atrial septal defect ostium secundum, patent ductus arteriosus, partial 2-3 toe cutaneous syndactyly, little developmental progress (without head control at 4 months). G-banded karyotype did not reveal any chromosomal abnormalities. The breakpoints were characterised by array CGH using the oligoarray platform CytoScan 750K Array, Gene Scan 3000 (Affymetrix). Our patient has a partial duplication of chromosome 1 between 1q42.11-q44 of 24.72 Mb in lenght (nucleotides 224,499,474 - 249,224,684) according to NCBI 37/hg19. The parents karyotype was normal and FISH tests (for breakpoint) is to be performed. In conclusion we report a 4 months-old male with the distinctive clinical features and probably de novo 1q42.11q44 duplication without parental chromosomal abnormalities. The case requiers long-term medical follow-up for other clinical particulaties highlighted with aging.

    E. Braha: None. F. Nedelea: None. I. Nedelcu: None. O. Popa: None.

    E-P11.107 Possible effect of the imprinting on the Turner´s phenotype

    P. Vrtel1, R. Vrtel1, K. Adamova1, D. Vrbicka1, M. Prochazka1, J. Stellmachova1, E. Klaskova2, J. Zapletalova2, J. Pavlicek3, V. Hana4, V. Stara5, O. Soucek5, J. Lebl5

    1Department of Medical Genetics, University Hospital and Palacky University, Olomouc, Czech Republic, 2Clinic of Paediatrics, University Hospital and Palacky University, Olomouc, Czech Republic, 3Clinic of Paediatrics, University Hospital, Ostrava, Czech Republic, 43rd Department of Medicine - Department of Endocrinology and Metabolism, First Faculty of Medicine, Charles University and General University Hospital, Prague, Czech Republic, 5Department of Pediatrics 2nd Faculty of Medicine, Charles University and University Hospital Motol, Prague, Czech Republic

    Monosomy of chromosome X - Turner syndrome (TS) is the only monosomy postnatally compatible with life. The incidence of this chromosomal abnormality is 1:2500 live female births. Their phenotype can be very variable. Common is low stature, congenital heart defects, renal abnormalities etc. Some of these defects correlate with karyotype - karyotype 45,X is the most severe.

    Other hypothesis is focused on parental origin of chromosome X. Specific defects can correlate with paternal or maternal origin of gonosome. We used molecular genetic analysis for detection microsatellite DNA markers on chromosome X to reveal the origin of these gonosome in TS patients.

    We selected cohort of 50 TS patients (plus their parents) with 45,X karyotype confirmed by karyotype and native FISH. We also tested patients with 46,XX karyotype (but Turner phenotype), for hypothesis of maternal X chromosome homology.

    DNA was isolated from peripheral blood of the patients and the cells of the buccal mucosa of the parents. We used the Argus X-12QS forensic kit for the X-chromosome analysis, which was optimized for our genetic testing. The method is based on detection of 12 STR markers from chromosome X.

    Results suggest that 70 % of X chromosomes are of maternal origin and 30 % cases of paternal origin. The origin of X chromosome in 46,XX cohort was biparental. The next part of our project will be a correlation specific heart defects and renal abnormalities with the origin of gonosome. Supported by MH CZ - DRO (FNOl, 00098892) and grant nr. 17-29111A

    P. Vrtel: None. R. Vrtel: None. K. Adamova: None. D. Vrbicka: None. M. Prochazka: None. J. Stellmachova: None. E. Klaskova: None. J. Zapletalova: None. J. Pavlicek: None. V. Hana: None. V. Stara: None. O. Soucek: None. J. Lebl: None.

    E-P11.110 Uniparental disomy of chromosome 16: a case report with a new cardiac malformation

    F. Di Palma1, M. Goldoni2, E. Marchionni1, B. Caravale3, M. Mondovì3, G. Mastromoro1, D. Guadagnolo1, P. Versacci4, V. D’Ambrosio5, A. Giancotti5, L. Bernardini6, A. Pizzuti1

    1Department of Experimental Medicine, Sapienza University, Rome, Italy, 2Medical Genetics Unit, Casa Sollievo della Sofferenza IRCCS Foundation, San Giovanni Rotondo, Italy, 3Department of Developmental and Social Psychology, Sapienza University, Rome, Italy, 4Department of Pediatrics, Sapienza University, Rome, Italy, 5Department of Maternal and Child Health and Urologic Science, Sapienza University, Rome, Italy, 6Medical Genetics Unit, Casa Sollievo della Sofferenza IRCCS Foundation, San Giovanni Rotondo, San Giovanni Rotondo, Italy

    Introduction: Maternal uniparental disomy of chromosome 16 [UPD(16)mat] is the most often reported UPD other than UPD(15). In literature there is not a specific phenotype associated with upd(16)mat and few follow-up data are reported.

    Materials and methods: We present the case of a 1-y.o. male of a healthy non-consanguineous parents. In prenatal diagnosis IUGR, polydramnios and single umbilical artery was reported. He born late preterm, small for gestational age, and showed facial dysmorphisms and congenital malformations (esophageal atresia, cardiac defects, mild bone alterations, hypospadias). Transesophageal echocardiography detected persistency of left superior vena cava draining into the left atrium through an unroofed coronary sinus. Brain ultrasound showed dilated and asymmetric lateral ventricles. At present, cognitive and language abilities are adequate for age but he has mild gross motor delay. Genomic DNA was extracted from peripheral blood and analyzed by SNP-array (Cytoscan HD; Thermo Fisher Scientific).

    Results: SNP-array analysis showed a 147 Kb homozygous 16p13.3 microdeletion and a 114 kb 16q24.3 microtriplication, both segregated from the mother. Region of Homozigosity (ROH) analysis showed two ROH of 7 and 13 Mb on chromosome 16 compatible with the presence of UPD(16) of maternal origin. The possible presence of a residual mosaic trisomy 16 was excluded by karyotype analysis and FISH.

    Conclusions: This is an additional case of the phenotypic characterization of UPD(16)mat. To date, it is the first time that an unroofed coronary sinus is described within cardiac malformations associated with UPD(16)mat. Moreover, according to literature data, it confirms the need to extend follow-up.

    F. Di Palma: None. M. Goldoni: None. E. Marchionni: None. B. Caravale: None. M. Mondovì: None. G. Mastromoro: None. D. Guadagnolo: None. P. Versacci: None. V. D’Ambrosio: None. A. Giancotti: None. L. Bernardini: None. A. Pizzuti: None.

    E-P11.111 Clinical analysis VACTERL/VACTER cases at children hospital in Bogotá, Colombia

    J. S. Rincon Redondo1, I. Rueda1, Y. Ladino2,3, M. C. Cuellar1, L. A. Gonzalez1, C. M. Restrepo4, O. I. Beltran1,2

    1Facultad de Medicina, Universidad Militar Nueva Granada, Bogotá DC, Colombia, 2Grupo GenHOMI, Hospital Pediátrico de la Misericordia, Bogotá DC, Colombia, 3Maestría en Genética Humana, Universidad Nacional de Colombia, Bogotá DC, Colombia, 4Unidad de Genética y Genómica, CIGGUR, Escuela de Medicina y Ciencias de la Salud, Universidad del Rosario, Bogotá DC, Colombia

    Introduction: The VACTER-L/VATER association has been divided on three subtypes to improve clinical classification and epidemiologic analysis. It is an acronym that corresponds to a group of diverse and complex malformations that was initially described as the non-random occurrence of five anomalies together.

    Methods: Descriptive study of case series of children with VACTER-L/VACTER diagnosis (using the criteria and classification of the EUROCAT) at Hospital Pediátrico de la Misericordia (April 2009-December 2016) approved by institutional ethical committee. Statistical analysis done SPSS program.

    Results: Preliminary selection of 13 patients, one was excluded. The male: female ratio was 1,4, age range (3 months - 9 years old), 1 case had family history of first-degree consanguinity, 1 case had second degree consanguinity, and other had both. Four patients had VACTER-LIKE, three patients presented VACTER-STRICT, and five showed VACTER-PLUS diagnosis. Phenotypes were: VC, ATE, VR, VAT, VTL, ACR, VCR, VAC, VACR (X2), VCTRL, and VACRL. Additional anomalies in patients with VACTER-PLUS included: microtia, hemifacial microsomia, myelomeningocele, structural SNC malformation, these four had more than one anomaly. Eight patients had cytogenetic analysis (all normal) and only one case had normal sequencing exome.

    Conclusions: VACTERL/VACTER association has a typical wide clinical variability, which was evident in our series. Consanguinity was a relevant factor, as forth part of the patients had it. VACTERL/VACTER has been extensively characterized by the 6 defined anomalies;nevertheless, diagnosis is not simple in VACTER-PLUS phenotype, as these cases might present with co-occurrence of multiple pathologies, atypical presentation of relatively common diseases or misdiagnosis.

    J.S. Rincon Redondo: None. I. Rueda: None. Y. Ladino: None. M.C. Cuellar: None. L.A. Gonzalez: None. C.M. Restrepo: None. O.I. Beltran: None.

    E-P11.113 Whole Exome Sequencing in unsolved pediatric cases

    G. Moresco1, O. Rondinone1, A. Mauri1, C. Santaniello1, J. Costanza1, B. Rinaldi2, E. Rosina2, P. Colapietro3, S. Tabano3,4, L. Fontana1, D. Milani2, M. Miozzo1,3

    1Coordination Research Laboratories Unit, Fondazione IRCCS Ca’ Granda, Ospedale Maggiore Policlinico, Milano, Italy, 2Highly Intensive Pediatric Care Unit, Fondazione IRCCS Ca’ Granda, Ospedale Maggiore Policlinico, Milano, Italy, 3Department of Pathophysiology and Transplantation, Università degli Studi di Milano, Milano, Italy, 4Laboratory of Medical Genetics, Fondazione IRCCS Ca Granda Ospedale Maggiore Policlinico, Milano, Italy

    Children suffering from undiagnosed diseases with a possible genetic origin underwent Whole-Exome Sequencing (WES) to disclose the causative variant. We evaluated twenty-two cases resulted negative to aCGH and karyotyping and found the causative lesion in four of them. Herein, we describe two paradigmatic solved cases: one without any definite clinical suspicion (F1), and the other in which the diagnosis was suggested (F2). Libraries were prepared using the SureSelectQXT Clinical Research Exome V2 kit (Agilent) on blood samples collected from patients and family members, and were run on NextSeq550 instrument (Illumina). F1: the female proband presents delayed psychomotor development, polymicrogyria, gastroesophageal reflux and facial dysmorphisms. The analysis identified the novel de novo missense variant c.C625G:p.H209D in the DDX3X gene, an ATP-dependent RNA helicase involved in neurogenesis. Mutations in DDX3X were described as causative of X-Linked Dominant Mental Retardation (OMIM #300958) and variants mapping in the same domain are associated to the specific phenotypic traits of the proband (Lennox et al., bioRxiv, 2018). F2: two siblings were suspected to have Ochoa Syndrome (AR), characterized by congenital urinary bladder dysfunction. In both sibs, the analysis revealed the novel homozygous splicing variant c.1478-2A>G in the LRIG2 gene (OMIM #608869), associated with Ochoa Syndrome. This variant probably alters the proper splicing mechanism, leading to an aberrant mRNA maturation and unfunctional protein (ongoing experiments). Our report expands the genotypic spectrum of the pathogenetic variants of DDX3X and LRIG2 disease-genes. In these cases, WES approach allowed us to get closer to the end of these diagnostic odysseys.

    G. Moresco: None. O. Rondinone: None. A. Mauri: None. C. Santaniello: None. J. Costanza: None. B. Rinaldi: None. E. Rosina: None. P. Colapietro: None. S. Tabano: None. L. Fontana: None. D. Milani: None. M. Miozzo: None.

    E-P11.115 A novel de novo frameshift mutation in SMC1A gene responsible for Cornelia de Lange syndrome 2

    R. Szalai1,2, J. Bene1,2, L. Magyari1,2, A. Maasz1,2, A. Düh1,2, A. Till1,2, K. Hadzsiev1,2, B. Melegh1,2

    1University of Pecs, Clinical Center, Department of Medical Genetics, Pecs, Hungary, 2Szentagothai Research Center, University of Pecs, Pecs, Hungary

    Introduction: Cornelia de Lange syndrome (CdLS) is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. CdLS have been reported in children with mutations of NIPBL, SMC1A, SMC3A, RAD21, and HDAC8 genes. Although, the appearance of classic CdLS is well-characterised, the phenotypic traits of individuals with various SMC1A mutations have some similarities, but have other features that make them different from classic CdLS (e.g., small hands but no limb reductions or oligodactyly, prominent intellectual disability and seizures despite milder structural malformations, and a high rate of isolated cleft palate).

    Materials and methods: We present a patient with CdLS2 features, including progressive microcephaly, severe psychomotor retardation, feeding difficulties, therapy resistant epilepsy, lack of expressive speech, nearsightedness, high arched palate and abnormal palmar creases. Whole Exome Sequencing (WES) analysis was performed using Agilent SureSelectXT library kit and Illumina sequencing technology. Sanger sequencing confirmed the presence of the pathogenic variant.

    Results: WES analysis identified a c.3237_3238insT (p.Asn1080*) pathogenic variant in SMC1A gene in a heterozygous state. This alteration is a frameshift variant with a resulting stop codon leading to nonsense-mediated mRNA decay and loss of function, has never been reported.

    Conclusions: The features of Cornelia de Lange syndrome vary widely, there are 5 distinct subgroups (CdLS1-5) according to the phenotype and affected genes. Here we report a pathogenic frameshift SMC1A mutation in a Hungarian patient with fitting but unique phenotype characteristics of Cornelia de Lange syndrome 2, still representing a novel phenotypic variant, as well.

    R. Szalai: None. J. Bene: None. L. Magyari: None. A. Maasz: None. A. Düh: None. A. Till: None. K. Hadzsiev: None. B. Melegh: None.

    E-P12 Cancer Genetics

    E-P12.07 Genotyping of urinary bladder carcinomas for up-regulated EGFR, PIK3CA, FGFR3 and CDKN2A to determine the potential for targeted therapy

    O. S. Antonova1, S. Rangelov2, B. Mladenov3, Z. Hammoudeh1, D. Nesheva1, O. Ivanovski4, S. Saidi4, G. Petrusevska5, C. Slavov6, A. Dimovski7, Z. Yordanova8, D. Plaseska-Karanfilska7, Z. Popov4, A. Galabov9, D. Toncheva1

    1Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, 2Department of Urology, University Hospital ISUL-Tsaritsa Yoanna, Sofia, Bulgaria, 3Department of Urology, UMBALSM “N. I. Pirogov”, Sofia, Bulgaria, 4University Clinic of Urology University of St. Cyrilius and Methodius, Skopje, Macedonia, The Former Yugoslav Republic of, 5Institute of pathology, Medical faculty, Skopje, Macedonia, The Former Yugoslav Republic of, 6Department of Urology, University Hospital ISUL-Tsaritsa Yoannaf Sofia, Sofia, Bulgaria, 7Research Center for Genetic Engineering and Biotechnology “Georgi D. Efremov”, Macedonian Academy of Sciences and Arts, Skopje, Macedonia, The Former Yugoslav Republic of, 8University of National and World Economy, Sofia, Bulgaria, 9The Stephan Angeloff Institute of Microbiology, Bulgarian Academy of Sciences, Sofia, Bulgaria

    Background:The aim of our study was to identify mutational status of the uroepithelial bladder cancer samples for previously detected by us overexpression of EGFR, PIK3CA, FGFR3 and CDKN2A genes in order to determine the potential for targeted therapy.

    Materials & Methods: Tumour samples from 66 patients, staged pTa - T4 were collected. The epidemiological data related to age, gender, recurrence, smoking habits and occupational exposure were taken from patients’ questionarie. RT-PCR for mutation detection in EGFR (exones 18, 19, 20, 21) and PIK3CA (A3140T, A3140G, C3139T) SensiScreen® as well as SNaPshot multiplex assay for activating FGFR3 mutations and MLPA for CDKN2A CNVs were performed.

    Results and discussion: For the EGFR and PIK3CA only wild type of the tested genetic variants were detected. Mutations in FGFR3 were found in 50 % from the tested tumors: 65% - S249C, 30% Y375C and 5% G372C. Mutations in CDKN2A were detected in 37,5 % from the tested tumors: 53,3% - homozygous deletions, 40% heterozygous deletions and 6,7% duplications.

    Conclusion: The overexpression of the EGFR and PIK3CA was not found to be related to tested mutations and so far these two molecules are not convenient for bladder cancer targeted therapy. On the other hand the overexpression of FGFR3 and CDKN2A could be due to detected mutations.

    Acknowledgements: BG NSF Grants No KP-06-OPR01/3-2018, MANU-BAN.

    O.S. Antonova: None. S. Rangelov: None. B. Mladenov: None. Z. Hammoudeh: None. D. Nesheva: None. O. Ivanovski: None. S. Saidi: None. G. Petrusevska: None. C. Slavov: None. A. Dimovski: None. Z. Yordanova: None. D. Plaseska-Karanfilska: None. Z. Popov: None. A. Galabov: None. D. Toncheva: None.

    E-P12.08 Germline variants in cancer-associated genes in pediatric and young adult patients with brain tumors

    T. S. Lisitsa1,2, V. V. Semenova1, A. A. Mitrofanov3, E. V. Zhukovskaya1, A. F. Karelin1, V. N. Kasatkin1, T. V. Nasedkina1,2

    1Dmitry Rogachev National Medical Research Center Of Pediatric Hematology-Oncology and Immunology, Moscow, Russian Federation, 2Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russian Federation, 3N.N. Blokhin National Medical Research Center of Oncology, Moscow, Russian Federation

    Introduction: Pediatric and young adult brain tumors are often associated with cancer predisposition syndromes. The knowledge of specific mutations in cancer-associated genes may alter the management of the cancer, offer novel targeted therapies and enable early detection of other malignancies.

    Patients and Мethods: Twenty-four patients with brain tumors aged 5-22 years were enrolled in the study, 15 boys and 9 girls. Astrocytoma was the most common histological type (n=10), followed by medulloblastoma (n=6), low-grade glioma (n=3), ependymoma (n=2), craniopharyngioma (n=1), ganglioglioma (n=1), pineoblastoma (n=1). Genomic DNA was isolated from peripheral blood leukocytes and next-generation sequencing on the NextSeq500 Illumina platform was performed. A multigene panel included coding sequences of 132 cancer-associated genes. The library was prepared using enrichment by hybridization with NimbleGen probes (Roche). For the analysis of NF1 large rearrangements MLPA assay was performed.

    Results: In total, six patients carried NF1 mutations: frameshift deletions (n=3), nonsynonymous missence (n=2) or nonsense (n=1) mutations. Patients with NF1 mutations had optic pathway glioma (n=3), pylocytic astrocytoma (n=2) and brain stem tumor (n=1). Three patients also had clinical features of neurofibromatosis type 1, but no NF1 variants were revealed. Other findings included likely pathogenic variants in APC and CHEK2 genes. The results were validated by Sanger sequencing.

    Conclusion: Germline variants associated with cancer were found in one-third of our patients, one-fourth had the mutations in NF1 gene. Thus, molecular analysis is important to reveal NF1-associated brain tumors for accurate diagnosis of the disease and personalized approach to treatment including targeted therapies.

    T.S. Lisitsa: None. V.V. Semenova: None. A.A. Mitrofanov: None. E.V. Zhukovskaya: None. A.F. Karelin: None. V.N. Kasatkin: None. T.V. Nasedkina: None.

    E-P12.09 Characterization of BRCA Genes’ Variants in Turkish Hereditary Breast and Ovarian Cancer(HBOC) Patients

    E. A. Ateş1, C. Alavanda2, H. Polat2, A. Turkyilmaz3, M. A. Soylemez2, B. B. Geckinli2, A. I. Guney2

    1Marmara University Pendik and Research Hospital, Medical Genetics Department, Istanbul, Turkey, 2Marmara University School of Medicine, Medical Genetics Department, Istanbul, Turkey, 3Erzurum Region Training and Research Hospital, Medical Genetics Department, Erzurum, Turkey

    Breast cancer is the most common cancer among women. BRCA genes are associated with %10-15 of all breast cancers. Six hundred-four patients which 169 of them had family history and 435 had breast and/or ovarian cancer, applied to our clinic. After anamnesis, pedigree analyses and physical examinations, BRCA genes were sequenced via Next-Generation Sequencing(NGS) for all patients. Except from 67 patients with pathogenic mutations in BRCA genes, MLPA analysis was planned for all patients. Among patients that had pathogenic mutation, 36 had BRCA1 and 31 had BRCA2 gene mutations. The most common pathogenic mutations were c.5266dupC, c.3624dupA and c.5444G>A in BRCA1 and c.67+1G>A in BRCA2. Sixty-one variants with unknown significance(VUS), mostly missense variants, were identified and the vast majority of them were in BRCA2 gene. In MLPA analyses seven gross deletions in BRCA1 were detected. The most common gross deletion in BRCA1 gene was exon 18-19 deletion. No gross deletion was detected in BRCA2 gene. Four novel mutations in BRCA1 and five novel mutations in BRCA2 gene were identified. In two of 5 patients with both breast and ovarian cancer, BRCA1 pathogenic mutation was detected and this was the highest mutation rate group. Among ten postmenopausal sporadic breast cancer patients, one had BRCA1 pathogenic mutation. This rate was higher than premenopausal breast cancer patients’ rate with family history. This study determines the variants of BRCA genes, their frequencies and their clinical significance in Turkish population. Also, these results showed that screening indications for BRCA should be reviewed.

    E.A. Ateş: None. C. Alavanda: None. H. Polat: None. A. Turkyilmaz: None. M.A. Soylemez: None. B.B. Geckinli: None. A.I. Guney: None.

    E-P12.11 The potential of Dendrosomal curcumin (DNC) as a therapeutic agent for modulating the expression of p53 in both wild type and mutant type cancer cells

    m. montazeri1, Y. Pilehvar Soltanahmadi2, N. Zarghami3, M. Sadeghizadeh4

    1Department of Medical Biotechnology, Faculty of Advanced Science and Technology, Tehran Medical Sciences, Islamic Azad University, Tehran, Iran, Tehran, Iran, Islamic Republic of, 2Cellular and Molecular Research Center, Research Institute for Cellular and Molecular Medicine, Urmia University of Medical Sciences, Urmia, Iran, Urmia, Iran, Islamic Republic of, 3Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran, Tabriz, Iran, Islamic Republic of, 4Department of Genetics, School of Biological Sciences, Tarbiat Modares University, Tehran, Iran, Tehran, Iran, Islamic Republic of

    The effect of Dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3 and p53 wild-type MCF7 in both RNA and protein levels, and also cell cycle distribution and apoptosis. Curcumin derived from rhizome of Curcumin longa modulates key signaling pathways in cellular processes, therefore, it is recently considered in cancer related researches for its cell growth inhibition properties against human tumors. It is evidenced that p53 is the most common tumor-suppressor gene involved in human cancers. Its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Toxicity of DNC was studied using MTT assay and cell cycle distribution, apoptosis study. Real-time PCR and Western blot analysis were used to analyze the expression of p53, and other apoptosis related proteins. DNC treatment during the time increased the cells in the SubG1 and gradually decreases them in the G1, S and G2/M phases, the percentages of early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR showed an increased mRNA expression of BAX, Noxa and p21 during the time with decreased expression of Bcl-2. The expression of p53 mutant decreased in SKBR3, and the expression of p53 wild-type increased in MCF7 cells. Consequently, DNC can drive the tumor cell lines toward the apoptosis by modulating the expression of genes involved in apoptosis and proliferation, furthermore, this study suggest p53 plays an important role in mediating the survival by DNC.

    M. montazeri: None. Y. Pilehvar Soltanahmadi: None. N. Zarghami: None. M. Sadeghizadeh: None.

    E-P12.13 The expression level of the EAF1 & the EAF2 genes is significantly decreased in Iranian breast cancer patients

    S. Heydaran, M. Moghanibashi Mansurieh, S. Naeemi

    department of Genetics, Islamic Azad university, Kazerun, Iran, Islamic Republic of

    Breast cancer death rate is increasing annually in Iran, and early diagnosis is important to reduce the mortality rate. Beside genetic predisposition, environmental factors are the most known risk factors. The EAF1 & the EAF2 tumor suppressor genes belong to the ELL family, locating on chromosome 3 in the human genome, which antagonize the Wnt/β-catenin signaling pathway in different cell lines by suppressing the tumorigenic activity. The change of the expression level of the EAF1 & the EAF2 genes is reported in other cancer types such as intestinal and blood. Here, we investigated the fold change of these mentioned genes in breast cancer (invasive ductal carcinoma: IDC) in Iranian patients. Forty Tumor and marginal normal tissues from breast cancer patients (grade I 16%, grade II 58%, and grade III 25%) were collected during surgery with immediately treatment of RNA later. All selected patients were HER2 positive, with an average age of 56 years old. Seventy percent of affected individuals were ER/PR[1] positive, and the other 30% ER/PR negative. Quantitative analysis of the EAF1 & EAF2 gene expression in two sample groups (tumor & normal) was performed by Real-time-PCR (cyber- green method). The expression of the EAF1 & the EAF2 genes was in tumor tissue compared to normal samples significantly decreased (fold change= -5.7 for the EAF1 gene [p=0.000] & -4.4 for the EAF2 gene [0.034]). Lower expression of the both mentioned genes is apparently associated with negative prognosis of breast cancer.

    [1] ER: estrogen receptor & PR: progesterone receptor

    S. Heydaran: None. M. Moghanibashi Mansurieh: None. S. Naeemi: None.

    E-P12.15 Age depending prevalence of RUNX3, BRCA1 genes comethylation among female breast cancer case

    N. Medvedieva1, O. Lobanova2, Z. Rossokha1, V. Vershyhora1, V. Cheshuk2, R. Vereshchako2, N. Gorovenko3

    1SI Reference Centere For Molecular Diagnostic of Public Health Ministry of Ukraine, Kyiv, Ukraine, 2Bogomolets National Medical University, Kyiv, Ukraine, 3P.L. Shupyk National Academy of Postgraduate Education, Kyiv, Ukraine

    Introduction: Genes comethylation is important pathways of epigenetic mechanisms in the risk of breast cancer development. Hypermethylation of RUNX3 and BRCA1 genes is involved in disrupted oncosuppression process among breast cancer cases. But no so much known about their co-influences on breast cancer (BC) risk in different age. Aim of the study was to evaluate RUNX3, BRCA1 genes age depending comethylation status.

    Materials and methods: Tumor tissue of 52 BC female patients was obtained during surgery. Patients (mean age 53.05 ± 1.86) subdivided depending of age: Group 1 (25-44 years), Group 2 (45-60 years), Group 3 (61-85 years). Obtained tumor was tested for BRCA1 and RUNX3 gene methylation status. Tumor samples saved using DNA/RNA Shield. DNA extracted with Quick-DNA Miniprep Plus Kit. Bisulfide conversion was done by dint of EZ DNA Methylation-Gold Kit. Converted DNA with methyl-specific primers was used for PCR analysis.

    Results: No significant differences were found for RUNX3 gene methylation. Patients of Group 1 had significantly higher methylation status (41.2%) in BRCA1 gene compared to patients of Group 2 (25%) and Group 3 (26.6%), respectively. Comethylation of hypermethylated BRCA1/RUNX3 was significantly prevalence also among Group 1 compared to others (Table).

    Conclusions: Higher hypermethylated BRCA1/RUNX3 genes status was found among young patients (aged 25-44 years). Further careful studies are needed to understand cometylation effect of investigated genes on early breast cancer development.

    Methylation statusRUNX3hypermethylationRUNX3unmethylation
    Group 1 (25-44 years) 17 patients
     BRCA1 hypermethylation41.2%5.9%
     BRCA1 unmethylation41.2%11.7%
    Group 2 (45-60 years) 20 patients
     BRCA1 hypermethylation25%0
     BRCA1 unmethylation60%15%
    Group 3 (61-85 years) 15 patients
     BRCA1 hypermethylation26.6%6.7%
     BRCA1 unmethylation60%6.7%

    N. Medvedieva: None. O. Lobanova: None. Z. Rossokha: None. V. Vershyhora: None. V. Cheshuk: None. R. Vereshchako: None. N. Gorovenko: None.

    E-P12.19 Impact of TP53 (rs1042522) and MDM2 (rs2279744) polymorphisms on cervical intraepithelial lesions and cervical cancer in North Macedonian women

    S. Duvlis1, D. Dabeski2, D. Plaseska-Karanfilska3

    1Institute of public health of Republic of North Macedonia, Skopje, Macedonia, The Former Yugoslav Republic of, 2Clinic for gynecology and obstetrics, Clinical center "Majka Tereza", Skopje, Macedonia, The Former Yugoslav Republic of, 3Research Center for Genetic Engineering and Biotechnology "Georgi D. Efremov", Skopje, Macedonia, The Former Yugoslav Republic of

    Introduction: Variant in cell cycle regulation genes may influenced cervical intraepithelial lesions (CIN) and malignant progression to cervical cancer (CCa). Single nucleotide polymorphisms (SNPs) rs1042522 within the codon 72 of TP53 and rs2279744 within MDM2 promoter genes are plausible factors that could have impact on cervical carcinogenesis conferring increased attenuation of p53 pathway. We investigated the association of these SNPs with the CIN and CCa among women from Republic of North Macedonia.

    Methods: Using a multiplex PCR SNaPShot analysis we genotyped rs1042522 and rs2279744 in 131 women with CIN or CCa and 110 cytologicaly negative women.

    Results: No significant difference in either genotype or allelic frequencies for rs1042522 and rs2279744 between cases and control was found. Stratification of the cases based on grade of the lesion, revealed lower frequency of CC genotype and C allele of rs1042522 in CIN2+ and CCa compared to CIN1 [GG vs CC; p=0.001, OR=0.4; CG vs CC; p=0.04, OR=0.03 and CG+ GG vs CC; p=0.004, OR=0.2]. Furthermore, GG genotype and G allele of rs2279744 showed significantly lower frequency in CIN2+ and CCa cases then in CIN1 [G vs T p=0.02, OR=0.52; GG vs TT; p=0.04, OR=0.29; ТТ vs ТG+GG; p=0.007, OR=0.34].

    Conclusion: The Arg variant of rs1042522 and T allele/TT genotype of rs2279744 are associated with progression of CIN1 to CIN2+ or CCa and may be used as prediction markers in CCa management. Still, clinical importance of these variants warrants further validation in more comprehensive studies.

    S. Duvlis: None. D. Dabeski: None. D. Plaseska-Karanfilska: None.

    E-P12.21 Monitoring circulating tumor DNA in a breast cancer patient to provide real-time cancer progression information

    L. C. Liu1, C. C. Hung2, T. K. Lin2,3, C. W. Yeh4, C. W. Huang4, Y. N. Su2,5

    1Department of Medicine, College of Medicine, China Medical University, Taichung, Taiwan, 2Sofiva Genomics Co., Ltd., Taipei, Taiwan, 3Graduate Institute of Clinical Medicine, College of Medicine, National Taiwan University, Taipei, Taiwan, 4National Center for High Performance Computing, National Applied Research Laboratories, Hsinchu, Taiwan, 5Dianthus Maternal Fetal Medicine Clinic, Taipei, Taiwan

    Background: Liquid biopsy is a mini-invasive test and easy to get specimen for cancer progression information based on circulating tumor DNA (ctDNA). In this study, we analyzed ctDNA dynamics and aim to push liquid biopsy toward clinical practice.

    Method: We used next-generation sequencing (NGS)-based panel assay and molecular barcoding technology to analyze variants in 197 genes. We examined a breast cancer patient after surgery and frequently monitoring of ctDNA.

    Results: In April 2017, ERBB2 c.2264 T>C (2.00%) was detected in ctDNA as well as ERBB2 c.2664 T>C (70.56%) and PIK3CA c.1634 A>C (22.93%) were detected in tissue of the patient. After seven months, ERBB2 c.2264 T>C (9.00%) and PIK3CA c.1634 A>C (0.76%) were detected in ctDNA, and it seems the therapy did not work. The patient was suggested to change other chemotherapy and targeted therapy. Three months later, ERBB2 c.2264 T>C (0.59%), PIK3CA c.1625 A>C (0.04%) and PIK3CA c.1634 A>C (0.07%) were detected in February 2018. Then we follow the cancer genetic status every 1-2 months for the patient with given the same treatment. For ERBB2 c.2264T>C in particular, the mutation rates were shown 0.56%, 0.68%, 1.96% and 3.48%, respectively.

    Conclusion: Using liquid biopsy to monitor ctDNA dynamics after surgery may be helpful for patient to estimate prognosis. The liquid biopsy can be used to monitor treatment effect in patient who receive cancer therapies.

    L.C. Liu: None. C.C. Hung: A. Employment (full or part-time); Significant; Sofiva Genomics, Co., Ltd. T.K. Lin: A. Employment (full or part-time); Significant; Sofiva Genomics Co., Ltd.. C.W. Yeh: None. C.W. Huang: None. Y.N. Su: A. Employment (full or part-time); Significant; Sofiva Genomics Co., Ltd..

    E-P12.24 Analysis of PPARG and UCP2 gene polymorphisms in colorectal cancer patients

    E. M. N. D. Ajaj

    Institute Of Human Genetics, Belgrade, Serbia

    Introduction: Altered lipids metabolism is a hallmark characteristic of colorectal cancer (CRC). Peroxisome proliferator - activated receptor gamma (PPARG) and uncoupling protein 2 (UCP2) act as transcriptional regulators of lipid metabolism. Recent studies have shown that PPARG and UCP-2 could represent biomarkers for prognosis in CRC and possible target for cancer therapy. We aimed to investigate the association between PPARG Pro12Ala (rs1801282) and UCP2 45 bp +3474 ins/del polymorphisms with clinicopathological factors of tumor progression in CRC patients.

    Material and methods: Our study included 160 CRC pateints, mean age 65,39±8.55 years. Among them, there were 98 men (61.3%) and 62 (38.8%) women. PPARG Pro12Ala genotypes were detected by PCR-RFLPs while UCP2+3474 ins/del polymorphism was detected by PCR. all patients, data about tumor location, histologic differentiation, preoperative serum carcinoembryonic antigen level, the presence of lymph node metastases, distant metastases and stage of the disease were recorded.

    Results: Analysis of PPARG Pro12Ala polymorphism has shown that carriers of Pro/Pro genotype had moderately and poorly differentiated tumor cells more frequently than patients with Pro/Ala genotype (p=0.01). Our analysis also revealed that colon cancer was more frequent than rectal in carriers of UCP2 +3474 ins allele (p=0.02). Also, carriers of ins allele had distant metastases more frequently than patients with del/del genotype (p=0.024).

    Conclusion: Our findings indicate that there is an association between PPARG gene Pro/Ala polymorphism and tumor cells differentiation and UCP2 gene +3474 ins/del polymorphism with tumor location and the presence of distant metastases in CRC patients.

    Key words: Colorectal cancer, PPARɣ, UCP2

    E.M.N.D. Ajaj: None.

    E-P12.31 MGMT methylation status in glioblastomas multiforme

    A. V. Antonets, Y. G. Yakovlenko, S. V. Mordanov, A. A. Tushev, V. A. Moldovanov, V. Y. Deribas, S. S. Todorov

    Rostov Medical State University, Rostov-on-Don, Russian Federation

    Introduction: Epigenetic silencing of the methyl-guanine methyl transferase (MGMT) gene promoter by gene promoter methylation suggests a partial inability of the tumour to repair the chemotherapyinduced DNA damage. In retrospective analyses, MGMT methylation has been correlated with a response to or benefit predictive value of a methylated MGMT status for response to or benefit from alkylating agent chemotherapy and thus improved outcome has been demonstrated repeatedly in glioblastomas. Moreover, MGMT methylation identifies a sub-population with a better prognosis irrespective of the applied treatment.

    Materials and methods: We examined 10 patients with the diagnosis of glioblastoma multiforme treated in the neurosurgical department and have observed them within 12 months by present. DNA was extracted from freshly frozen tumor tissue. Detection of the MGMT gene hypermethylation was carried out with methyl-specific real time PCR.

    Results: Hypermethylation of the MGMT gene was detected in 4 patients. We have not observed relapse in patients with hypermethylation by 12 months from surgery. One patient with unmethylated secondary glioblastoma multiforme after anaplastic astrocytoma had died.

    Conclusion: In light of emerging human genetic and molecular knowledge, molecular diagnosis of oncological diseases might help in the establishment of prognosis and personalized treatment for patients and improve life quality.

    A.V. Antonets: None. Y.G. Yakovlenko: None. S.V. Mordanov: None. A.A. Tushev: None. V.A. Moldovanov: None. V.Y. Deribas: None. S.S. Todorov: None.

    E-P12.35 BRCA1 and BRCA2 pathogenic variants spectrum in patients with hereditary breast and ovarian cancer syndrome

    M. Šukys, V. Ašmonienė, D. Čereškevičius, I. Nasvytienė, I. Valančiūtė

    Department Of Genetics And Molecular Medicine, Medical Academy, Lithuanian University of Health Sciences, Kaunas, Lithuania, Kaunas, Lithuania

    Introduction: Hereditary breast and ovarian cancer syndrome is one of the most common cancer susceptibility syndromes, affecting 1 of 1600 women. Affected patients harbor pathogenic variant in BRCA1 or BRCA2 genes, which increases lifetime risk for women of developing breast or ovarian cancer to nearly 80%, for men breast cancer - 8%. Detection of such variant allows early screening and monitoring for better cancer management.

    Methods: We report BRCA1 and BRCA2 analysis results of the Hospital of Lithuanian University of Health Sciences Kauno Klinikos from year 2015 till 2019. Analysis was performed for patients who were at increased risk of having BRCA1/2 genes pathogenic variants according to the local laws. Analysis was performed in two steps: firstly, it was analyzed with pyrosequencing kit for 6 common variants. Later, If needed, analysis on Sanger sequencing or Next generation sequencing for coding genes regions was continued.

    Results: BRCA1 and BRCA2 analysis for 6 common pathogenic variants was performed for 1737 patients (including familial BRCA1 and BRCA2 variant cases). Pathogenic variant was found for 12,95 % patients. Coding region sequencing was performed for 647 cases, as other patients testing is still ongoing, 10 % pathogenic variants were found. From all pathogenic variants, most frequent were BRCA1: c.4035delA 43,4 %; c.5266dupC - 23,1%; c.181T > G - 10%; BRCA2: c.657_658delTG 4,8%.

    Conclusion: The c.4035delA might be the most frequent variant in Lithuania, whereas in neighboring countries c.5266dupC is more common

    M. Šukys: None. V. Ašmonienė: None. D. Čereškevičius: None. I. Nasvytienė: None. I. Valančiūtė: None.

    E-P12.37 The case of Hutchinson-Gildford Syndrome associated with G608G mutation in LMNA gene and Methylenetetrahydrofolate reductase deficiency

    Y. Hrechanina, L. Molodan

    Interregional Specialized Medical Genetic Center - Center of Rare (Orphan) Diseases, Kharkiv National Medical University, Kharkiv, Ukraine

    Introduction: Hutchinson-Gildford Syndrome (HGS) is an orphan disease from the group oncogenetic syndromes. The disease is based on a point mutation in Lamin A LMNA (1q21 / 2) gene, which leads to splicing disorder.

    Materials and methods: HGS was diagnosed in 3 patients aged 4.5 to 8 years. Classic and modern technologies were used.

    Results: Patient I., 4.5 years old with physical development delay, progeric skin and hair changes, prominent brain skull over facial, pronounced expanded venous network, microangiopathy. Progeric changes increase, the subcutaneous fat layer disappears, the skin becomes thin, dry patches of stretched skin alternate with patches sclerotic changes, alopecia develops, expansion of superficially located vessels. Molecular genetic analysis: a mutation in the LMNA gene (G608G). Pathology had a progressive course and manifested against of methylenetetrahydrofolate reductase deficiency. Biomarkers: glucose - ↓, lactate - ↑, cholesterol - ↑↑, LDL cholesterol - ↑, VLDL cholesterol - ↑↑, atherogenic coefficient - ↑↑↑, homocysteine - ↑↑ The comorbid pathology was diagnosed: a combination of HGS associated with mutation in the LMNA gene (G608G), methylenetetrahydrofolate reductase deficiency, hyperhomocysteinemia, lipid metabolism disorder. Therapy: positive dynamics was noted - skin condition improved, decreased dryness, skin became more elastic, hair growth appeared.

    Conclusions: Search for metabolic disorders, clarification of their nature in the case of a combination of HGS with methylenetetrahydrofolate reductase deficiency have allowed to develop individual tactics of patient management taking into account revealed disorders, the correction has reduced clinical disease manifestations, improved the quality of life of the patient and family.

    Y. Hrechanina: None. L. Molodan: None.

    E-P12.40 KRAS, NRAS, BRAF mutation spectrum in Georgian patients with metastatic colorectal cancer

    D. Agladze1,2,3, S. Iordanishvili4, L. Margvelashvili4,3, E. Kldiashvili4, O. Kvlividze1,5

    1School of Medicine, New Vision University, Tbilisi, Georgia, 2Research Institute of Clinical Medicine, Tbilisi, Georgia, 3Pediatric Surgery Center (KidCo), Tbilisi, Georgia, 4Petre Shotadze Tbilisi Medical Academy, Tbilisi, Georgia, 5Georgian Foundation for Genetic and Rare Diseases (GeRaD), Tbilisi, Georgia

    Introduction: According to the NCDC data Colorectal Cancer (CRC) is the fifth among most common malignancy in Georgian population. In 2019 326 new cases of CRC have been registered. Testing CRC for mutations in KRAS, NRAS, BRAF genes are common in most countries to determine resistance to anti-EGFR therapy.

    Aim of the study: To detect most common mutations in KRAS, NRAS, BRAF genes of metastatic CRC cells in Georgian patients affected with mCRC and to compare the data with the results of similar studies in other countries.

    Materials and methods: Study was made in Georgian population. Inclusion criteria was the morphologically diagnosed mCRC. DNA was extracted from 111 patients FFPE Tissue. KRAS (exon 2,3,4), NRAS (exon 2,3,4) and BRAF (exon15) were amplified. For mutations detection Sanger Sequencing method has been used.

    Results: Analyzing data showed that in 111 tested patients mutation was detected in 21.6% cases. KRAS exon2 mutation was detected in 18.9% cases, NRAS ex4 mutation in 0.9%, BRAF ex15 mutation in 1.8%. There was no mutation detected in KRAS ex 3 and 4 and NRAS ex2 and 3. From overall 24 detected mutations most common mutations are KRAS ex2 G12D 37.5%, G12V 25%, G12C 20.8%, G13D 4.1% and BRAF Ex15 V600E 8.3%.

    Conclusions: The study of 111 Georgian patients affected with mCRC showed that the most common mutations in KRAS gene is G12D, followed by the same codon mutations G12V and G12C. Similar studies already conducted in different countries in patients affected with mCRC showed the similar results.

    D. Agladze: None. S. Iordanishvili: None. L. Margvelashvili: None. E. Kldiashvili: None. O. Kvlividze: None.

    E-P12.41 Aberrant methylation of CDH13 and RASSF1 as classifiers of muscle-invasive, high grade bladder cancer.

    M. Pietrusinski1, E. Borkowska1, M. Constantinou1, Z. Jablonowski2, J. Salamunia1, M. Borowiec1

    1Medical University of Lodz, Department of Clinical Genetics, Lodz, Poland, 2Medical University of Lodz, 1st Clinic of Urology, Lodz, Poland

    Introduction: The mortality among men due to bladder cancer is approximately twice as high in Poland as in other European countries. Bladder cancer is a result of multistep accumulation of genetic and epigenetic alterations and exposure to environmental factors. Aberrant methylation of CpG islands has been recognized as a potential early biomarker of carcinogenesis. Additionally, these changes affect tumor stage and grade, which may have an impact on the choice of the right treatment method.

    Materials and methods: We aimed to investigate the methylation profiles of selected tumor suppressor genes to find out whether aberrant methylation can be significantly correlated with tumor stage and/or grade. Tumor DNA from carefully selected 44 patients diagnosed with NMIBC and MIBC was analyzed. Methylation profiles were examined by MS-MLPA technique. The capillary electrophoresis method provided data for calculating the percentage of methylation of particular genes. A value above 15% was considered as a positive result.

    Results: Among the analyzed genes, the most frequently hypermethylated genes were CDH13, APC and RARβ. RASSF1 methylation showed a significant correlation with the invasive stage. Hypermethylation of CDH13 (AUC = 0,75) and RASSF1 (AUC = 0,67) has been statistically significantly associated with the histological high-grade bladder cancer and both genes are good classifiers for this condition.

    Conclusions: This study confirms the association of CpG island methylation of CDH13 and RASSF1 with bladder cancer and suggests its potential role in the assessment of bladder cancer aggressiveness. Medical University of Lodz Grant No. 502-03/2-159-02/502-24-305.

    M. Pietrusinski: None. E. Borkowska: None. M. Constantinou: None. Z. Jablonowski: None. J. Salamunia: None. M. Borowiec: None.

    E-P12.44 A retrospective study of patients with Multiple Myeloma tested in Laboratory of Medical genetics, Varna, Bulgaria

    V. Miteva, T. Ruseva, M. Hachmeriyan, M. Levkova, L. Angelova

    Medical University Varna, Varna, Bulgaria

    Introduction: Multiple myeloma (MM) is a clonal bone marrow disease of B-cells, at the last stage of differentiation and is the second most common hematologic neoplasia. MМ is a heterogeneous disease characterized by very complex cytogenetic and molecular genetic aberrations.

    Materials and methods: We performed a retrospective review of patients with MM referred to Laboratory of Medical Genetics, Varna, Bulgaria between 2017 and 2019. Bone marrow (BM) samples of 65 patients with MM at different stages of the disease were evaluated for cytogenetic analyses and 19 of them for interphase fluorescent in situ hybridization (iFISH). Chromosomes were classified according to the International System for Human Cytogenetic Nomenclature 2016 (ISCN 2016). FISH was performed on BM samples and 200 interphase nuclei were evaluated per sample. The iFISH was performed using commercially available probes (Kreatech TM FISH probes) for the detection of two oncohaematological markers: deletions of 17p13 (TP53) and rearrangements involving immunoglobulin heavy chain (IGH) region on 14q32 chromosome.

    Results: Cytogenetic analysis was successful in 57 of the 65 patients (87.7%). Six patients out of these 57 (9.23%) had different abnormal karyotypes sustainable with the diagnosis MM.iFISH analysis was successful in all 19 patients. Deletion del17p13 was detected in seven patients (36.84%) and rearrangements involving 14q32 in one (5.26%).

    Conclusion:The detection of chromosomal abnormalities in MM by conventional cytogenetics is limited due to the low mitotic index of malignant plasma cells. This disadvantage can be overcome with the use of FISH, which can detect specific target arrangements and chromosomal copy number changes.

    V. Miteva: None. T. Ruseva: None. M. Hachmeriyan: None. M. Levkova: None. L. Angelova: None.

    E-P12.45 Matrix metalloproteinases expression level in patients with oesophageal squamous cell carcinoma

    S. Rakhimova1, U. Kozhamkulov1, A. Sharip1, A. Molkenov1, Y. Zhukov2, M. Omarov2, M. Tuleutaev2, U. Kairov1, A. Akilzhanova1

    1National Laboratory Astana, Nazarbayev University, Nur-Sultan, Kazakhstan, 2Oncology center, Nur-Sultan, Kazakhstan

    Introduction: More than 80% of oesophageal cancer cases occur in developing countries, Central and East Asia countries and the prevalent type is oesophageal squamous cell carcinoma (ESCC). The aim of our study was to analyse of major genes, anticancer drug targets based on whole transcriptome sequencing data for Kazakhstani patients.

    Materials and methods: Tissue samples were collected from 25 ESCC-affected patients immediately after Ivor-Lewis esophagectomy in Oncology Center. Whole transcriptome sequencing was performed regarding the TruSeq RNA Protocol. STAR software and DESeq2 package have been used for mapping and defining differentially expressed genes.

    Results: 25 male and female (14 and 11 respectively) patients with ESCC were recruited for study. Average age of patient was 65.5±7.7 years diagnosed with ESCC stages T1-T4. Expression level of 24 genes, targets of the main antitumor drugs was investigated in our research. Overexpression of metalloproteinase genes MMP1, MMP9, MMP10 during cancer progression (stages 2-4) was significantly found among patients with T2, T3 stages of ESCC (p-value<0.05). MMP1, MMP9 and MMP13 genes identified as up-regulated in patients with T4 stage (p-value<0.05). According recent publications matrix metalloproteinases is frequently up-regulated and correlates with vascular invasion, metastasis and poor outcomes among patients with ESCC.

    Conclusion: Our research study showed that metalloproteinase genes (MMP1, MMP9, MMP10 and MMP13) were overexpressed among patients with ESCC. Further research will be continued and additional validation of findings will be performed.

    Grant reference: #AP05134722, #AP05135430 and #AP05136106 MES

    S. Rakhimova: None. U. Kozhamkulov: None. A. Sharip: None. A. Molkenov: None. Y. Zhukov: None. M. Omarov: None. M. Tuleutaev: None. U. Kairov: None. A. Akilzhanova: None.

    E-P12.56 Resveratrol can miss laryngeal squamous cell carcinoma cells from immune response

    B. Goksel Tulgar1, M. E. Sarı1, G. Turkoglu1, F. Duymus1, D. Esin1, E. Marzioglu Ozdemir2, T. Cora1

    1Selcuk University Faculty of Medicine, Medical Genetics Department, Konya, Turkey, 2Konya Education and Research Hospital, Genetic Diseases Diagnosis Unit, Konya, Turkey

    The epidermal growth factor receptor (EGFR) is a receptor tyrosine kinase that mediates intracellular signals in response to various extracellular stimuli. Previous studies have been shown that EGFR is activated and overexpressed in many types of human epithelial cancer. In a limited study on epithelial cancer cells, resveratrol has been shown to have an inhibitory effect on EGFR tyrosine kinase activity in vitro. Programmed death-ligand 1(PD-L1) is normally expressed in healthy cells, is also expressed in cancer cells during cancer development and leads to the concealing of cancer cells from the immune system. In this study, we aimed to investigate the effect of resveratrol on EGFR and PDL-1 in Laryngeal squamous cell carcinoma cells(HEP2), which is epithelial cancer. We cultivated HEP2 and HEK293 (human embryonic kidney cell) cell lines as a control cell line. We determined the IC50 value as 100 uM. EGFR, MYC, and PD-L1 gene expression levels were evaluated by gene expression studies. GAPDH and ACTB genes were identified as housekeeping genes. As a result of the study, gene expression relative change levels for EGFR, MYC, and PD-L1 were determined as 1.145, 0.475, 2.695, respectively. According to these results, resveratrol did not cause a significant change in EGFR and MYC expression levels in the LSCC cell line, while it significantly increased PD-L1 levels. It has been found interesting because the resveratrol, which is normally included in the literature as an anticancer, increases levels of PD-L1 because it is likely to support escape from the immune response.

    B. Goksel Tulgar: None. M.E. Sarı: None. G. Turkoglu: None. F. Duymus: None. D. Esin: None. E. Marzioglu Ozdemir: None. T. Cora: None.

    E-P12.57 Investigation of retroelement activity in childhood leukemia

    S. Z. Urazbakhtin1, M. V. Saliutina1, G. A. Nugmanov1, Y. B. Lebedev1, A. Y. Komkov1, Y. V. Olshanskaya2, E. A. Zerkalenkova2, I. Z. Mamedov1

    1Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry of Russian Academy of Science, Moscow, Russian Federation, 2Dmitry Rogachev National Medical Research Center Of Pediatric Hematology, Oncology and Immunology, Moscow, Russian Federation

    Introduction: Retroelements (RE) are interspersed repeats that comprise a sufficient part of the human genome. The majority of them are currently inactive but functional copies can be a source of genetic instability associated with some types of cancer. Currently, there is very limited data about retrotranspositions in hematological malignancies. In this study we perform analysis of RE activity in childhood acute lymphoblastic and acute myeloblastic leukemia.

    Materials and methods: Digested DNA obtained from paired tumor/normal samples was ligated to adapters with Unique Molecular Identifiers. Primers specific to young RE were used to selectively amplify sequences flanking RE insertions in the genome. These sequences were used to identify new insertions by custom pipeline. To test method sensitivity, we prepared a mixture of cells from 4 healthy donors, with different cell concentrations.

    Results: Polymorphic RE insertions, distinguishing donors from each other, were used to determine method’s sensitivity. We were able to detect 95% of insertions of a person, whose cells comprised 1% of the mixture at sequencing depth of 2,000,000 reads per Alu library and 300,000 per for L1 library. Using our method and pipeline we analyzed 14 T-ALL, 34 B-ALL and 18 AML paired tumor/normal samples.

    Conclusion: We designed a sensitive method and sophisticated pipeline for tumor-specific RE insertion detection in as little as 1% of cells. The developed method was the first to evaluate RE activity in childhood leukemia.

    Funding: This work was supported by RSF18-14-00244 grant.

    S.Z. Urazbakhtin: None. M.V. Saliutina: None. G.A. Nugmanov: None. Y.B. Lebedev: None. A.Y. Komkov: None. Y.V. Olshanskaya: None. E.A. Zerkalenkova: None. I.Z. Mamedov: None.

    E-P12.58 Somatic Variant Interpretation in TET2 using two distinct next generation sequencing platforms

    H. Saat1, M. Say2, T. Bahsi3,4, S. Sevinc5

    1Ankara Dıskapı Yıldırım Beyazıt Training and Research Hospital, Department of Medical Genetics, Ankara, Turkey, 2Gen Era Diagnostics, Bioinformatics Department, Istanbul, Turkey, 3Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital, Department of Medical Genetics, Ankara, Turkey, 4Ankara Provincial Health Directorate, Central Genetic Laboratory, Ankara, Turkey, 5Gen Era Diagnostics, Application Department, Istanbul, Turkey

    Evans Syndrome is a rare autoimmune disorder in which the immune system produces antibodies that destroy erythrocytes, platelets and/or certain leukocytes. The patients may have different symptoms related to the type and extend of blood cells affected. The most common symptoms include hemolytic anemia and thrombocytopenia. Similarly, some database is included same phenotype knowledge for Myelodysplastic Syndrome. Herein, we have analyzed the DNA sample extracted from whole blood of a 19-year-old male with an initial diagnosis of Evans Syndrome starting from the age of 10. Next generation sequencing (NGS) was performed using Clinical Exome Solution (CES) of Sophia Genetics on the on the Illumina NextSeq 550® platform. has been analyzed for using. Through analysis of the CES data for single nucleotide and copy number variations has revealed a frameshift variant at TET2 gene with a variant fraction of only 6% in 120 reads. We have therefore decided to validate this result using the same biospecimen in an alternative platform, namely Archer®Myeloid dedicated for somatic variant analysis. Accordingly, the identical variant was confirmed using the Archer platform with 13% variant fraction in 744 reads. Somatic mutations in TET2 encoding Tet methylcytosine dioxygenase 2 has been reported to be associated with myelodysplastic syndrome (MDS). MDS refers to a heterogeneous group of closely related clonal hematopoietic disorders characterized by ineffective hematopoiesis resulting in low blood counts and possibility of developing acute myeloid leukemia. The variant identified in TET2 can be considered as somatic and may aid correct diagnosis and treatment for the patient.

    H. Saat: None. M. Say: None. T. Bahsi: None. S. Sevinc: None.

    E-P12.60 A novel de novo splicing mutation in the TSC2 gene causes exon in a patient with tuberous sclerosis syndrome

    P. Gerasimou1, A. Miltiadou1, I. Kyprianou1, J. Chi1, V. Anastasiadou2, P. Costeas1

    1Molecular Hematology-oncology, Karaiskakio Foundation, Nicosia, Cyprus, 2Department of Clinical Genetics, Archbishop Makarios III Medical Centre, Nicosia, Cyprus

    Introduction: Tuberous sclerosis complex is an autosomal dominant disorder characterized by hamartomas in multiple organ including the brain, skin, heart and kidneys among other complications. Approximately 10 to 30% of cases are due to mutations in the TSC1 gene. TSC2 gene mutations frequency is consistently higher and are associated with more severe phenotype.

    Case Description: Newborn with prenatal diagnosis of heart tumor. Suspected Tuberous Sclerosis.

    Methodology: A custom HaloPlexHS (Agilent) NGS panel was used to investigate mutations in Syndromic associated genes as per manufacturer’s instructions. Sanger sequencing performed for parental carrier status and RNA investigation for exon skipping.

    Interpretation: A heterozygous novel splice-site mutation in the TSC2 gene was detected in the patient sample. The c.139-2A>T (NM_000548.5) mutation is located two nucleotides from the splice acceptor site between exons 2 and 3 of the TSC2 gene. It is classified as pathogenic according to ACMG recommendations and Bioinformatics tools predicted that this novel mutation have pathogenic effects on splicing machinery. RNA investigation revealed that this variation leads in exon 3 skipping. Parental testing showed that this is a de novo mutation in the patient as neither of the parents were carriers.

    Conclusion: More than 1,100 mutations in the TSC2 gene have been identified in individuals with tuberous sclerosis complex. This study highlighted the presence of a novel de novo splicing mutation in the TSC2 gene that leads in exon 3 skipping and is responsible for the loss of 29 amino acids, which causes the production of an aberrant protein isoform.

    P. Gerasimou: None. A. Miltiadou: None. I. Kyprianou: None. J. Chi: None. V. Anastasiadou: None. P. Costeas: None.

    E-P13 Genome Variation and Architecture

    E-P13.3 Copy number losses of 11p14.3-p13 and 11p13-p12 detected by CGH array revealed to be heterozygous deletion of 11p14.3-p12 on one chromosome 11 and heterozygous duplication within 11p13 on the other chromosome 11 by metaphase FISH analysis

    K. Wakui1,2, T. Kosho1,2, Y. Fukushima1,2

    1Department of Medical Genetics, Shinshu University School of Medicine, Matsumoto, Japan, 2Center for Medical Genetics, Shinshu University Hospital, Matsumoto, Japan

    Introduction: Wilms tumor-Aniridia-Genitourinary abnormalities-growth and mental Retardation (WAGR) syndrome/11p13 deletion syndrome is a rare genetic condition associated with contiguous-gene deletions including PAX6 and WT1. An 8-month-old boy with aniridia and his parents were analyzed for possible genomic variations.

    Methods: Cytogenomic microarray testing using a CGH array (135K [hg18], Roche NimbleGen) was performed to evaluate copy number variations (CNVs). We employed metaphase FISH analyses using selected BAC clones to identify the chromosomal rearrangements related to the CNVs.

    Results: Copy number losses of 11p14.3-p13 (chr11:25,784,386-32,872,519; 7.1 Mb) including the PAX6 and WT1 genes and of 11p13-p12 (chr11:33,555,357-42,819,900; 9.3 Mb) were detected by the CGH array in the patient. And the FISH signals of the probes mapping the normal copy number region between the two copy number loss regions were absent in the abnormal chromosome 11, as were the probes mapping the distal and proximal copy number loss regions. Additional microarray analyses of the parents uncovered a copy number gain of 11p13 (chr11:32,910,676-33,522,409; 0.6 Mb) in the mother.

    Conclusion: Comprehensive genomic evaluation of a case of WAGR syndrome ultimately revealed a heterozygous deletion of 11p14.3-p12 (chr11:25,784,386-42,819,900; 17.0 Mb) on one chromosome 11 and a heterozygous duplication of a part of 11p13 (chr11:32,910,676-33,522,409; 0.6 Mb) on the other chromosome 11. Metaphase FISH analysis is indispensable in clarifying exact chromosomal rearrangements while distinguishing between homologous chromosomes.

    K. Wakui: None. T. Kosho: None. Y. Fukushima: None.

    E-P13.4 Identification of unsolved rare genetic cases of North Cyprus

    M. C. Ergoren1, E. Manara2, S. Paolacci2, G. Tuncel3, S. G. Temel4, G. Mocan1, M. Dundar5, M. Bertelli6

    1Near East University, Faculty of Medicine, Nicosia, Cyprus, 2MAGI Euregio, Bolzano, Italy, 3Near East University, DESAM Institute, Nicosia, Cyprus, 4Bursa Uludag University, Faculty of Medicine, Bursa, Turkey, 5Erciyes University, Faculty of Medicine, Kayseri, Turkey, 68MAGI’s LAB S.r.l., Roverato, Italy

    Cyprus, which is the third largest island in the Mediterranean Sea, has been at the crossroads of multiple civilizations throughout human history. Today, the Turkish Cypriots and the Greek Cypriots constitute two major ethnic groups in Cyprus, along with some minor groups. Even though Turkish-Cypriot paternal lineages have an autochthonous quality, some Y-DNA haplotypes are shared between the Turkish Cypriots and the Greek Cypriots. It should be no surprise that the genetic characteristics of the current Turkish-Cypriot population have been determined by the interactive forces of migrations, admixture, genetic drift, etc. We aimed at elucidating the path from the interesting or unusual clinical phenotypes of rare diseases to potentially novel gene variants. In the present study, the most recent high-throughput genomic technologies were employed to study the genetic etiology of such diseases. Accordingly, WES was used to sequence trios. As a result, we identified a number of novel population-specific gene variants, each of which causes rhizomelic chondrodysplasia punctate type 5, Wiedeman-Rautenstrauch Syndrome, tricho-rhino-phalangeal syndrome type 1, Joubert syndrome, etc. Lack of genetic databases in the region of middle eastern, the laboratory set up the capacity to produce DNA sequence data expands the number of contributors to DNA sequence databases, which is beneficial for science and may be helpful for any number of bioinformatic analyses. Overall, this study emphasizes the importance of revealing rare-disease-causing variants in a particular population for immediate use in accurate diagnosis, for improved understanding of the underlying molecular mechanisms and for developing effective preventive medicine strategies.

    M.C. Ergoren: None. E. Manara: None. S. Paolacci: None. G. Tuncel: None. S.G. Temel: None. G. Mocan: None. M. Dundar: None. M. Bertelli: None.

    E-P13.5 Parallel analysis of next generation sequencing data for small nucleotide and copy number variations and a follow-up approach using SNP array genotyping detect a biallelic variant in TBX1 gene

    F. K. Colak1, M. Say2, M. A. Dülger3, B. B. Turan3

    1Dr. Sami Ulus Obstetrics and Gynecology, Children Health and Disease Training and Research Hospital, Department of Medical Genetics, Ankara, Turkey, 2Gen Era Diagnostics, Bioinformatics Department, Istanbul, Turkey, 3Gen Era Diagnostics, Application Department, Istanbul, Turkey

    Next-generation sequencing (NGS) platforms with dedicated software are increasingly being used to identify copy number variations (CNVs) along with single nucleotide variants (SNVs) simultaneously. Array-based technologies including SNP genotyping has been be employed in parallel to NGS for further characterization of the CNV event. Such combined approaches may resolve challenging cases in medical genetics especially for recessive conditions when one copy of the gene is deleted while the other copy carries a pathogenic CNV. Herein, we have adopted Clinical Exome Solution (CES) of Sophia Genetics in a patient with an initial diagnosis of Pierre Robin syndrome. The capture-based target enrichment kit has enabled us to cover approximately 4490 genes. Sequencing was performed on the Illumina Next Seq 550® platform. Sophia DDM platform was used as a interface to evaluate SNVs and CNVs. HumanCytoSNP-12 v2.1 Bead Chip Kit at Illumina SNP array platform was used for follow-up detection of CNV events. Analysis of NGS data for CNV events has revealed one copy loss at chromosome 22q11 including the gene TBX1. The loss had exactly the same boundaries as deduced from SNP genotyping. Although, haploinsufficiency of TBX1 is associated with DiGeorge syndrome, we have interestingly identified a novel missense pathogenic SNV in TBX1 in the NGS data. Combined analysis of CNV events in NGS and SNP array platforms has enabled us to identify a deletion involving the TBX1 gene in a patient. We propose that the SNV identified in the nondeleted copy may explain the phenotypic variability associated with TBX1 deletions.

    F.K. Colak: None. M. Say: None. M.A. Dülger: None. B.B. Turan: None.

    E-P14 Cytogenetics

    E-P14.01 Both 17q12 duplication and deletion detected in the patient with normal phenotype and their segregation in family with variably affected members

    H. Zunova, M. Stolfa, T. Rasplickova, D. Novotna, M. Vlckova

    DBMG, 2nd Faculty of Medicine Charles University and University Hospital Motol, Prague, Czech Republic

    Chromosomal band 17q12 is a gene rich region flanked by segmental duplications which make the region prone to deletions and duplication by NAHR mechanism (non-allelic homologous recombination). While the deletions cause well described clinical unit with specific phenotype called RCAD (renal cyst and diabetes mellitus), the phenotype caused by reciprocal duplications of the same region still remains unclear especially due to variable expressivity and incomplete penetrance and fact, that they are often detected in healthy patients. Here we present unusual case of family where the mother is carrier of duplication (paternally inherited) and also deletion (inherited from mother with RCAD) of the identical 17q12 region. All of her children were diagnosed with 17q12 microduplication syndrome. Except of the mother and grandfather, all her children carrying duplication express variable degree of neurodevelopmental problems, such as epilepsy, mild intellectual disability, delayed speech development or attention deficit disorder, that correlate with the hypothesis of incomplete penetrance and variable phenotype published by many studies. As a potential causative genes are considered LHX1 for neurodevelopmental problems and gene ACACA for epilepsy. The simultaneous occurrence of deletion and duplication of the same chromosomal region in one family is very rare. This case supports hypothesis that 17q12 duplications are stable and may segregate in a family for several generations. Supported by: 00064203, NF-CZ11-PDP-3-003-2014, AZV17-29423A

    H. Zunova: None. M. Stolfa: None. T. Rasplickova: None. D. Novotna: None. M. Vlckova: None.

    E-P14.05 Duplication of 10q22.2q23.1 as a cause for severe hypotonia in a child

    G. Ilieva, E. Sukarova-Angelovska, D. Nestoroska, S. Naunova-Timovska, M. Pesevska, V. Anastasovska

    University Pediatric Clinic, Skopje, Macedonia, The Former Yugoslav Republic of

    Introduction: Array comparative genomic hybridization (aCGH) technique enables high-resolution screening of the genome for segmental genomic copy number variations (CNVs). The technique today represents an unsurpassed tool for detecting minor chromosomal aberrations in children with expressed pathological clinical features, such as hypotonia, dysmorphia, motor and mental delay.

    Materials and methods: aCGH analysis was performed in a child with clinical signs of dysmorphia and severe hypotonia using the Affymetrix® CytoScanTM 750K Array (Applied Biosystems). Each array was consisted of 200 k SNP and 550 k non-polymorphic markers. The data was analysed and interpreted using Chromosome Analysis Suite (ChAS) Software (v4.0).

    Results: 7-month-old child had hypotonia, was unable to hold his head, to sit and did not develop fine motor skills. The clinical conditions included asthenia, frequent respiratory infections and atypical convulsion. Dysmorphological features followed wide forehead, protruded eyes, long eyelashes, triangular face, slender extremities and diminished fat tissue. Karyotype results were typical for a normal male (46, XY). The array CGH analysis revealed a pathological microduplication of a 10q segment - arr 10q22.2q23.1(75,709,593-80,912,470)x3 that was 5230 kb long and includes 44 genes.

    Conclusion: Application of array Comparative Genomic Hybridization (aCGH) in patient with severe hypotonia, dysmorphia and neurological disability represents a great diagnostic marker compared to conventional karyotyping. The results suggest that the main reason for the various clinical and dysmorphological features of the child has genetic background. Keywords: array Comparative Genomic Hybridization, karyotype, dysmorphia, hypotonia

    G. Ilieva: None. E. Sukarova-Angelovska: None. D. Nestoroska: None. S. Naunova-Timovska: None. M. Pesevska: None. V. Anastasovska: None.

    E-P14.07 Chromosome instability index: a potential human cancer biomarker?

    T. Sylaidy1, E. Lialiaris2, T. S. Lialiaris3

    1Demokritus University of Thrace, Dept of Mol. Biology and Genetics, Alexandroupolis, Greece, 2Aristotle University of Thessaloniki, Dept of Biology, Thessaloniki, Greece, 3Demokritus University of Thrace, Medical School, Dept of Genetics, Alexandroupolis, Greece

    Introduction: Chromosome Instability Index (CII) is a biomarker that has been remarkably increased in cancer patients and it consists of three parameters: Sister Chromatid Exchange (SCE) frequencies, Proliferating Rate Index (PRI) and Mitotic Index (MI). The most important of the above is SCEs because they showed the most significant difference between patients and controls. The aim of the study was to investigate the CII as possible biomarker in different types of cancer.

    Material and Method: We used our data of the SCE methodology as it is a simple, sensitive and rapid detection technique used to evaluate chromosomal fragility. Increased SCEs mean increased unspecific damage to the DNA molecule, which was caused by various mutants in lymphocyte cultures.

    Discussion: A significant alteration in both SCE frequency and PRI was observed in patients with different types of cancer, such as breast and stomach cancer or leukemia. Specifically, SCEs in cancer patients were almost twice than in controls. Additionally, as far as PRI is concert, there was a significant reduction in cancer patients compared to normals. We believe that, the co-calculation of SCEs, PRIs and MIs in an index, can predict the chromosomal instability in human cancer. So, CI Index was created as CI=20*SCEs+10*(3-PRI)+2/10*(60-MI). From the results it is revealed that CII (cancer)>>CII (control).

    Conclusions: The results of the present study demonstrate that SCEs can offer reliable results for the studies of chromosome instability and so CII could be used as biomarker for cancer and this is of great importance in premature diagnosis.

    T. Sylaidy: None. E. Lialiaris: None. T.S. Lialiaris: None.

    E-P14.08 Genotoxicity of thimerosal and paracetamol in human lymphocyte culture Genotoxicity of thimerosal and paracetamol in human lymphocyte culture

    M. Mackic-Djurovic1, D. Klepo2, H. Nefić2, D. Rukavina3

    1Center for Genetics, Sarajevo, Bosnia and Herzegovina, 2Faculty of Natural Science and Mathematics, Sarajevo, Bosnia and Herzegovina, 3Veterinary Faculty, Sarajevo, Bosnia and Herzegovina

    Introdaction: Although its use has been reduced, thimerosal is still present as conservans in multidose containers of some vaccines or as a trace from pathogen inactivation process in vaccines production. Paracetamol, as widely used analgoantipyretic, is most often used for treatment of postimunisation pirexy. Profilactic use of paracetamol upon vaccination is still present, despite the fact that in this cases paracetamol decrease immune response on some vaccines.

    Materials and methods: Blood samples of three healthy donors were included in the study. Tested substances were added 24 hours after culture were started and following concentration were examined: thimerosal (1 µg/ml and 0.5 µg/ml), paracetamol 20 µg/ml, thimerosal with paracetamol (0,5 µg/ml/20 µg/ml and 0.5 µg/ml/ 20 µg/ml). Cultivations were lasted for 72 hours, and analysys of structural chromosomes aberations was performed.

    Results: Results shown that frequency of chromosomal structural aberation was significantly incresed in all tretaed cultures in comparission with negative control. Number of chromosomal structural aberations was highest in culture treated with 1 µg/ml of tiomersal. In cells treated with thiomersal 1 µg/ml with presence of 20 µg/ml of paracetamol, the number of aberation was significatly decreased.

    Conclusion: It is shown induction of chromosomal structural aberation as sign of genotoxicity for examined concentration of thimerosal and paracetamol and their common treatment of lymphocites cultures. Suppresing effect of paracetamol on thimerosal genotoxicity in lymphocytes culture treated with 1 µg/ml of thimerosal was shown as indicative for furter examination of paracetamol use in prevention of genotoxicity.

    M. Mackic-Djurovic: None. D. Klepo: None. H. Nefić: None. D. Rukavina: None.

    E-P14.09 Genetic diagnosis of true hermaphroditism; case report in an Angolan patient

    N. Calumbuana1, C. Correia2, I. C. Capuepue1, J. C. V. D. Van-Dúnem1, M. M. P. Chimpolo1

    1Faculdade de Medicina da UAN, Luanda, Angola, 2SynlabHealth Medical Genetics, Porto, Portugal

    Introduction: The present work reports a case of marked gynecomastia, ambiguous genitalia and female body fat distribution in a young boy of 14 years of age with no family history of hermaphroditism. Scan tests have shown the presence of a uterus and a right ovary. Laboratory exams (FSH, LH and Testosterone levels) were also added to the clinical investigation.

    Objectives: To report the case of a genetic diagnosis of an individual with sex differentiation disorder, seen by a urology consultant in Luanda.

    Materials and methods: Initially, sexual markers were analysed by capillary electrophoresis followed by conventional cytogenetic analysis. 200 nuclei were analysed by FISH with a probe for the SRY gene and another for the X chromosome centromere for exact determination of the % of each line.

    Results: The results of the molecular examination by capillary electrophoresis showed an atypical genotype, with tri-allelic markers, similar to those of mixtures. The cytogenetic analysis of 50 metaphases indicated 35 metaphases 46,XX and 15 metaphases 46,XY. The examination of FISH confirmed the presence of 70% of the nuclei showed two signals for the X chromosome centromere and none of the SRY and 30% showed one signal for the X chromosome and one SRY centromere.

    Conclusion: We present a true chimera hermaphroditism with a 46XX/46XY karyotype and hypothesize that the patient is a tetra-gamete or chimera due to early post-zygotic error and fusion of two distinct zygotes that gave rise to only one embryo. The results obtained will be used for clinical decision-making.

    N. Calumbuana: None. C. Correia: None. I.C. Capuepue: None. J.C.V.D. Van-Dúnem: None. M.M.P. Chimpolo: None.

    E-P14.10 A Rare Immune Deficiency Case With Dysmorphic Findings: ICF Syndrome

    A. Kalayci Yigin, F. Ozdemir, A. Ozaydin, M. Seven

    Department of Medical Genetics, Cerrahpasa Medical Faculty, Istanbul University-Cerrahpasa, Istanbul, Turkey

    Introduction: ICF (immune deficiency, centromeric region instability, facial anomalies) syndrome is a rare autosomal recessive inherited chromosomal breakage syndrome. In mitogen-induced lymphocytes, it is characterized by agamaglobulinemia or hypogammaglobulinemia, as well as rearrangements of chromosomes 1, 9, 16, adjacent to the centromere, in the heterochromatin regions.

    Clinical Findings: A 16-year-old male patient was referred to our outpatient clinic for genetic analysis with a preliminary diagnosis of ICF syndrome, due to recurrent lower and upper respiratory tract infections from a young age. The patient is the only surviving child of the family and no feature has been defined in his own and family history. In the physical examination; hypertelorism, nasal root flatness, deeply located eyes, flat and wide forehead, frequent hard and black hair were present. The ear was located downward and the bucket was facing forward.

    Results: Immunoglobulin (Ig) levels: A, G and M were lower than normal. IgE levels were normal. In Ig G subtyping, IgG1, G2 and G4 levels are higher than normal. CD3+, CD4+, CD8+ were detected. Chromosomal analysis revealed 46 XY. Chromosomal instability in the perisentromeric heterochromatin region of chromosomes 1, 9 and 16, decondensation of chromosome 9 and specific multi-branch chromosome structure was detected.

    Conclusion: According to our karyotype analysis of the patient decondensation of chromosome 9, multi-branch chromosome structure, low levels of immunglobulins and accompaning dysmorphic face was considered as a ICF syndrome.

    1. A.

      Kalayci Yigin: None. F. Ozdemir: None. A. Ozaydin: None. M. Seven: None.

    E-P14.11 A case of mosaicism with two different sex cell lines detected by chromosome analysis in a second trimester spontaneous miscarriage

    D. Sabau1,2, F. Nițu2, S. Grigore2, C. Tatai2, D. Guzun3,2, P. Apostol2

    1Emergency Hospital “Sfantul Ioan” Bucharest/ Clinica Sante Bucharest, Bucharest, Romania, 2Clinica Sante, Bucharest, Romania, 3Fundeni Clinical Institute, Bucharest, Romania

    Introduction: Miscarriage is a common event in a woman’s life. Most occur before 12 weeks and it has been estimated only 2-3% of pregnancies end spontaneously in the second trimester. Second-trimester pregnancy loss has been defined as miscarriage diagnosed between the duration of gestation 12-24 weeks.

    Material and methods: We report the case of a teenager who suffered a miscarriage in the second trimester (19 weeks). She was referred to our medical genetics department for further testing due to fetal malformation of the central nervous system, meningocele diagnosed by ultrasound. We performed karyotype analysis of the product of conception and analysed 70 cells.

    Results: The final cytogenetic result according to ISCN 2016 was: mos 46,XYqh-,inv(7)(p12q21)[61]/46,XX[9]. The structural modification identified in the majority of cell lines (the male line), the inversion, has the break points most likely in the regions 7p12 and 7q21 and it could be the cause of the malformation discovered by ultrasound. The normal cell line (the female line), might be the result of vanishing twin syndrome, possible sexual ambiguity of the fetus or maternal contamination.

    Conclusions: Considering even the possibility of maternal contamination, the diagnostic value for this case is of great importance, since it still offers the explanation for the pregnancy loss. To conclude, we consider karyotyping analysis of the product of conception to be of a great value when diagnosing the causes of miscarriages.

    D. Sabau: None. F. Nițu: None. S. Grigore: None. C. Tatai: None. D. Guzun: None. P. Apostol: None.

    E-P14.12 ADAMTS1, THBS1, RBFOX2 and WHSC1 gene expression as a biomarker of individual radiosensitivity in human lymphocytes

    R. Savchenko1, S. Vasilyev1, V. Fishman2, E. Sukhikh3, O. Gribova4, Z. Startseva4, A. Murashkina5, A. Dorofeeva6, D. Shunkova6, I. Lebedev1

    1Research Institute of Medical Genetics, Tomsk National Research Medical Center of RAS, Tomsk, Russian Federation, 2Institute of Cytology and Genetics of SB RAS, Novosibirsk, Russian Federation, 3Tomsk Regional Oncology Center, Tomsk, Russian Federation, 4Cancer Research Institute, Tomsk National Research Medical Center of RAS, Tomsk, Russian Federation, 5National Research Tomsk State University, Tomsk, Russian Federation, 6Siberian State Medical University, Tomsk, Russian Federation

    The search for genetic markers of human individual radiosensitivity is important. The microarray analysis of gene expression in human lymphocytes revealed the correlation of ADAMTS1, RBFOX2, THBS1 and WHSC1 gene expression with the spontaneous γH2AX foci level and the radiation-induced micronuclei frequency. The aim of this study was to assess the possibility of predicting individual radiosensitivity using analysis of ADAMTS1, RBFOX2, THBS1 and WHSC1 gene expression and methylation level of their promoters. We analyzed the blood lymphocytes obtained from 47 individuals, included 20 male and 27 female after exposure to 2 Gy of γ-rays in vitro. The micronucleus frequency was assessed using FISH-based micronucleus test with pancentromeric probes. The gene expression level was analyzed by real-time PCR. Targeted bisulfite analysis by NGS was used to estimate the methylation level of gene promoters. The micronucleus frequency was correlated with expression of ADAMTS1 (R=-0.52, p=0.033), THBS1 (R=-0.52, p=0.03) and WHSC1 (R=-0.37, p=0.032) in non-irradiated cells and with expression of THBS1 (R=-0.53, p=0.033) and RBFOX2 (R=-0.30, p=0.027) after irradiation. Simultaneous use of expression levels of all analyzed genes allowed to identify individuals with increased radiation-induced micronucleus frequency in groups of male (p=0.00026), female (p=0.048) and all individuals (p=0.0009). DNA methylation level was correlated with expression of RBFOX2 only (R=-0.58; p=0.009). It is possible to identify individuals with increased radiation-induced micronucleus frequency using gene expression level of analyzed genes, but not the methylation level of gene promoters. This study was supported by Grant of the President of Russian Federation MK-5944.2018.4 and RFBR grant №19-34-90143.

    R. Savchenko: None. S. Vasilyev: None. V. Fishman: None. E. Sukhikh: None. O. Gribova: None. Z. Startseva: None. A. Murashkina: None. A. Dorofeeva: None. D. Shunkova: None. I. Lebedev: None.

    E-P14.14 A retrospective study of indications and consent process for neonatal microarray analysis as a screen for genomic rearrangements

    K. A. Andrews*1,2, M. Prapa*1,2, E. J. Radford*3,4, I. Simonic1, S. Holden1,2, G. Belteki3, * equally shared

    1Department of Medical Genetics, University of Cambridge, Cambridge, United Kingdom, 2East Anglian Medical Genetics Service, Cambridge, United Kingdom, 3Addenbrookes Hospital, Cambridge University NHS Foundation Trust, Cambridge, United Kingdom, 4Department of Paediatrics, University of Cambridge, Cambridge, United Kingdom

    Introduction: Microarrays are increasingly requested as a first-line genetic investigation for chromosome anomalies in the neonatal population. Paediatricians, frequently trainees, usually choose the indication and take consent. This is often without specific training in how to consent for genetic tests.

    Materials and methods: We conducted a retrospective study over one year on our tertiary neonatal unit to assess the indications, consent process, diagnostic yield and results delivery for microarray testing.

    Results: Of 98 neonatal microarrays there was documented evidence of consent in 62% of cases and in only 2% was consent informed with documented discussion about prognostic information, variants of uncertain significance (VUS), incidental findings and possible implications for family members. Nearly a quarter of microarrays were requested for intra-uterine growth restriction without congenital anomalies, and in this group no likely pathogenic variants were identified. Four times more VUS were identified than likely pathogenic copy number variants. In 41% of cases, there was no documentation that the results had been communicated to the parents. However, all cases with clinically actionable findings were referred to clinical genetics.

    Conclusions: There is a need to build greater consensus on the indications for microarray testing in neonates, and training for paediatricians regarding how to take adequately informed consent for genetic testing. Citation:Andrews K, Prapa M, Radford E, et al Taking consent for neonatal microarray analysis as a screen for genomic rearrangements: are paediatricians equipped for the genomic era? Archives of Disease in Childhood Published Online First: 28 September 2019. doi: 10.1136/archdischild-2019-317966

    K.A. Andrews*: None. M. Prapa*: None. E.J. Radford*: None. I. Simonic: None. S. Holden: None. G. Belteki: None.

    E-P14.20 Could be a supernumerary marker chromosome in mosaic associated with pregnancy loss? A case report

    P. APOSTOL, M. Cristea

    Clinica Sante – Genetic Expert Center, Bucharest, Romania

    Fertility problems are became common disorder in the last time. Although cytogenetic abnormalities (e.g. the presence of a supernumerary marker chromosomes) represent an important cause of abortions, for some of couples the etiology remains unexplained.

    A couple, both partners of 38 years old, was refereed to our center for genetic investigations. In their history a pregnancy loss in the first trimester due to foetal cardiac defects (ultrasonographically detected) is described. A peripheral blood sample was collected and karyotype was performed from two independent cultures. Chromosome analysis was performed using the classical G-banding method (650 bands resolution).

    Cytogenetic analysis, done by two observers, shown a normal karyotype for the wife (46,XX), while the husband was found to have a mosaic karyotype: mos 46,XY,22pstk+[78]/47,XY, 22pstk+,+mar[8] (according to ISCN 2016). For this case 86 metaphases were analysed – 78 metaphases with a normal polymorphism 22pstk+ and 8 metaphases with a supernumerary marker chromosome with unknown chromosome origin. Further studies, including molecular analyses to highlight the breakpoint, are necessary in order to identify the origin of this marker chromosome. Few cases of supernumerary marker chromosome are described in the literature, most of them of small size and associated with different phenotypes, including infertility.

    In conclusion, although only 9.3% of the investigated metaphases had the chromosome marker, proper genetic counseling is recommended for the couple. Although the potential risk of this supernumerary marker chromosomes for pregnancy loss cannot be defined, it should be considered for further pregnancies and prenatal genetic tests should be done.

    P. Apostol: None. M. Cristea: None.

    E-P15 New Technologies and Approaches

    E-P15.04 Towards Next-Generation Phenotyping (NPG) for cat-eye syndrome

    T. Liehr, A. Al-Rikabi

    Jena University Hospital, Institute of Human Genetics, Jena, Germany

    We presently work together with the company FACE2Gene, (https://www.face2gene.com/) to establish the possibility to recognize cat-eye syndrome just by analyzing facial pictures of an individual patient. Forms of next generation phenotyping (NPG) are needed to increase further the value of any kind of genetic approaches, including timely consideration of (molecular) cytogenetics during the diagnostic quest. As NGP we used in this study the facial dysmorphology novel analysis (FDNA) technology. To automatically identify facial phenotypes of patients with small supernumerary marker chromosomes we already established successfully Emanuel (ES) and Pallister-Killian Syndrome (PKS) identification from 2D facial photos. The comparison between ES or PKS and normal individuals expressed a full separation between the cohorts. These results show that NPG is able to help in the clinic, and could reduce the time patients spend in diagnostic odyssey. The same development is currently undertaken for cat-eye syndrome. It became possible thanks to a grant from NORD. The link for the present project to upload pictures of cat-eye syndrome will be provided on the poster. NPG also helps to differentiate ES or PKS from each other and other patients with small supernumerary marker chromosomes and most likely also from patients with cat-eye syndrome. Thus, especially in countries with no access to more sophisticated genetic approaches apart from banding cytogenetics NPG is a very timely approach. Inclusion of more facial pictures of patient with sSMC, like cat-eye-, isochromosome-18p-syndrome or others may contribute to higher detection rates in future. Supported by NORD Research Program grant number 18002.

    T. Liehr: None. A. Al-Rikabi: None.

    E-P15.05 Performance evaluation study of INNO-LiPA® CFTR iage

    C. Dobbels1, L. Tremmerie1, M. Seia2, M. D’Apice3, M. Lucarelli4, K. Stouffs5, S. Seneca5, A. Gheldof5, C. Orsini6, G. Mersch1, V. Kostanjevecki1

    1Fujirebio, Gent, Belgium, 2Medical Genetics Lab, Milan, Italy, 3PTV Foundation, Rome, Italy, 4Dipartimento di Medicina Sperimentale, Rome, Italy, 5Center for Medical Genetics, Brussels, Belgium, 6Fujirebio Italia S.r.l., Rome, Italy

    Objectives: The INNO-LiPA® CFTRiage assay based on reverse-hybridization is a simple method allowing simultaneous analysis of 88 CFTR mutations with automatic interpretation using LiRASTM for LiPA Cystic Fibrosis v.5 software. By performing just one amplification and hybridization with the INNO-LiPA CFTRiage > 95% of the samples can already be characterized. Worst case 2 additional confirmation strips, using the same amplicon, are required to obtain complete characterization. The aim of the study was to assess the success rate, agreement with a reference result and reproducibility of the INNO-LiPA® CFTRiage assay.

    Methods: To assess the success rate and agreement, 324 stored DNA samples from (suspected) CF patients, heterozygous carriers and healthy subjects were tested at 3 external sites. The DNA was amplified with the OneAmp kit and consecutively tested with the INNO-LiPA® CFTRiage strips and, where applicable with the INNO-LiPA® CFTR confirmatory strips. For reproducibility testing, a panel of 6 DNA samples was tested at three sites (2 external, and 1 in-house), by different persons, on different days, on different instruments, and in-house on 3 different lots of the INNO-LiPA CFTRiage.

    Results: The success rate was 100.0% (95% CI [99.2%;100.0%]). An agreement of 99.7% (95% CI [98.6%;99.7%]) between INNO-LiPA CFTRiage assay and the reference result was obtained. The reproducibility of the INNO-LiPA CFTRiage was 100.0% (95% CI of [98.6%; 100.0%]).

    Conclusion: The study proved that the INNO-LiPA® CFTRiage assay has an excellent performance and is an easy to use assay to detect 88 CFTR mutations simultaneously.

    C. Dobbels: None. L. Tremmerie: A. Employment (full or part-time); Modest; Fujirebio. M. Seia: None. M. D’Apice: None. M. Lucarelli: None. K. Stouffs: None. S. Seneca: None. A. Gheldof: None. C. Orsini: A. Employment (full or part-time); Modest; Fujirebio. G. Mersch: A. Employment (full or part-time); Modest; Fujirebio. V. Kostanjevecki: A. Employment (full or part-time); Modest; Fujirebio.

    E-P15.06 Association of two rare inherited causes of neonatal intrahepatic cholestasis revealed by next generation sequencing

    H. Fredj1, S. Hizem1, Y. Elaribi1, I. Rejeb1, H. Jilani1, M. Sebai1, M. Chaabouni2, F. Broly3, L. Ben Jemaa1

    1Department of Congenital and Hereditary Diseases, Mongi Slim Hospital, La Marsa, Tunis, Tunisia, 2pediatric clinic, Sfax, Tunisia, 3Service Toxicologie et Génopathies. Institut de Biochimie et Biologie Moléculaire CHU de Lille, Lille, France

    Introduction: Neonatal cholestasis is a heterogeneous group of rare disorders of impaired bile flow in the newborn and young infant, some of which might be fatal if not identified and treated rapidly. More than 100 inherited etiologies were identified to cause cholestatic liver diseases with the initial presentation of jaundice. Clinical diagnosis of neonatal cholestasis is considered to be an extremely challenging process. With the advent of next generation sequencing (NGS), it becomes possible to rapidly identify the genetic cause of such disorders in a high-throughput manner. We report on a case of neonatal cholestasis investigated by an expanded panel-based NGS, revealing a rare association of citrin deficiency and progressive familial intrahepatic deficiency (PFIC 2).

    Material and methods: The proband is a 3-month-old boy, born from consanguineous union. He presented with intermittent jaundice from 15 days after birth, with elevated transaminase and alpha-fetoprotein serum levels, very high serum bile acid concentration, and normal serum gamma-glutamyltransferase (GGT) activity. An expanded panel-based NGS was performed on genomic DNA from the proband, including 29 genes implicated in PFIC, and additional 224 other genes for cholestasis.

    Results: Two different homozygous variants were identified in the child: A c.1062T>A in ABCB11 gene responsible for PFIC2, and a novel probably pathogenic variant in SLC25A13 gene responsible for citrin deficiency. Both parents were heterozygous for both variants.

    Conclusions: Using large panel-based NGS allowed the identification of a combination of two rare intricate inherited causes of neonatal cholestasis, needing an appropriate treatment and dietary management to avoid complications.

    H. Fredj: None. S. Hizem: None. Y. Elaribi: None. I. Rejeb: None. H. Jilani: None. M. Sebai: None. M. Chaabouni: None. F. Broly: None. L. Ben Jemaa: None.

    E-P15.08 Sequencing Illumina DNA libraries on BGISEQ-500 sequencing platform using custom protocol

    J. A. Vnuchkova, P. A. Koshkin, D. V. Pyankov, S. A. Korostelev

    Genomed Ltd, Moscow, Russian Federation

    Introduction: Convertion of Illumina DNA libraries to DNA nanoballs and subsequent sequencing on BGI/MGI sequencing platforms could resolve potential problem of obtaining optimal cluster density on Illumina platforms. In this study we describe a custom protocol for sequencing Illumina DNA libraries on BGISEQ-500 sequencer and present comparative analysis of data obtained from NextSeq 500 and BGISEQ-500 sequencers.

    Materials and methods: Set of 48 DNA libraries was prepared using Swift 2S Turbo DNA Library Kit (Swift Bioscience) and NimbleGen SeqCap Hybridization reagents and probes (Roche). Sequencing was performed on NextSeq 500 and BGISEQ-500 platforms. Oligonucleotides for library convertion and BGISEQ-500 sequencing were ordered from Microsynth (Switzerland). Demultiplexing of BGISEQ-500 data was performed using custom tool. FastQC, aligning and coverage analysis were performed using FASTQC, BWA MEM and Mosdepth tools. Variant calling was performed using in-house pipeline for clinical variant interpretation based on ACMG criteria.

    Results: Custom protocol for sequencing Illumina DNA libraries on BGISEQ-500 was developed. Comparative analysis of Illumina and BGI data was performed. We observed comparably good quality in both datasets according to various quality control metrics, even having a better quality for BGISEQ-500 data. Variant calling showed some diversity in general amount of obtained variants between two platforms, however all clinically significant variants were similar in both datasets.

    Conclusions: Our study suggests that developed protocol is acceptable for sequencing hybridization-based DNA libraries. The limitation of the method is a necessity to use unique single indexes. The development of library convertion kit based on this study is potential.

    J.A. Vnuchkova: None. P.A. Koshkin: None. D.V. Pyankov: None. S.A. Korostelev: None.

    E-P15.09 Investigation of the DNA methylation profile in children presenting emergence delirium

    V. Quintao1,2, Y. Gasparini2, V. Almeida2, A. Dias2, M. Montenegro2, M. Carmona1, L. Kulikowski2

    1Hospital das Clinicas HCFMUSP, Faculdade de Medicina, Universidade de Sao Paulo, Sao Paulo, Brazil, 2Laboratorio de Citogenomica, Hospital das Clinicas HCFMUSP, Faculdade de Medicina, Universidade de Sao Paulo, Sao Paulo, Brazil

    Introduction: Among cognitive changes related to anesthesia, emergence delirium is frequent in children and could be observed in up to 30% of cases. The occurrence of delirium may be related to postoperative cognitive and behavioral changes. Recent studies demonstrated the involvement of epigenetic processes in the behavioral changes related to anesthesia. Thus, performing the DNA methylation profiles is an important tool for studying the role of epigenetic factors in these events.

    Materials and methods: After IRB approval, children between 1 and 12 years old, submitted to general anesthesia for endoscopic procedures, were recruited. Emergence delirium was considered as Pediatric Anesthesia Emergence Delirium Scale score ≥ 10. DNA from blood lymphocytes were extracted by QIAamp DNA BloodMidi Kit (QIAGEN®). The genomic array was performed using iScan (Illumina®) with HumanCytoSNP850K and Infinium MethylationEPIC BeadChips. Arrays data were treated and analyzed using Bluefuse®, GenomeStudio®, and specific packages in R environment.

    Results: We included 53 patients. Twenty-three children (43.4%) presented emergence delirium. Eight children with emergence delirium and eight controls (after age and gender matching) were selected for methylation profile evaluation. Copy number variation analysis demonstrated no presence of pathogenic deletions or duplications. Analysis of methylation raw data showed a difference in the average beta value between cases and controls in selected chromosomes.

    Conclusions: Our results suggest that DNA methylation profiles may present significant differences between children with emergence delirium and controls, including specific genomic regions. Therefore, we emphasize the importance of investigating and identifying epigenetic alterations to understand this relevant clinical adverse event.

    V. Quintao: None. Y. Gasparini: None. V. Almeida: None. A. Dias: None. M. Montenegro: None. M. Carmona: None. L. Kulikowski: None.

    E-P15.10 Gene expression profiling of RNA samples from frozen blood and optimization of sample storage conditions

    E. Koh, S. Yu, S. Hwang

    Hanyang University, Ansan, Korea, Republic of

    Gene expression profiling is one of the most powerful technologies to understand bio-molecular alterations which are affected by external stimulus such as environmental toxicants. In order to obtain reliable interpretation of these data, integrity of RNA should be primarily qualified, which is determined from the very moment of sample collection and storage conditions. In the meantime, whole blood can be obtained with less-invasive way compared to others such as tissues. However, blood is vulnerable to freezing and often loses its availability for RNA downstream applications. In this study, we compared changes of RNA quality according to the several sample storage conditions including temperature and duration of incubation before freezing, long-term freezing and types of collection tubes. After simple QC steps, we performed mRNA-seq to compare gene expression patterns of RNAs from various storage conditions. We found that quality of RNA samples is obviously affected by storage conditions leading to changes in gene expression patterns compared to control (Fold changes>|2|). Differentially expressed genes in this study are grouped as snoRNA family, which is involved in structure of rRNA, tRNA and so on. As a results, we set the guideline for optimal blood sample storage. By proceeding to further study, it is expected to set the markers for RNA sample quality by inducing whether these genes take charge in RNA degradation in some ways. This study was supported by Korea Environment Industry & Technology Institute(KEITI) through "the Environmental Health Action Program", funded by Korea Ministry of Environment(MOE) (2017001360005).

    E. Koh: None. S. Yu: None. S. Hwang: None.

    E-P15.12 Quick assessment of antioxidant effects in combined treatments measuring catalase gene activity in vitro

    N. Tomic, M. Hadzic, N. Lojo-Kadric, J. Ramic, L. Pojskic

    University of Sarajevo, Institute for Genetic Engineering and Biotechnology, Sarajevo, Bosnia and Herzegovina

    Luteolin is the bioflavonoid with known protective roles. It inhibited genotoxicity experimentally induced by halogenated boroxine (HB). Statistically significant decrease in the frequency of micronuclei and nuclear buds was observed before, but mechanism of its anti-genotoxic activity is not clear. Since HB is recognized as inhibitor of catalase activity as a major antioxidant enzyme, we designed experiment to assess antioxidative effects of luteolin on level of relative expression of catalase (CAT) gene. Cell cultures from peripheral blood lymphocytes of five healthy donors were established and treated with luteolin, HB, and luteolin and HB combined. After 72 hours incubation, total RNA was isolated from harvested cells and reverse-transcribed. SYBR based Real-Time PCR amplification method for analysis of relative gene expression in treated cultures was used. Analysis of results included normalization of ratio of target (CAT) and housekeeping (GAPDH) gene and statistical analysis (REST®). Significant up-regulation of CAT expression on transcriptional level was found in simultaneously treated cultures when compared with cultures treated with each substance individually. In luteolin-treated cultures when compared to HB-treated cultures CAT expression was down regulated but not statistically significant. In comparison to control (DMSO), CAT expression was up regulated in simultaneously treated cultures but in individually treated cultures it was down regulated, with no statistical significance. Obtained results may indicate that new approaches to the treatment of skin changes with HB should include luteolin and monitoring corresponding antioxidant system. For more precise determination of luteolin effects and potential, more treatments and genes should be explored.

    N. Tomic: None. M. Hadzic: None. N. Lojo-Kadric: None. J. Ramic: None. L. Pojskic: None.

    E-P15.13 Closing the diagnostic gap on muscular dystrophies

    F. Zimmer1, N. Pluta1, B. Wolf2, D. Atlan3, A. Zaum1, S. Rost1

    1Institute of Human Genetics, Wuerzburg, Germany, 2iCoSys, Fribourg, Switzerland, 3Phenosystems SA, Braine le Chateau, Belgium

    Introduction: Whole genome sequencing (WGS) is becoming more and more meaningful not only in human genetic research but also for future molecular genetic diagnostics. The main challenges in WGS lie in data analysis and variant interpretation rather than in the sequencing technology itself. The detection of disease-causing variants in those extensive genome data requires the application of appropriate software tools.

    Materials and methods: Here we present the data analyses of four genomes from patients with muscular dystrophies (without mutations using gene panel or exome sequencing) by applying the software GensearchNGS (PhenoSystems). We used integrated variant calling, CNV tools and anomaly scans together with external tools (e.g. cnMops, Alamut, CADD) to analyze and validate the patient’s data (see table).

    Results:

    patient 1 2 3 4
    sex F M F M
    gene of interest (goi) SGCG DMD DMD DMD
    aligned sequences 1.262.574.555 1.072.189.661 666.864.288 680.631.017
    fastq(Gb) 90,9 77,9 48,1 48,9
    mean coverage (goi) 64 29 34 18
    variants (total) * 5.706.907 5.679.385 5.635.599 5.709.193
    variants (goi) * 453 2.321 3.151 2.003
    candidate variant homozygous SNV intron 1 pending heterozygous SNV intron 63 hemizygous deletion intron 2
    splice effects (in silico prediction) cryptic acceptor activated pending cryptic acceptor activated unknown
    comments muscle biopsy: reduced gamma-sarcoglycan expression RNA-analysis of DMD without pathological findings skewed X-inactivation heterozygous intronic deletion (SGCG)
    1. *variant calling options: frequency >20 %, coverage > 5

    Conclusion:In at least three out of four patients, definitely suffering from muscular dystrophies, we could detect promising structural variants and/or SNVs in the non-coding regions of known genes (DMD, SGCG). The most promising candidate variants are now under consideration for further functional studies in order to confirm/exclude the deleteriousness of those variants.

    F. Zimmer: None. N. Pluta: None. B. Wolf: None. D. Atlan: A. Employment (full or part-time); Significant; Phenosystems SA. A. Zaum: None. S. Rost: None.

    E-P15.17 Nanoscale automation of RNA sequencing library preparation on a microfluidic platform

    A. Hamilton1, S. Chamnongpol2, J. Alipaz2, J. Brockman2, B. Fowler2, J. A. Geis2, T. Goralski2, C. Kubu2, R. Kung2, B. Lacar2, C. Park2, M. Phelan2, G. Sun2, D. A. King2

    1Fluidigm GmBH, Munich, Germany, 2Fluidigm Corporation, South San Francisco, CA, United States

    Insights from the analysis of expressed gene products by RNA sequencing enables human disease researchers to better understand the underlying structure and function of genes of interest. We developed a microfluidics-based solution that automates many tedious hands-on steps of the RNA-seq library prep workflow including poly(A) RNA selection. The method generates up to 48 random-primed stranded RNA-seq libraries from as little as 10 ng of total RNA. Nanoliter reaction volumes significantly reduce reagent consumption to lower overall costs per sample. We are developing an option for use of unique dual index (UDI) tags to improve proper assignment of reads reported for sequencers with patterned flow cells, such as the Illumina® NovaSeq™. In this poster, results from an internal analytical study of the Advanta™ RNA-Seq NGS Library Prep Kit and a comparison to results obtained from the Illumina TruSeq® Stranded mRNA Kit are presented. Our study included >900 samples at 10 and 100 ng of input that generated genome mapping rates >80%, with rRNA reads <10%. Technical replicate correlations were observed to be >98% in all conditions. A comparable number of genes are detected in libraries prepared with either Advanta or TruSeq kits. The Advanta RNA-Seq Kit provides an RNA-seq library prep solution offering walkaway automation that substantially minimizes manual pipetting steps and hands-on time. The inclusion of UDIs further improves the workflow with high-data-output sequencers such as the NovaSeq. For Research Use Only. Not for use in diagnostic procedures.

    A. Hamilton: A. Employment (full or part-time); Significant; Fluidigm. S. Chamnongpol: A. Employment (full or part-time); Significant; Fluidigm Corporation. J. Alipaz: A. Employment (full or part-time); Significant; Fluidigm. J. Brockman: A. Employment (full or part-time); Significant; Fluidigm. B. Fowler: A. Employment (full or part-time); Significant; Fluidigm. J.A. Geis: A. Employment (full or part-time); Significant; Fluidigm. T. Goralski: A. Employment (full or part-time); Significant; Fluidigm. C. Kubu: A. Employment (full or part-time); Significant; Fluidigm. R. Kung: A. Employment (full or part-time); Significant; Fluidigm. B. Lacar: A. Employment (full or part-time); Significant; Fluidigm. C. Park: A. Employment (full or part-time); Significant; Fluidigm. M. Phelan: A. Employment (full or part-time); Significant; Fluidigm. G. Sun: A. Employment (full or part-time); Significant; Fluidigm. D.A. King: A. Employment (full or part-time); Significant; Fluidigm.

    E-P15.18 Using RNA-Seq as complementary diagnostic tool in congenital heart defects: pilot study in a group of transplanted children

    A. del Pozo1, C. Rodríguez-Antolín2, R. Martín-Arenas3, Á. González-Rocafort4, M. Solís1, B. Ruz2, L. García Guereta4, L. Fernández García-Moya2, E. Vallespín1

    1INGEMM - Hospital Universitario La Paz - CIBERER, Madrid, Spain, 2INGEMM - Hospital Universitario La Paz, Madrid, Spain, 3Genycell Biotech España, Madrid, Spain, 4Cirugía Cardiaca Infantil. Hospital Universitario La Paz, Madrid, Spain

    The implantation of NGS in clinical routine has supposed a great advance in the diagnostic of mendelian diseases providing very valuable information for disease management. Still there are cases where NGS testing does not provide a conclusive diagnosis due to the limits that present studies based exclusively on DNA analysis specially in the interpretation of challenging variants as those within intronic, regulatory or splicing regions.

    Recent works endorse RNA-Seq as a complementary technique that would provide more evidences to lead to a diagnostic. Although promising results, methodological and quality issues must be determined to ensure clinical validity/utility of the study.

    In this work, it had been selected a group of 9 pediatric patients who had undergone a heart transplant surgery during the period 2018-2019 due to a congenital heart defect with negative or inconclusive result for gene-panel study.

    It has been designed a pilot diagnostic scheme to achieve a robust diagnosis that includes the DNA information of the patients together with RNA-Seq data from their cardiac tissue from the discarded heart.

    The RNA-Seq pipeline integrates several tools that compares a target sample against a control cohort selected from the GTEx project. It includes tools for: 1) aberrant splicing events identification, 2) aberrant expression quantification and 3) identification of allele-specific expression of variants determined both by DNA-Seq and RNA-Seq.

    This study has enabled the characterization of a new candidate and the study of previous VUS variants what shows the potential of such approaches to be adopted in routine diagnosis.

    A. del Pozo: None. C. Rodríguez-Antolín: None. R. Martín-Arenas: A. Employment (full or part-time); Significant; Genycell Biotech España. Á. González-Rocafort: None. M. Solís: None. B. Ruz: None. L. García Guereta: None. L. Fernández García-Moya: None. E. Vallespín: None.

    E-P15.20 Try to find the somatic mutation in the brain!

    J. Kárteszi

    Genetic Laboratory, Zalaegerszeg, Hungary

    It was demonstrated in recent years that somatic mutations happen in neuronal stem cells. However, the effect of somatic mutations during tumorigenesis had been proven long time ago. We also know that some clue oncogenes have important role in neurodevelopment and maintenance of brain integrity. Based on common regulatory pathways in both tumorigenesis and neurodegeneration I discuss the possible use of oncogenetic research evidences in the explanation of devastating neurogenic diseases. “Loss of heterozygosity” is widely used in tumour genetics. On the other hand, plenty of neurogenic disorders were described with “dominant negative effect” which meant loss of function of the effected genes. Data were collected that until the normal allele functioned well this effect didn’t work. Somatic mutation in neuronal stem cells containing a germline mutation may destroy the function of the normal allele. I propose that neurodegeneration can be clonal disorder in some instances. The complicated pathogenesis of Parkinson disease is highly studied and GBA (beta-glucocerebrosidase) gene heterozygous mutations were found more frequently in the familial form of the disease. Gaucher disease is an autosomal recessive lysosomal storage disorder caused by glucocerebrosidase deficiency. It was detected that Parkinson disease is more frequent in Gaucher type I patients but also in the carrier parents. Liquid biopsy is well known in tumour research. Let’s try to use it to find the somatic mutation in the brain! The first successful step in this direction may also lead to the understanding of a subset of autosomal dominant neuronal diseases with incomplete penetrance.

    J. Kárteszi: None.

    E-P15.21 The use of artificial intelligence to assess factors of genetic predisposition to cancer of the uterine body

    I. Ugarov1, V. Chernyh1,2, I. Sharkova1,2, N. Ivanov1, V. Maslennikov1, D. Ostapenko1, V. Solovey1

    1xGen Cybernetics, Moscow, Russian Federation, 2Federal state scientific budgetary Institution «Research Centre for Medical Genetics», Moscow, Russian Federation

    Uterine Corpus Endometrial Carcinoma (UCEC) is a malignant multifactorial neoplasm which is characterized by high prevalence. Currently, there are no screening methods for assessing genetic predisposition to UCEC, so the development of an approach to analyzing the results of genetic testing, devoid of the previously described shortcomings and providing identification of variants characteristic of multifactorial pathology, is an actual problem. Objective: to develop an approach to identify patterns in the results of genetic testing that are typical for patients with multifactorial cancer and to develop a genetic panel for screening for predisposition to UCEC. Materials and methods: For a set of genes, the analysis of refereed scientific articles on the following keywords was performed:" Uterine Corpus Endometrial Carcinoma"," predisposition"," mutation","SNP". Data from TumorPortal was used to evaluate the model’s performance (http://www.tumorportal.org/) and the Cancer Genome Atlas (TCGA). Based on the data, two groups were formed: patients with UCEC (n=248) and a control cohort of patients with other nosologies (n=6498). Results: a method has been developed that allows us to identify screening patterns of multifactorial conditions. Patterns and a mathematical model based on the method takes into account genetic variants in 229 genes related to UCEC, showing 79% sensitivity and 85% specificity. Screening patterns cover all highly significant mutated genes according to Tumorportal data, excluding CCND1, ERBB3, ZNF471, and ING1. The use of artificial intelligence to assess factors of genetic predisposition to cancer of the uterine body and preclinical prevention.

    I. Ugarov: None. V. Chernyh: None. I. Sharkova: None. N. Ivanov: None. V. Maslennikov: None. D. Ostapenko: None. V. Solovey: None.

    E-P15.22 The first Albanian case of Waardenburg syndrome type 4A

    A. Laku - Babameto

    Service of Genetic Laboratory, University of Medicine, University Hospital Cenetr “Mother Teresa”, Tirana, Albania

    Waardenburg syndrome type 4 (WS4), is a very rare congenital disorder with variable clinical expression, characterised by Hirschsprung disease, and abnormal melanocyte migration, resulting in pigmentary abnormalities and sensorineural deafness. Three disease-causing genes have been identified: mutations in the SOX10, END3, or EDNRB genes are known to cause WS type IV. Variants in the endothelin - B receptor (EDNRB) gene on 13q22 region have been found to cause the Waardenburg syndrome type IVA (WS 4A), that combines clinical features of pigmentary abnormalities of the skin, hair and irides, sensorineural hearing loss, and Hirschprung disease. We report a 15 months - old albanian boy who was diagnosed as WS IVA. He presented clinical manifestations as skin and hair hypopigmentation, hypertelorism, broad nasal bridge, epicanthal folds, bilateral blue homochromatic irides, mild developmental delay, muscular hypotonia, short stature and constipation. The entire exome has been evaluated for variants clinically relevant to the described phenotype by the whole exome sequencing, but it was not detected any variant indicative of the genetic diagnosis of the patient. The diagnosis was confirmed by chromosomal microarray analysis. It was detected a 23153 kb one copy loss on the long arm of chromosome 13. A pathogenic CNV has been detected in the 13q21.1q31.1 region, totally encompassing the EDNRB gene. The EDNRB gene has been found totally deleted in our patient. It is observed a variable phenotype in patients with heterozygous loss of function of EDNRB gene. This is the first case of WS 4A to be reported from Albania.

    A. Laku - Babameto: None.

    E-P15.23 Generation of whole-exome-libraries with a wide-range of fragment length with the Nextera Flex bead-linked transposome approach to improve genotypability

    B. Iadarola1, M. Rossato1, M. Paterno1, D. Lavezzari1, C. Degli Esposti1, C. De Quattro1, B. Giovannone1, G. Bhattacharjee2, R. Tim2, M. You2, M. Delledonne1

    1University of Verona, Verona, Italy, 2Illumina, San Diego, CA, United States

    Introduction: Short-read sequencing in targeted resequencing prevents the identification of clinically-relevant genetic variants within or in close proximity to duplicate genomic regions. We recently found that the analysis of fragments longer than standard-size improves mapping quality and thus genotypability of many clinically relevant genomic regions. However, modulating fragment length in enzymatic-based library preparation is challenging, as optimal ratio between DNA/enzymes is not easily identifiable or because bead-linked transposome chemistry is setup for a standard DNA size. In this study we tested the possibility to modulate fragment length in exome-libraries using the standard or a modified version of the Nextera Flex for Enrichment bead-linked transposome (Illumina), extending fragment length up to 550bp.

    M&M: Genomic libraries were obtained with the standard Nextera Flex for Enrichment Library Prep kit or its new modified version (not commercially available yet), and subsequently enriched in exonic portions with the Illumina Exome Panel. Libraries have been sequenced in 150PE to 80X mapped coverage.

    Results: Genomic libraries with different fragment lengths (200, 300, 400, 500bp) have been successfully generated by adjusting simple experimental conditions such as bead-based size-selection and PCR extension time. Exome enrichment did not change the different fragment sizes, that were subsequently confirmed by sequencing. Target coverage and number of variants across the multiple fragment sizes are being evaluated.

    Conclusions: The availability of two distinct bead-based transposome library prep kits will allow to generate libraries with a wide range of fragment size, thus permitting to modulate/improve genotypability in targeted resequencing.

    B. Iadarola: None. M. Rossato: None. M. Paterno: None. D. Lavezzari: None. C. Degli Esposti: None. C. De Quattro: None. B. Giovannone: None. G. Bhattacharjee: A. Employment (full or part-time); Significant; Illumina. R. Tim: A. Employment (full or part-time); Significant; Illumina. M. You: A. Employment (full or part-time); Significant; Illumina. M. Delledonne: C. Other Research Support (supplies, equipment, receipt of drugs or other in-kind support); Modest; Illumina.

    E-P16 Diagnostic Improvements and Quality Control

    E-P16.01 Validation of a Next Generation Sequencing BRCA assay using buccal DNA swabs to meet current and future demands in diagnostic field

    E. De Paolis1, M. De Bonis1, E. Ferri2, C. Marchetti2,3, A. Pietragalla2, G. Scambia2,3, A. Urbani1,3, A. Fagotti2,3, A. Minucci1

    1Molecular Diagnostic and Genomics Laboratory, Fondazione Policlinico Universitario A. Gemelli IRCCS, Rome, 00168, Italy, 2Division of Oncological Gynecology, Department of Women’s and Children’s Health, Fondazione Policlinico Universitario A. Gemelli IRCCS, Rome, 00168, Italy, 3Catholic University of the Sacred Heart, Rome, Italy

    Introduction: Most of the commercial sequencing methods use blood as primary sample source of genomic DNA (gDNA). Buccal swab is an emerging sample collection device due to convenient and non-invasive characteristics. This study assesses the suitability of buccal swab as gDNA source and evaluates the performance of Next Generation Sequencing (NGS) Devyser kit for detecting BRCA pathogenic variants (PVs).

    Materials and methods: Swabs and blood samples were collected from 5 healthy and 3 BRCA PVs carriers. Buccal swabs were obtained using FLOQ Swab (COPAN, Brescia, Italy) placed with NAO basket. Both sample types were extracted using the QIAmp DNA Mini kit (Qiagen, Hilden, Germany). NGS Devyser BRCA kit (Devyser, Hägersten, Sweden) was used for the BRCA amplification. Sequencing was performed on MiSeq platform (Illumina, CA, US). Quality parameters were evaluated from sequencing data. NGS data were analyzed by Amplicon Suite (SmartSeq, Novara, Italy).

    Results: Concentration and quality of DNA extracted from buccal swab samples were adequate for library preparation and sequencing. Comparable quality parameters result from the evaluation of NGS data across samples types. BRCA genetic alterations (SNPs, PVs, CNV) detected in buccal DNA swabs were concordant with those from matched blood samples.

    Conclusions: Devyser BRCA NGS kit performs as well with buccal swabs collected using Copan FLOQ Swab as it does with samples collected from blood. Similar genotyping performances between the two DNA sources were observed, supporting the use of buccal swabs as alternative sample type in NGS. Larger study has been planned in order to perform the validation assay.

    E. De Paolis: None. M. De Bonis: None. E. Ferri: None. C. Marchetti: None. A. Pietragalla: None. G. Scambia: None. A. Urbani: None. A. Fagotti: None. A. Minucci: None.

    E-P16.02 Clinical utility of carrier status for autosomal recessive conditions in the Brazilian population

    W. A. R. Baratela, C. M. Moreira, P. R. Sacramento-Bobotis, G. M. N. Filho, M. G. Penna, R. R. F. Souza, A. C. C. Trindade, C. R. Furuzawa, D. P. Pereira, C. Olivati, G. M. Spolador, V. C. Pereira, R. A. da Silva, M. N. P. Santos, C. R. D. C. Quaio

    Fleury Medicina e Saúde, São Paulo, Brazil

    Introduction: Commercial tests for carrier status determination of common autosomal recessive conditions are currently offered in Brazil. Nevertheless, frequency of rare autosomal recessive alleles has not been established for the Brazilian population. Therefore, clinical utility of these tests is not determined for this specific population.

    Methods: We actively searched for pathogenic variants in autosomal recessive conditions, not the primary objective of analysis, in 100 whole exomes performed for diagnostic purposes in a private laboratory in Brazil. Common variants (e.g., frequency >1%) in common recessive conditions (HFE, SERPINE1, BTD) were excluded from our analysis. We reviewed the methodology of three commercial tests for carrier status and assessed whether variants found in our cohort were covered by these commercial kits.

    Results: Rare pathogenic variants in genes associated with autosomal recessive conditions were found in 37% of patients. Among these patients, 40,5% presented more than one variant. Average number of genes tested by commercial kits was 433. More than half (54%) of variants found were not universally covered by all commercial kits assessed. As for individual laboratories, coverage of recessive variants varied from 45% to 66,5%.

    Conclusion: Information about limited sensitivity for carrier status panels for pathogenic variants in Brazilian patients should be addressed in genetic counselling to avoid false reassurance and adjusting expectations from couples. The usage of larger target gene panels, or even whole exome sequencing, might overcome this limitation.

    W.A.R. Baratela: None. C.M. Moreira: None. P.R. Sacramento-Bobotis: None. G.M.N. Filho: None. M.G. Penna: None. R.R.F. Souza: None. A.C.C. Trindade: None. C.R. Furuzawa: None. D.P. Pereira: None. C. Olivati: None. G.M. Spolador: None. V.C. Pereira: None. R.A. da Silva: None. M.N.P. Santos: None. C.R.D.C. Quaio: None.

    E-P16.03 Allele dropout caused by an AT-repeat in MME

    H. T. Hilmarsen1, P. F. Rosenegger2, Ø. L. Holla1, S. B. C. F. Reiter3, L. Strand1, G. J. Braathen1, J. Senderek4, H. Høyer1, M. Auer-Grumbach4

    1Telemark Hospital Trust, Skien, Norway, 2Medical University of Vienna, Vienna, Austria, 3Haukeland University Hospital, Bergen, Norway, 4LMU Munich University Hospital, Munich, Germany

    Introduction: The MME-gene encodes a widely expressed zinc-dependent metalloendopeptidase (Neprilysin). Biallelic sequence variants in MME cause axonal Charcot-Marie-Tooth disease and fetomaternal alloimmune membranous glomerulopathy, while heterozygous variants are susceptibility factors for axonal Charcot-Marie-Tooth disease. The frameshift deletion NM_007289.3(MME):c.467delC (p.Pro156Leufs*14) has been reported as a dominant susceptibility factor and as a cause of recessive neuropathy.

    Materials and methods: We present three axonal neuropathy families and three simplex individuals carrying the MME c.467delC variant. Probands underwent Next-Generation-Sequencing (NGS); most relatives were Sanger sequenced.

    Results: NGS identified heterozygous c.467delC in the probands with familial disease and in two simplex cases. The last simplex case was homozygous. Subsequent Sanger analysis confirmed these results in all cases. Six additional relatives appeared to be homozygotes by Sanger sequencing. However, NGS showed these six individuals to be heterozygotes. Further investigation revealed a highly polymorphic AT-repeat in close proximity to the variant. All heterozygous individuals who appeared homozygous for c.467delC were heterozygous for the AT-repeat (8AT/13AT). The heterozygous individuals were homozygous for the AT-repeat.

    Conclusions: A heterozygous AT-repeat situated in close proximity to MME c.467delC causes allele dropout on Sanger sequencing; heterozygotes appear to be homozygotes. An incorrect diagnosis and cascade testing may have a large clinical impact. This highlights that even a small difference in nucleotides outside the primer binding sites may cause allele dropout.

    H.T. Hilmarsen: None. P.F. Rosenegger: None. Ø.L. Holla: None. S.B.C.F. Reiter: None. L. Strand: None. G.J. Braathen: None. J. Senderek: None. H. Høyer: None. M. Auer-Grumbach: None.

    E-P16.04 Cancer care and a tale of three molecular “genomic” tests

    N. Hook, J. Wallace, B. Zimmermann, N. Liang, R. Swenerton, U. Do, S. Sawyer, J. Saucier, S. Parmar, A. Aleshin

    Natera, Inc, San Carlos, CA, United States

    Introduction: Patient-specific, bespoke assays detect circulating tumor DNA (ctDNA) by analyzing cell free DNA to monitor molecular residual disease, recurrence, and treatment response in cancer patients. We present a case study of a patient diagnosed with cancer where three individual molecular tests were utilized in the care continuum.

    Case Presentation: A 56 yo Caucasian female diagnosed with stage IIIc ovarian clear cell carcinoma was treated with total abdominal hysterectomy with bilateral salpingooophorectomy, omentectomy, appendectomy, lymph node sampling, peritonectomy, and optimal tumor debulking in June, 2018. Comprehensive genomic profiling for tumor molecules and diagnostic testing for hereditary cancer predisposition syndrome was performed to identify inherited risk and consider use of PARP inhibitor therapy. Treatment with first-line adjuvant chemotherapy concluded in October 2018. The patient relapsed (Jan 2019) and was enrolled in clinical trial GYO16, receiving pembrolizumab infusions with oral epacadostat. In Feb 2019, ctDNA was monitored using a bespoke assay designed from matched-normal whole exome sequencing. ctDNA was initially detected (4.61 MTM/mL) and continued to increase across multiple timepoints (15.33 MTM/mL), consistent with the patient’s reported progressive disease and exit from GYO16 study in Nov. 2019. Positive ctDNA results allow opportunity to monitor treatment response and trending disease burden through longitudinal screening of ctDNA levels.

    Conclusion: This case study utilized three different molecular tests to inform and monitor cancer treatment. There are an increasing number of molecular genomic tests incorporated into practice, each with a unique purpose in the patient continuum of care that genetic professionals need to be aware of.

    N. Hook: A. Employment (full or part-time); Significant; Natera, Inc. J. Wallace: A. Employment (full or part-time); Significant; Natera, Inc. B. Zimmermann: A. Employment (full or part-time); Significant; Natera, Inc. N. Liang: A. Employment (full or part-time); Significant; Natera, Inc. R. Swenerton: A. Employment (full or part-time); Significant; Natera, Inc. U. Do: Other; Significant; Natera, Inc (past employee). S. Sawyer: A. Employment (full or part-time); Significant; Natera, Inc. J. Saucier: A. Employment (full or part-time); Significant; Natera, Inc. S. Parmar: A. Employment (full or part-time); Significant; Natera, Inc. A. Aleshin: A. Employment (full or part-time); Significant; Natera, Inc.

    E-P16.06 Decade-long progress of molecular genetics diagnostics of cystic fibrosis in Khanty-Mansi region (Russia)

    M. Donnikov1, V. Mescheryakov1, N. Satsuk2, A. Vorobyov1, L. Kolbasin3, I. Urvantseva4, O. Glotov5, A. Glotov6, L. Kovalenko1

    1Medical Institute of Surgut State University, Surgut, Russian Federation, 2Regional Children Clinical Hospital, Nizhnevartovsk, Russian Federation, 3Medical Genetics Counseling Service of Diagnostics and Cardiovascular Surgery Center (Cardiology Clinic) of KHMAO-Ugra, Surgut, Russian Federation, 4Diagnostics and Cardiovascular Surgery Center (Cardiology Clinic) of KHMAO-Ugra, Surgut, Russian Federation, 5Department of Genomic Medicine, D. O. Ott Research Institute of Obstetrics, Gynecology and Reproduction, Saint Petersburg, Russian Federation, Saint Petersburg, Russian Federation, 6Department of Genomic Medicine, D. O. Ott Research Institute of Obstetrics, Gynecology and Reproduction, Saint Petersburg, Russian Federation

    Introduction: Cystic fibrosis (CF) newborn screening since 2006 year provided patients surge requiring elucidation of genetic diagnosis but scarce molecular tools allowed detection of only major mutations specific for mixed Russian population. Introduction of high-resolution melting analysis (HRMA), MLPA, NGS techniques at regional genetics laboratory allowed to perform extensive genetic analysis of CFTR gene.

    Materials and methods: gDNA was obtained by whole-blood column extraction; HRMA performed by “PrecisionMelt Software” (Bio-Rad). MLPA performed with SALSA Probemix P091-D2_CFTR (MRC-Holland). NGS performed on MiSeq (Illumina) using NimbleGen SeqCap EZ_CysFib kit, mean coverage 70x. Raw data processed with bwa, GenomeAnalysisToolKit, annotated by dbNSFP (SnpEff, SnpSift), variants filtered by SNVViewer.

    Results: During 2009-2019 regional genetics laboratory studied 1,095 gDNA samples from newborns suspicious for CF. First three years only eight CFTR mutations were tested by allele-specific PCR. Successive introduction of HRMA, MLPA, Sanger sequencing and NGS allowed to perform comprehensive genetic analysis since 2014. We revealed 36 mutations (25 found once) in 110 alleles of 55 CF patients (with 2 CFTR mutations), including confirmed CF cases in 10 adult patients. Interestingly to note year-to-year increased proportion of North Caucasus mutations within regional mutation spectrum.

    Conclusions: Introduction of state-of-the-art techniques in regional genetics laboratory allowed to perform timely comprehensive genetic analysis of CFTR gene and deduce changes in regional mutations structure related to high migration rate of North Caucasians to Siberia.

    Mutant alleles list
    CFTR alleles (HGVS; legacy)Number (n=110)Frequency
    1c.1521_1523delCTT(p.Phe508del)580.527
    2c.1545_1546delTA(p.Tyr515X; 1677delTA)60.055
    3c.274G>A(p.Glu92Lys; E92K)50.046
    4c.54-5940_273+10250del21kb (p.Ser18ArgfsX16; dele2,3)40.036
    5c.3196C>T (p.Arg1066Cys; R1066C)40.036
    6c.413_415dupTAC (p.Leu138dup)20.018
    7c.1397C>G(p.Ser466X; S466X(TAG))20.018
    8c.1399C>T (p.Leu467Phe; L467F)20.018
    9c.3209G>A(p.Arg1070Gln; R1070Q)20.018
    10-36rare (published elsewhere)250.229 (sum)

    M. Donnikov: None. V. Mescheryakov: None. N. Satsuk: None. A. Vorobyov: None. L. Kolbasin: None. I. Urvantseva: None. O. Glotov: None. A. Glotov: None. L. Kovalenko: None.

    E-P16.07 Comparison of DNA extraction methods for samples from old blood collections

    S. Samut Tagliaferro, A. Zejnelagic, R. Farrugia, S. Bezzina Wettinger

    University of Malta, Msida, Malta

    Introduction: Limited information is available on which methods are suitable to extract DNA from 20-year-old blood samples and samples kept in non-ideal storage conditions. The aims of this study were to assess if DNA can be extracted from whole blood collected and stored at -20 °C for 7-20 years, and to identify which commercial DNA extraction kit is most suitable for this purpose, yielding good quality DNA.

    Materials and methods: Nine whole blood samples collected in 1999, 2001 and 2012, all having low (between 100 μL to 200 μL) blood volumes, were used in this study. DNA extraction was performed using three different DNA extraction kits, according to their respective instructions.

    Results: The Quick-DNA Miniprep Plus kit produced the highest DNA yield ranging from 0.51 – 20.2 µg, followed by the DNeasy Blood and Tissue kit which gave DNA yields ranging between 0.30 µg and 2.92 µg. In contrast, the MagAttract HMW DNA kit was less efficient at extracting DNA from these samples, with DNA yields ranging between 0.16 and 0.80 µg. The average yield was not affected by the age of the sample.

    Conclusion: From the results obtained, it can be concluded that good quality DNA can be extracted from whole blood samples biobanked for 18 to 20 years at -20 °C. This study was limited by the small number of samples. DNA concentrations were not affected by the number of years the blood sample was stored, but were affected by the type of kit used to extract the DNA.

    S. Samut Tagliaferro: None. A. Zejnelagic: None. R. Farrugia: None. S. Bezzina Wettinger: None.

    E-P16.08 Low density oligonucleotide microarray for the detection of ethnospecific mutations causing five genetic disorders prevalent among the Yakut population

    M. Savvina, N. Maksimova, A. Sukhomyasova

    North-Eastern federal university, Yakutsk, Russian Federation

    In yakut population of republic of Sakha (Yakutia) serious genetic disorders occur with relatively high frequency. There is a pressing need for comprehensive carrier screening and molecular diagnostic, but methods of genetic diagnostics that commonly used today are not able to afford it due to the high cost and time consumption for a single test. For such purposes, we developed an ethnicity-specific assay based on DNA microarray. Microarray is designed to address most prevalent mutations among yakut population: 4582_4583insT in CUL7 gene, с.5741G>A in NBAS gene, с.806С>Т in DIA1 gene, c.1090G>C in FAH gene, c.-23+1G>A in GBJ2 gene causing 3-M syndrome, SOPH-syndrome, Tyrosinemia type 1, Methaemoglobinaemia type 1, Nonsyndromic hearing loss and deafness (DFNB1) type 1A respectively. Oligonucleotide probes printed onto aldehyde group-coated glass slides using non-contact microarrayer. The assay based on reverse hybridization, which include two-step multiplex PCR reactions with production of one-stranded Cy5 labeled-PCR products following its hybridization with oligonucleotide probes. Using this microarray, we estimated heterozygose carrier frequency in 120 healthy people of yakut ethnicity and validated data by real-time PCR and PCR-RLFP methods. The evaluation of this microarray demonstrates that it is comprehensive, robust, sensitive, specific, and easily modifiable. The developed assay can be considered as an alternative cost-effective tool for genetic screening purposes and it is suitable for both carrier screening and disease diagnostics in yakut population in the republic of Sakha (Yakutia). The research is conducted under the state target program: project FSRG-2020-0014 “Genomic of Arctic: epidemiology, hereditary and pathology”

    M. Savvina: None. N. Maksimova: None. A. Sukhomyasova: None.

    E-P16.09 Lessons from 14 years of french cytogenetic EQA concerning clinical genetics

    M. Doco-Fenzy1, D. Sanlaville2, C. Missirian3, I. Luquet4, c. Terre5, C. Schluth-Bolard2, M. Till2, C. Sarrauste de Menthières6, J. Dupont7

    1Service de Génétique, CHU-Reims, Reims, France, 2Service de Génétique, CHU-Lyon Bron, Lyon, France, 3Service de Génétique, CHU la Timone, Marseille, France, 4Service d’hématologie, CHU-Toulouse, Toulouse, France, 5Service de Génétique, CHU-Versailles, Versailles, France, 6Génétique, IGH, Montpellier, Montpellier, France, 7Service de Génétique, chu Cochin, Paris, France

    The ACLF provides laboratories since 2005 with external quality assessments for the caryotype (including FISH) and array-CGH. More than 70 laboratories in constitutional cytogenetics, hematology and array-CGH participate each year. The evolution of our practices requires continuously adaptation but these EQAs and their European equivalents have made us aware of the state of knowledge and certain limitations reveal the loss of competence in classical cytogenetic analysis as well as of molecular pangenomic techniques. Indeed we have identified technical gaps or pitfalls that we will illustrate with 2 examples. Postnatal Cytogenetics: We proposed a pericentric chromosome 5 inversion inv(5)(p13q13) considered a variant in the literature. A large discrepancy was observed between laboratories reporting this chromosome a polymorphism and others reasoning as a classic pericentric inversion. The "youngest" cytogeneticists have lost experience regarding a variant not rece