Table 1 Sequences of primers and oligonucleotides

From: SEC24A identified as an essential mediator of thapsigargin-induced cell death in a genome-wide CRISPR/Cas9 screen

Identification Sequence (5’→3’)
Amplification primers for deep sequencing
  PCR1 forward primer AATGGACTATCATTGAAAGTATTTCG
  PCR1 reverse primer TCTACTATTCTTTGATGTGCGCTCTG
  PCR3 forward primer AATGATACGGCGACCACCGAGATC
  PCR3 reverse primer CAAGCAGAAGACGGCATACGAGAT
  U6 forward primer CGTGACGTAGAAAGTAATAATTTCTTGGG
sgRNA sequences
  MFSD2A sgRNA 1 GAACATGGTGAGAGCCGAGT
  MFSD2A sgRNA 1 GGAAACAAGGCGTGTCTGCT
  ARF sgRNA 1 TCTGCTTCTTGCCAAATAGT
  ARF sgRNA 2 CTAGTTGGATTGGATGCTGC
  SEC24A sgRNA 1 AGTAGTTACGACGAGATTGA
  SEC24A sgRNA 2 GCAGGACCACTATGAAGCGA
  SEC24A sgRNA 3 GGGATGATGCACGAGGACAA
  PNPLA8 sgRNA 1 ATCCGAATTCTCTCAATTGA
  EGFP sgRNA AGCTGGACGGCGACGTAAA
Amplification primers for Sanger sequencing
  SEC24A forward primer CAAGGATACAATTTCCAGCTTCCAG
  SEC24A reverse primer TATATTGCCAATTCAAAGGTGGTGG
  PNPLA8 forward primer TCAGGCTGTCAGCAAAGACA
  PNPLA8 reverse primer AGCTTTGGGTGTTATCCCTCT