Introduction

Anaplastic lymphoma kinase (ALK), normally expressed only in certain immature neural cells [1] acts as a potent oncogene in a number of diverse neoplasms, including distinct subsets of T- and B-cell lymphomas, inflammatory myofibroblastic tumors, lung adenocarcinoma, and familial and sporadic neuroblastomas [2,3,4]. With the exception of neuroblastomas in which the entire, albeit mutated, ALK gene is expressed, expression of ALK in other malignancies stems from chromosomal rearrangements fusing the ALK gene with various partner genes, largely specific for the given tumor type. In T-cell lymphomas (ALK + ALCL), the nucleophosmin (NPM1) gene is by far the most frequent fusion partner of the ALK gene [5]. The resulting NPM1::ALK chimeric protein is constitutively expressed and activated through autophosphorylation [5, 6]. NPM1::ALK is highly oncogenic, both in vitro and in vivo [7,8,9,10]. Strikingly, it is capable of transforming normal CD4 + T lymphocytes into immortalized and tumor-forming cells morphologically and immunophenotypically indistinguishable from patient-derived ALK + ALCL cells and tissues [11]. NPM1::ALK executes its oncogenic function by “highjacking” cell signaling pathways physiologically utilized in CD4 + T cells by IL-2 and other related cytokines [12], leading to activation of several cell signal transduction proteins including STAT3 [4, 13, 14]. Persistent activation of these signal transmitters leads to chronic modulation of expression of a number of genes, the protein products of which govern key cell functions such as cell proliferation, apoptosis, evasion of the immune response [15,16,17], protection from the negative effects of hypoxia [18, 19], and preservation of NPM1::ALK expression [4, 17, 20].

Nicotinamide adenine dinucleotide (NAD) plays an important role in cell metabolism and other functions [21,22,23]. NAD acts as a cofactor, or substrate, for key cellular enzymes such as sirtuins, poly(ADP-ribose) polymerase 1, and ADP-ribosyl cyclase involved in the synthesis of ATP. Nicotinamide phosphoribosyltransferase (NAMPT/Vistfatin/PBEF) is the rate-limiting enzyme involved in the synthesis salvage pathway of NAD by generating its precursor NMN, which is converted into NAD by the three members of the nicotinamide/nicotinic acid mononucleotide adenyltransferase family (NMNAT) 1, 2, and 3. In addition to intracellular NAMPT, this enzyme has also been identified as an extracellular form in cell supernatants and blood of patients with cancer and other diseases [22].

Here we report that NAMPT, the key enzyme in the NAD synthesis salvage pathway, is strongly and selectively expressed by ALK + ALCL cells and tissues. NAMPT expression is induced by NPM1::ALK through STAT3 which activates transcription of the NAMPT gene. Inhibition of NAMPT affects gene expression, metabolism, and intracellular signaling, strikingly including activation of NPM1::ALK itself. Ultimately, the inhibition leads to apoptotic cell death and growth inhibition, also in vivo. Pathogenic and translational implications of these findings are discussed.

Materials and methods

Cells and tissue samples

The cell lines were described previously [17, 19, 24]. In brief, SUDHL-1, JB6, Karpas 299, SUP-M2, L82, and SR786 cell lines were derived from ALK + ALCL patients. Mac-2A, Mac-2B, MyLa 2059, and MyLa 3675 were obtained from diverse transformed ALK-TCL involving skin, all with anaplastic cell morphology and CD30 expression. The NA1 cell line was established from normal CD4 + T cells by transduction with the NPM1::ALK gene [11, 25]. ALK inhibitor-resistant sub-cell line Karpas 299 was obtained from JH Schatz, University of Miami, Florida, USA. The cell lines are regularly tested by PCR for Mycoplasma contamination. T-cell-rich peripheral blood mononuclear cells (PBMC) were from healthy adults, with the subset stimulated in vitro for 5 days with a mitogen (PHA; Sigma) to generate PHA/PBMC blasts. ALK + ALCL tissues were obtained from biopsies performed for diagnostic purposes.

Immunohistochemical tissue analysis

Immunohistochemical staining of ALK + ALCL tissues, 24 of which were assembled in tissue microarrays, was done as described [17, 19, 24]. In brief, the slides were heat-treated and incubated with the primary antibodies to ALK (Dako), CD30 (Dako), and NAMPT/PBEF (Bethyl) at a 1:50 dilution.

Treatment of ALK + T cells with ALK and NAMPT Inhibitors

In the gene, protein and cell functional studies, we used one of the highly specific ALK inhibitors: CEP-28122; Cephalon or ceritinib (Selleckchem). Similar studies employed a highly specific and potent NAMPT inhibitor FK866 (APO866, daporinad; Selleckchem).

DNA oligonucleotide array

Total RNA from cells treated in triplicate cultures with CEP-28122 for 6 h was hybridized to a U133 Plus 2.0 or Human Gene 1.0 ST array (Affymetrix). The results were analyzed using Partek GS (Partek Inc.). The expressed genes were analyzed using KEGG, Ingenuity Pathway Analysis, and Gene Ontology databases.

RNA sequence (RNA-Seq) analysis

RNA was adapter-ligated and analyzed by high-throughput sequencing. Variants were called from the transcriptome using SAMtools and expression calculations were performed using the Cufflinks package. The expressed genes were identified using Partek algorithms and assigned to the cell pathways and programs using the above-mentioned databases.

Quantitative (q)RT-PCR

RNA was extracted (RNeasy kit; Qiagen) and reverse transcribed using an ABI high-capacity RNA-to-cDNA kit (Life Technologies). The fold difference in RNA levels was calculated on the basis of the difference between CT values (ΔCT) obtained for the investigated and control mRNA.

Western blotting

Western blotting was performed using antibodies against NAMPT (Abcam), total NPM1::ALK (BD Pharmingen), and phospho(p)-ALK (Y1604), p-STAT3 (Y705), p-AKT (S473), p-ERK (T202/204), and total ALK, STAT3, AKT, ERK, and total β-actin (Cell Signaling Technology), according to standard protocols.

NAMPT activity assay

Equal amount of protein lysates from SR786 and SUPM2 treated with medium (containing DMSO as a drug vehicle) or certinib and all three BaF3 cell populations were immunoprecipitated with NAMPT antibody (Bethyl Labs). The NAMPT bound to protein A/G dynabeads washed with TBST for three times and tested using NAMPT activity assay kit from MBL following the kit manufacturer’s recommendations. The activity was determined spectrophotometrically be measuring optical density (O.D.) value at 450 nm wavelength.

Quantification of NAD concentration

Cells were serum-starved for 24 h and treated with 10 nM FK866 for 24 h. Intracellular NAD concentrations were determined using the CycLex NAD+/NADH Colorimetric Assay Kit (Cyclex). NAD concentrations were normalized to protein concentrations in cell lysates. ATP Quantification. ATP concentration was measured using colorimetric assay kit (Abcam). Cells were treated with 10 nm FK866 for 48 h. The amount of ATP in each sample was normalized to the protein content for each test sample.

Short interfering RNA (siRNA) assay

A mixture of four ALK- STAT3-, or NAMPT-specific or control, non-targeting siRNAs (Dharmacon) was introduced into cells for 72 h as described [24].

Cas9/CRISPR assay

ALK + ALCL cell line SUDHL-1 was stably transduced with Cas9-containing lentiviral vector, single-cell cloned, and tested for Cas9 functional efficiency [26]. To target NAMPT gene, the Cas9-expressing SUDHL-1 cells were transduced with lentiviral vectors (VectorBuilder) containing E(enhanced)GFP and single guide (sg) RNA, either scrambled (control) or targeting NAMPT gene AGCCGAGTTCAACATCCTCC (sgNAMPT #1) or CTGGGAATGACAAAGCCCTC (sgNAMPT #2).

Electrophoretic mobility shift assay (EMSA)

Nuclear proteins were extracted and incubated with biotin-labeled DNA probes 5′- GTGACTTAAGCAACGGAGCG-3′corresponding to the Nampt gene promoter region that contains Stat3 GAS binding site, gel-separated and transferred to membranes. The blots were developed using HPR system (Pierce).

Chromatin immunoprecipitation (ChIP) assay

Cell lysates were incubated with anti-STAT and -IgG antibodies (R&D). The DNA–protein immunocomplexes were isolated with protein A-agarose beads and q-PCR-amplified them using primers specific for the NAMPT gene promoter (5′- CTCTCTCCGTTTCCCCCTCT -3′ and 5′- ATGTTGAACTCGGCTTCTGC-3′).

Luciferase reporter assay

The NAMPT promoter DNA sequence was PCR-amplified with primers 5′-TATAGGTAC-CCTCCCCTCTCTCCGTTTC-3′ and 5′-ATATCTCGAGTGTT-GAACTCGGCTTCTG-3′ (the italicized sequences represent nucleotides inserted to generate KpnI- and XhoI-specific restriction sites). The PCR product was cloned into the pGL3-basic luciferase reporter construct (Promega). Site-directed mutagenesis was used to mutate the Stat3-binding sites with the QuikChange Site-Directed Mutagenesis kit (Stratagene). The firefly luciferase constructs were generated to contain either wild-type (TTAAGCAA) or mutations of Stat3-binding sites (CGAAGCGC) or (CGGCGCAA). ALK + ALCL cell lines were transfected with the constructs using Electroporation Systems (BTX, ECM830), with phRL (Renilla luciferase) TK plasmids (Promega) serving as a control. Next, the cells were evaluated using the Dual-Luciferase Reporter Assay system (Promega).

MTT enzymatic conversion assay

Cells were plated in 96-well plates (3–5 × 103/well) and treated with 10 nM FK866 or the drug vehicle and labeled with MTT (Promega). Well contents were solubilized and absorbance was determined using a Titertek Multiskan reader.

Metabolite extraction and mass-spectrometry (MS) analysis

Cells were centrifuged by centrifugation, re-suspended, and pulse-sonicated. The supernatants were incubated, evaporated, and analyzed by LC-MS.

Soft agar colony formation assay

Cells were treated with 10 nM FK866 and seeded at 10,000/well in agar. Colonies measuring ≥50 cells were counted after 14 days of culture.

Apoptotic cell death assay

Cell spoptosis was analyzed using the Annexin-V-FLUOS Staining Kit (Roche). Propidium iodine (P.I.) uptake and Annexin V cell-surface staining were evaluated by flow cytometry 36 h post-treatment with FK866.

DNA fragmentation (tunnel) assay

ALK + ALCL cell lines were treated with FK866 or mock for 86 h. Cells were collected and fixed for TUNEL labeling (Roche Life Science) and analyzed by flow cytometry (LSR, BD Biosciences).

Enzyme immunoassay (EIA)

Soluble CD30 was detected using an EIA kit (Sigma). In brief, serum samples were deposited into wells pre-coated with an anti-CD30 antibody and incubated with another CD30 antibody conjugated to peroxidase. The OD values were determined using an ELISA plate reader.

Mouse xenograft studies

All experiments were IACUC-approved and conducted according to the NIH guidelines. To establish a lymphoma tumor model, we employed NSG mice (Jackson) and SUPM2 cells transduced in vitro with Click-bettle green protein gene. Mice were injected via the tail vein with 2 × 106 SUPM2. FK866 inhibitor at 30 mg/kg or PBS was administered daily via intraperitoneal route. Detection of disease was performed by bioluminescence imaging using a Xenogen Spectrum system and Living Image v4.0 software after intraperitoneal injection of 150 mg/kg D-luciferin (Caliper Life Sciences).

Results

ALK + ALCL cells and tissues express NAMPT

To identify genes potentially important in NPM1::ALK-mediated malignant cell transformation, we examined gene expression patterns on a genomic scale by DNA oligonucleotide array. Specifically, the ALK + ALCL-derived cell lines SUDHL-1 and SUP-M2 as well as the NPM1::ALK-transformed cell line NA1 were compared to T-lymphocyte rich normal peripheral blood mononuclear cells, either unstimulated (PBMC) or pre-stimulated with PHA (PBMC/PHA blasts). An important gene strongly and selectively expressed by all ALK + T-cell populations examined was NAMPT. NAMPT gene particularly stood out compared to genes that encoded enzymes from the NMAT family involved in the same NAD synthesis salvage pathway downstream of NAMPT and other molecules related to NAD (Fig. 1A and Supplementary Table 1). In contrast to ALK + T cells, NAMPT was barely expressed by PBMC and relatively weakly by PBMC/PHA blasts (Fig. 1A).

Fig. 1: Expression of NAMPT by ALK + T cells and tissues.
figure 1

A mRNA expression encoding key enzymes involved in the salvage NAD synthesis pathway: NAMPT and three members of the NMNAT family (1–3) in ALK + ALCL-derived cell lines (SUDHL-1 and SUP-M2), NPM1::ALK-transformed primary human CD4 + T cells (NA1) and control cell populations (resting PBMC and activated PBMC/PHA) detected by DNA oligonucleotide array analysis. B Expression of NAMPT mRNA in the six depicted ALK + ALCL cell lines, NA1, and control PBMC/PHA cells detected by qRT-PCR. C Expression of NAMPT protein in the depicted ALK + T-cell and control populations identified by Western blot. D Concentration of the final NAMPT product, active NAD, in the ALK + T cells and controls using a NAD+/NADH colorimetric assay. E Expression of NAMPT protein in representative ALK + ALCL tissue detected by immunohistochemistry (the images are at 400× magnification). Panels: upper left panel: H&E, upper right: ALK, lower left: CD30, and lower right: NAMPT.

Full size image

To confirm and expand our array-generated findings, we examined NAMPT mRNA expression in six ALK + ALCL-derived cell lines, NA1 cells and control PBMC/PHA blasts by RT-qPCR. While there was substantial variation in the concentration of NAMPT transcript among the ALK + T-cell populations, all but one expressed transcripts at higher concentrations than PBMC/PHA blasts (Fig. 1B). Expression of NAMPT mRNA correlated with expression of NAMPT intracellular protein detected by Western blotting (Fig. 1C) as well as its extracellular form identified by enzyme immunoassay (Supplementary Fig. 1A) in all seven ALK + T-cell populations examined. The presence of extracellular NAMPT was confirmed in two randomly selected ALK + ALCL cell lines by the combination of immunoprecipitation and Western blotting (Supplementary Fig. 1B). Expression of NAMPT also correlated with the concentration of its ultimate product NAD (Fig. 1D).

To establish that NAMPT protein is expressed not only in ALK + ALCL-derived cell lines but also in primary ALK + ALCL cells, we examined formalin-fixed, paraffin-embedded diagnostic tissue samples from 38 cases of ALK + ALCL by immunohistochemistry (Fig. 1E; a representative image). In all cases, essentially all malignant cells identified by morphology (upper left panel) and expression of ALK (upper right) and CD30 (lower left) strongly expressed NAMPT (lower right) while the admixed small, non-malignant lymphocytes and other stromal cells did not express this protein at a detectable concentration. These findings indicate that NAMPT expression is strong and universal in ALK + ALCL but remains essentially non-detectable in normal tumor-associated cells.

NPM1::ALK induces expression of the NAMPT gene

Because of the ubiquitous expression of NAMPT in ALK + ALCL cells and tissues (Fig. 1), we explored potential role of NPM1::ALK in activating the NAMPT gene. DNA oligonucleotide array-based analysis of gene expression by the NPM1::ALK + SUDHL-1, SUP-M2 and NA1 cells treated with a highly specific small molecule ALK inhibitor CEP-28122 or the drug vehicle alone indicated that NPM1::ALK induces activation of the NAMPT gene, since ALK inhibition profoundly decreased NAMPT mRNA expression (Fig. 2A). Of note, ALK inhibition did not affect mRNA expression by other genes related to NAD indicating that NPM1::ALK selectively targets NAMPT within this key metabolic program (Fig. 2A and Supplementary Table 2). RT-qPCR-based analysis confirmed the marked reduction in NAMPT mRNA in response to the relatively brief (6 h) inhibition of ALK (Fig. 2B). A similar reduction in expression was noted at the NAMPT protein level, both intracellular (Fig. 2C) and extracellular (Supplementary Fig. 1C) but a much longer drug exposure (24 h) was required to clearly see this suppressive effect, indicating a rather long half-life of NAMPT protein. Treatment of the ALK + ALCL cells with a second-generation, FDA-approved ALK inhibitor ceritinib yielded essentially identical results (Supplemental Fig. 2), confirming that ALK promotes NAMPT expression on the gene level. Similar to inhibition of NPM1::ALK enzymatic activity, siRNA-mediated NPM1::ALK depletion for 72 h profoundly inhibited expression of NAMPT mRNA (Fig. 2D) and protein (Fig. 2E) in all NPM1::ALK + T cell populations evaluated.

Fig. 2: NPM1::ALK-dependence of NAMPT expression.
figure 2

A Expression of NAMPT and NMNAT 1-3 mRNA detected by DNA oligonucleotide array in the depicted ALK + T-cell populations exposed to 100 nM of ALK inhibitor CEP-28122 or its vehicle alone. The p-values for ALK inhibitor- vs. medium-treated SUDHL-1, SUP-M2, and NA1 cells were: <0.001. B NAMPT mRNA expression examined by RT-qPCR in ALK + T cells treated with the ALK inhibitor or its vehicle. The p-values for untretaed vs. treated cells were <0.01 for the SUDHL-1, SUP-M2, L-82, and NA1 cells. C Western blot-detected expression of NAMPT and control proteins in ALK + T cells cultured with the ALK inhibitor or its medium vehicle alone. D Effect of siRNA-mediated NPM1::ALK depletion on expression of NAMPT mRNA in ALK + T cells, with cells exposed to non-specific (NS) siRNA serving as controls. The p values for NAMPT siRNA- vs. NS siRNA-treated cells were all <0.0001 for all ALK+ cell lines examined. E Effect of siRNA-mediated NPM1::ALK depletion on expression of NAMPT protein in ALK + T cells, with the NS siRNA-treated cells serving as controls.

Full size image

NPM1::ALK induces NAMPT gene expression through STAT3

Because NPM1::ALK induces gene expression by phosphorylating and, hence, activating transcription factors [4], we next focused on identifying the transcriptional activator of the NAMPT gene. Transcription factors such as the ones involved in circadian rhythm CLOCK and ARNTL (BMAL1) [27] as well as c-MYC [28] and IL-6-activated STAT3 [29] have been reported as activators of the NAMPT gene. While STAT3 is critical for ALK + ALCL cells and expression of c-MYC is significantly induced by NPM1::ALK (Supplementary Table 3), CLOCK expression is unaffected, and ARNTL is seemingly inhibited, making the latter two proteins unlikely regulators of the NAMPT gene in ALK + ALCL cells. Indeed, siRNA-mediated depletion of neither CLOCK (Supplementary Fig. 3A) nor ARNTL (Supplementary Fig. 3B) had any effect on NAMPT expression in three different ALK + T-cell lines. Similarly, depletion of either c-MYC (Supplementary Fig. 3C) or ERK1 or ERK2, (Supplementary Fig. 3D), two closely-related kinases activated by NPM1::ALK [12], had no effect on NAMPT expression, indicating that none of these proteins is involved in the regulation of the NAMPT gene’s expression, at least in ALK + T cells.

Given the extensive evidence that the transcription factor STAT3 is the key effector of NPM1::ALK-mediated oncogenesis [2, 4, 13,14,15,16,17,18,19,20, 30], we explored whether STAT3 activates the NAMPT gene. Sequence analysis of the promoter region of the NAMPT gene identified two potential STAT3 binding sites containing the canonical TT and AA dinucleotides (Supplementary Fig. 4A). Using electrophoretic mobility shift assays (EMSA), we detected binding of proteins in cell extracts from all five ALK + T-cell lines examined to the 23-mer DNA oligonucleotide probes corresponding to the STAT3 binding regions, one proximal to the ATG start codon (Fig. 3A and Supplementary Fig. 4B) and the other more distal (Supplementary Fig. 5A). The binding to both sites was specific, as demonstrated by its abrogation by an unlabeled (cold) probe (Fig. 3A and Supplementary Fig. 5B). Identity of STAT3 as the protein bound to the sites was established using a “super-shift” EMSA assay, where an antibody against STAT3 but not a control anti-IgG antibody, further delayed migration of the probes containing the STAT3 binding sites (Fig. 3A, right panel; the proximal site and Supplementary Fig. 5C; the distal site).

Fig. 3: STAT3-dependence of NAMPT expression.
figure 3

A Binding of the transcription factor STAT3 to the proximal part of the NAMPT gene promoter in vitro detected by EMSA in the depicted ALK + ALCL cell lines. In some experiments the cell lysates were pre-incubated with unlabeled (“cold”) DNA oligonucleotide probe (left panel), in the other with a STAT3-specific ab (right panel: “supershift” EMSA). B Binding of STAT3 to the proximal NAMPT promoter in ALK + ALCL cells in vivo detected by ChIP assay. The p values for STAT3 antibody- vs. control IgG-purified isolates were <0.01 for all three cell lines examined. C STAT3-mediated activation of the NAMPT promoter sequence in ALK + ALCL cells, as determined by a luciferase reporter assay employing “wild-type” sequence of the proximal STAT3 binding site TTAAGCAA or mutant forms CGAAGCGC (Mutant 1) or CGGCGCAA (Mutant 2). The p values for wild-type promoter vs. promoters #1 and #2 mutants were <0.01 and vs. control empty vector <0.001. for both cell lines. D Impact of siRNA-mediated STAT3 depletion on expression of NAMPT mRNA in the ALK + T cells, with cells exposed to NS siRNA serving as controls. P values for STAT3 vs. control (NS) siRNA were at least <0.01 for all cell lines examined. E Impact of siRNA-mediated STAT3 depletion on expression of NAMPT protein in ALK + T cells, with NS siRNA-treated cells serving as controls.

Full size image

To demonstrate that STAT3 also binds to the NAMPT promoter in vivo, we performed chromatin immunoprecipitation (ChIP) assays using anti-STAT3 and, as a control, anti-IgG antibody as well as two sets of PCR primers that amplify promoter segments containing either the proximal, or distal, STAT3 binding site. Strong and specific binding of STAT3 to both sites in the promoter was identified, as it was ~50-fold more robust in the STAT3 antibody immunoprecipitates as compared to the IgG antibody immunoprecipitates (Fig. 3B and Supplementary Fig. 5D). To provide functional evidence that STAT3 activates the NAMPT promoter, we performed a luciferase reporter assay (Fig. 3C). Upon transfection into two different ALK + ALCL cell lines, the NAMPT promoter construct displayed 25-fold higher activity than the control construct containing only the luciferase gene. Of note, very limited mutations within the entire 197 bp construct of only four bases in the STAT3 binding-site sequence: TTAAGCAA to CGAAGCCG (mutant 1; Supplementary Fig. 6A) or CGCGGCAA (mutant 2; Supplementary Fig. 6B), essentially abrogated the promoter’s transcriptional activity, stressing the critical role of STAT3 in its activation.

Finally, to document that STAT3 is indeed required for the expression of NAMPT, we siRNA-depleted the transcription factor in seven different ALK + T-cell lines. STAT3 depletion profoundly suppressed expression of NAMPT mRNA (Fig. 3D) and protein (Fig. 3E) in all the cell lines examined.

ALK + T cells depend on the enzymatic activity of NAMPT for energy and growth

To determine the role of NAMPT in ALK + T cells, we took advantage of the availability of the highly active and specific inhibitor of NAMPT called FK866 (APO866) [22, 31]. Exposure of the panel of ALK + T cells to various doses of the inhibitor demonstrated that FK866 is extremely active in ALK + T cells by essentially completely inhibiting NAD synthesis at the lowest concentration examined (Fig. 4A). siRNA-mediated depletion of NAMPT (Supplementary Fig. 7) has also proven to be highly effective in inhibiting expression of NAD (Fig. 4B); inhibition of NAMPT by a low dose of FK866 led to depletion of ATP (Fig. 4C) which correlated with the suppression of ALK + ALCL cell growth induced by siRNA-mediated NAMPT depletion (Fig. 4E).

Fig. 4: NAMPT-dependence of ALK + T cells.
figure 4

A Effect of the NAPMT inhibitor FK866 on NAD concentration in ALK + T cells. P values for treated cells vs. controls were <0.01 for all seven cell lines examined. B Effect of NAPMT siRNA in ALK + T cells on NAD concentration (upper panel) and, as control, NAMPT expression (lower panel). P values for NAMPT siRNA-exposed vs. control (NS) siRNA-exposed cells were <0.01 for all three cell lines examined. C Impact of FK866 (1 nM) on ATP concentration in ALK + T cells, determined by an ATP-specific colorimetric assay. P values for FK866-treated cells vs. controls were <0.01 for all seven cell lines examined. D Impact of NAMPT siRNA on ALK + T-cell growth as seen in the MTT conversion assay. P values for NAMPT siRNA-exposed vs. control (NS) siRNA-exposed cells were <0.01 for all three cell lines examined.

Full size image

NAMPT inhibition affects ALK + ALCL cells by suppressing cell signaling and metabolic pathways

To gain insight into the mechanisms of NAMPT inhibitor activity, we next examined the effects of FK866 on gene expression on the genome scale. A total of 273 genes were downregulated and 87 genes upregulated by at least two-fold in SUP-M2 cells exposed to FK866 for 6 h with cells exposed to the drug vehicle serving as a control. Functional in silico analysis of down-regulated genes revealed that they belong to diverse cell pathways and programs, foremost: cell signaling, metabolism, and apoptosis (Supplementary Table 4).

Given these genomic results and the well-described role of NAD in fueling cell metabolism [21, 22], we analyzed the impact of NAMPT inhibition on cell metabolic pathways. As shown in Fig. 5A, FK866 profundly affected the key metabolic pathways, foremost glycolysis, the pentose shunt, and the TCA cycle in the SUP-M2 cells. In regard to glycolysis, the enzyme seemingly most down-regulated was fructose-biphosphate aldolase, considering the marked increase in its upstream substrate G6P and direct F1,6BP substrate, respectively, and decrease in its direct and indirect metabolic products GAP and DHAP. In regard to the pentose shunt (PPP), two metabolites were markedly decreased 6PG and Ribo5P, indicating impaired function of 6PG dehydrogenase and Ribo5P isomerase (RPI), respectively. In the TCA cycle, marked accumulation of malate and oxaloacetate (OAA) occurred, consistent with inactivation of the PDH complex and citrate synthase along with malic enzymes (ME) which convert malate to pyruvate in an NAD-dependent manner.

Fig. 5: Inhibition of NAMPT induces functional changes in ALK + ALCL cells.
figure 5

A Impact of NAMPT inhibitor on metabolic pathways. SUP-M2 cells were exposed to FK866 at 1 nM or the drug vehicle alone for 48 h and evaluated for the concentration of metabolites from the depicted metabolites. P-values for the FK866-exposed vs non-exposed cells were: G6P: <0.003), Fruc(F)-1,6 -BP: <0.003), 6-P-Gluconate (6PG): <0.0004, AKG: <0.0003, Malate: <0.0002, OAA: <0.014, Aspartate (ASP): <0.00003, and Acetoacetate (AA): <0.0017. B Effect of NAMPT inhibition on cell signaling pathways in ALK + ALCL cells. SUP-M2 and SR786 cells were exposed to 10 nM of FK866 or the drug vehicle for 48 h and examined by Western blot for the phosphorylation status and total protein expression of the listed proteins. Expression of the corresponding total proteins as well as NAMPT and ß-actin (ACTB) served as control. Effect of NAMPT inhibition on growth of ALK+ and ALK- ALCL cells (C) as well as PBMC and PHA/PBMC from three healthy donors (D). The cells were exposed for 48 h to the stated concentrations of the NAMPT inhibitor FK866 and evaluated in the MTT conversion assay. E NAMPT inhibition amplifies the effect of ALK inhibition. ALK + ALCL Karpas 299 cells were treated for 48 h with drug vehicle DMSO, ALK inhibitor (ALKi) ceritinib (50 nM), NAMPT inhibitor FK866 (10 nM) or the drug combination and examined for cell viability (***p < 0.0002, **p < 0.001). F NAMPT inhibition retains activity in ALK inhibitor-resistant ALK + ALCL cells. Parental Karpas 299 cell line (left 3 columns) and its ALKi-resistant subline (right 3 columns) were treated for 48 h with DMSO, ceritinib (50 nM), or FK866 (10 nM) and examined for synthesis of NAD, the ultimate product of NAMPT. ***p < 0.0001.

Full size image

Considering the profound and multifaceted impact of NAMPT inhibition on metabolic pathways in ALK + ALCL cells (Fig. 5B), we explored its effect on NPM1::ALK-dependent cell signaling pathways. Strikingly, NAMPT inhibition profoundly suppressed activation of NPM1::ALK itself (Fig. 5C) and, likely as a consequence, activation of cell-signaling pathways down-stream of NPM1::ALK, as determined by auto-phosphorylation of NPM1::ALK and phosphorylation of AKT and ERK, respectively. In contrast to AKT, MAPK 1/3, and even NPM1::ALK itself, no change STAT3 Y705 phosphorylation could be detected under the same experimental conditions (not shown), suggesting functional preference of NPM1::ALK for this phosphorylation target. Of note, Cas9/CRISPR-induced NAMPT depletion using two different NAMPT single guide (sg)RNA constructs also profoundly inhibited NPM1::ALK enzymatic activity as detected by its loss of autophosphorylation (Supplementary Fig. 8). Because NAD is required to synthesize ATP [22, 23] and NAMPT inhibition indeed suppresses ATP synthesis in ALK + ALCL cells (Fig. 4C), these data reveal the fundamental role of NAMPT in the NPM1::ALK-driven oncogenesis by its critical role in securing ATP-based energy supply for NPM1::ALK to support its enzymatic activity.

Pharmacologic NAMPT inhibition suppresses growth of ALK+ and ALK- ALCL cells

We examined next impact of pharmacologic NAMPT inhibition on growth of ALK + ALCL and ALK-ALCL cell; normal T-cell rich PBMC and PHA/PBMC blasts were included in these studies for comparison. Growth of both ALK+ and ALK- ALCL cell lines was profoundly inhibited by FK866 inhibitor, as determined in the MTT conversion assay (Fig. 5C) with some differences in the inhibitor IC50 (~2–5 nM vs. ~20–40 nM) among these populations. These differences correlated with concentration of NAMPT in the cells, tested simultaneously by Western blots (Supplementary Fig. 10), suggesting that the higher NAMPT expression requires more of FK866 to achieve optimal inhibition of this metabolic enzyme and cell growth suppression. In striking contrast to the malignant cells, normal T-cell-rich PBMC and PHA/PBMC blasts displayed only partial sensitivity to FK866 (Fig. 5D), not exceeding 40% for the former and 60% for the latter, even in the presence of higher drug concentrations of up to 80 nM. These results indicate that malignant ALK+ and ALK- ALCL cells strictly depend for growth on NAMPT to generate NAD as an indispensable source of energy, while normal T cells are much less dependent on NAMPT, most likely by being able to produce NAD also through pathway(s) independent of NAMPT, such as the de novo and Preiss-Handler pathways [21,22,23]. Of note, combination of ALK and NAMPT inhibitors has been more effective against ALK + ALCL cells that either inhibitor alone (Fig. 5E), suggesting that not only the combination may be quite efficacious therapeutically but perhaps also it may prevent, or substantially delay, development of drug resistance. The ability of NAMPT to inhibit growth of not only ALK inhibitor-sensitive but also -resistant cells as measured by their ability to synthesize NAD (Fig. 5F), further supports these notions.

Inhibition of NAMPT suppresses colony formation and results in apoptotic cell death of ALK + ALCL cells

To better characterize the nature of dependence on NAMPT for ALK + T cell growth, we examined the impact of FK866 on cell colony formation in soft agar. The drug essentially abrogated formation of colonies by four different ALK + ALCL cell lines examined (Fig. 6A and Supplementary Fig. 9). Importantly, FK866 induced extensive apoptotic cell death of ALK + T cell lines, as determined in both the DNA fragmentation (tunel) and P.I. uptake/Annexin V expression assays (Fig. 6B, C, respectively). ALK-ALCL and PBMC/PHA blasts with ALK + ALCL cells serving as controls, have shown that the ALK-ALCL Mac-2A and -2B cells displayed degree of cell death comparable to ALK + ALCL cells. MyLa cells, in particular MyLa 2059, were reproducibly less affected and PBMC/PHA blasts showed a minimal degree of FK866-induced cell death. These results, combined with the data shown in Fig. 5C, D, strongly suggest that NAMPT inhibition may prove therapeutically efficacious in ALK + ALCL and at least some subtypes of ALK-ALCL, with a limited inhibitory effect on normal lymphocytes.

Fig. 6: NAMPT inhibition induces apoptosis of ALK + T cells.
figure 6

A Colony formation in soft agar in the presence or absence of the NAPMT inhibitor FK866. Effect of FK866 on viability of ALK + T cells identified by a DNA fragmentation (tunnel) assay (B) and P.I. uptake/Annexin V cell-surface expression assay (C).

Full size image

Inhibition of NAMPT suppresses growth of ALK + ALCL cells in vivo

Finally, to examine the effect of NAMPT inhibition on ALK + ALCL tumor growth, we injected immunodeficient NSG mice with SUP-M2 cells expressing the Click-beatle green protein permitting detection of cells by bioluminescence. The mice were treated daily with FK866 or drug vehicle; as shown in Fig. 7A, B, a marked suppression of tumor growth was observed in response to the drug. Examination of the autopsy-collected mouse serum samples for soluble human CD30 further indicated strong inhibition of the ALK + ALCL cell growth in vivo since the concentration of this lymphoma marker was much lower in the FK866-treated mice vs. control mice (Fig. 7C). The in vivo bioluminescence findings were further confirmed by examination of mouse tissues, in which the tumor burden was markedly lower in the FK866-treated mice when compared to the control mice as determined by morphology and staining for ALK and CD30 (Fig. 7D; representative images). No drug toxicity was identified as liver, kidneys, and other organs displayed normal cell morphology.

Fig. 7: Inhibition of NAMPT suppresses growth of ALK + ALCL cells in vivo.
figure 7

ALK + ALCL (SUP-M2, expressing a luminescence marker) cells were injected via tail vain into NSG mice. After the tumor establishment was detected by bioluminescence, mice were treated daily with NAMPT inhibitor FK866 or drug vehicle and monitored by the bioluminescence twice a week. A ALK + ALCL tumor growth curves evaluated by bioluminescence measured at the depicted days after initiation of the therapy. The p-values for the calculated tumor volume between the FK866-treated vs. drug vehicle-treated cohorts reached <0.024, <0.047, and <0.019 on days 20, 23, and 27, respectively. B Bioluminescence images of one of the control mice and four representative FK866-treated mice obtained at the listed time intervals after initiation of the therapy. C Serum concentration of soluble human CD30 (pg/mL) in the blood samples collected at the autopsy from the control drug vehicle- and NAMPT inhibitor (FK866)-treated mice. P value for the mean soluble human CD30 concentration in serum samples from the FK866-treated vs. drug vehicle-treated mice was <0.001. D Microscopic images of the representative mouse tissues harvested at autopsy on day 27 visualized by H&E stain or immunohistochemical stains for ALK and CD30 to highlight the ALK + ALCL cells. Main images: 100×, insets: 400× magnifications.

Full size image

Discussion

Previous studies have demonstrated that NPM1::ALK is an extremely potent oncogene [2,3,4, 7, 8, 10, 11, 25]. Among the signaling proteins activated by NPM1::ALK, STAT3 transcription factor has emerged as the most prominent [2, 4, 13,14,15,16,17,18,19,20, 30]. In ALK + ALCL cells, STAT3 induces expression of proto-oncogenes as well as inhibits expression of tumor suppressor genes, often by fostering epigenetic silencing of the gene promoters [2, 4, 13,14,15,16,17,18,19,20, 30]. Whereas protein products of induced proto-oncogenes promote cell proliferation, survival, protection from hypoxia, tumor immune evasion, and epigenetic gene silencing [2, 4, 13,14,15,16,17,18,19, 32] products of inhibited tumor suppressor genes interfere mainly with NPM1::ALK function and expression [4, 20, 30, 33, 34].

In this report, we present evidence that NPM1::ALK induces strong, persistent, and universal expression of NAMPT, the key rate-limiting enzyme of the NAD synthesis salvage pathway. As depicted schematically in Fig. 8, NPM1::ALK promotes NAMPT through STAT3 that binds to the promoter of the NAMPT gene and activates its transcription. Of note, NAMPT is critical for the oncogenic activity of NPM1::ALK, as it affects expression of a number of genes related to cell signaling, metabolism, programmed cell death, and other cell functions, fuels key cell metabolic pathways, foremost glycolysis, the TCA cycle, and the pentose shunt. Strikingly, NAMPT supports cell signaling including enzymatic activity of NPM1::ALK itself. Given this critical role of NAMPT in ALK + ALCL cells, it is not surprising that inhibition of NAMPT results in apoptotic cell death in vitro and suppression of ALK + ALCL tumor growth in vivo. Notably, this key role of NAMPT seems specific for malignant T cells from ALK + ALCL and ALK-ALCL since normal T lymphocytes, resting or mitogen-preactivated, are much less sensitive to NAMPT inhibition, most likely by being able to generate NAD also independently of NAMPT through alternative NAD synthesis pathways [21,22,23]. Consequently, these results strongly suggest that NAMPT is a novel and attractive therapeutic target in ALK + ALCL and possibly some types of ALK-ALCL.

Fig. 8: Schematic diagram of the mechanistic links between NPM1::ALK and NAMPT.
figure 8

The oncogenic tyrosine kinase NPM1::ALK induces via STAT3 expression of NAMPT gene. NPM1::ALK depends on NAMPT, the key metabolic enzyme which is rate-limiting in the salvage NAD synthesis pathway to secure its own oncogenic enzymatic activity which includes regulation of gene expression and cell metabolism as well as, ultimately, promotion of cell growth and survival (black lines). Inhibition of NAMPT enzymatic activity by small-molecule inhibitor impairs NAD synthesis and, consequently, inhibits down-stream ATP synthesis, and, as the ultimate result, impairs enzymatic activity of NPM1::ALK and, hence, its oncogenic function (blue lines).

Full size image

NAMPT is expressed in numerous types of cancer including colorectal, ovarian, breast, gastric, and prostatic carcinomas, gliomas, and B-cell lymphomas [22, 35,36,37]. The study by Nagel et al. [38] of 100 cell lines from diverse hematopoietic malignancies identified by far the highest NAMPT mRNA expression in three out of four ALK + ALCL cell lines examined, suggesting that this type of lymphoma may be highly dependent on NAMPT. However, the underlying mechanisms of NAMPT expression in malignant cells of any kind remained essentially unknown. Our data link for the first time an oncogenic kinase to the induction of NAMPT expression and NAD synthesis. They also provide evidence that oncogenesis and the heightened metabolic status of malignant cells are intimately mechanistically linked. Our finding that NPM1::ALK induces NAMPT expression indicates that, in addition to providing direct oncogenic signals resulting in cell immortalization and proliferation, NPM1::ALK promotes the generation of an adequate energy supply to meet the considerable metabolic needs of highly malignant ALK + ALCL cells. Previous studies have implicated NPM1::ALK in the regulation of cell metabolism by its ability to activate the mTORC1 complex [39], a key sensor and coordinator of cytokine/growth factor-generated cell signaling and metabolic status. Inhibition of mTORC1 by a rapamycin-type inhibitor suppresses growth of ALK + ALCL cells [39]. Our findings implicating NPM1::ALK in induction of NAMPT, the key rate-limiting enzyme of the NAD synthesis salvage pathway, places this oncogenic kinase as a direct regulator of this critical aspect of cell metabolism. Consequently, it also strongly suggests that similar regulatory mechanisms of cell metabolism by genetic drivers of oncogenesis apply to cancer in general. Accordingly, it remains to be determined if in ALK-ALCL cells which are also profoundly affected by NAMPT inhibition (Fig. 5 and Supplementary Fig. 11), the oncogenic kinase(s) functionally similar to NPM1::ALK [12, 40] also experience impairment of their enzymatic activity. Furthermore, potential involvement of STAT3 [40] in regulation of NAMPT gene in ALK-ALCL in analogy to ALK + ALCL as shown in this report, also needs to be examined.

While the important role of NAD in cell metabolism is well-established, our results demonstrate a critical role for NAMPT specifically in ALK + ALCL cells with NAMPT affecting key metabolic pathways: glycolysis, the pentose shunt, and the TCA cycle (Fig. 5A). All three of these metabolic programs were profoundly impaired by NAMPT inhibition including strong suppression of early stages of glycolysis and the pentose shunt highlighting the central role of NAMPT in governing general metabolism in ALK + ALCL; a metabolically highly active type of lymphoma judging from its large cell morphology, high proliferative index and now, very high expression of NAMPT and high rate of NAD synthesis (Fig. 1). The dependence of cell signaling on NAMPT including NPM1::ALK activation itself, as determined by the kinase’s autophosphorylation status (Fig. 5B), provides further striking evidence of the key role of NAMPT in NPM1::ALK-mediated malignant cell transformation. Whereas NPM1::ALK and other kinases typically use ATP to fuel their enzymatic reactions and as the source of phosphate, our data indicate that NAMPT and, hence, NAD are also critical for sustaining enzymatic activity of NPM1::ALK by affecting the concentration of intracellular ATP (Fig. 4C).

Considering the known multitude of cell functions energetically supported by NAD, it is very likely that NAMPT inhibition affects also ALK + ALCL cells independently of its effect on NPM1::ALK activity. However, this possibility does not diminish the importance of the NAMPT inhibition-triggered ATP “starvation” of NPM1::ALK, given the central role of this fusion kinase in the pathogenesis of ALK + ALCL [2,3,4,5,6,7,8,9,10,11].

The essential role of NAMPT in NPM1::ALK-mediated malignant cell transformation described in this work may have major therapeutic implications. Current efforts in targeted therapy of malignancies driven by ALK and similar oncogenic kinases concentrate on inhibition of their enzymatic activity [2,3,4,5, 41, 42]. Indeed, clinical studies have demonstrated that small molecule-mediated inhibition of ALK is a highly effective therapy in advanced ALK + ALCL in both adults [43, 44] and children [45, 46] as well as in other ALK+ malignancies, with lung adenocarcinoma being the most extensively evaluated [47,48,49]. However, drug resistance, typically due to mutations of the ALK gene frequently, if not inevitably, develops [47, 50, 51]. It can be argued, therefore, that combination therapies targeting ALK as well as its downstream effector proteins such as NAMPT may prove highly beneficial and may diminish the risk of drug resistance by inhibiting ALK not only directly but also by depriving it of the energy supply required to sustain its enzymatic activity. FK866, a highly specific and active NAMPT inhibitor has already shown activity against acute myeloid leukemia and B-cell lymphomas in pre-clinical in vitro and in vivo models [52,53,54]; additional NAMPT inhibitors including GMX1778 and OT-82 are at various stages of investigation [55, 56]. Furthermore, FK866 displayed low toxicity [31, 36, 37] in phase I and antitumor activity as a single agent in phase II clinical trial in various cancers including advanced melanoma. However, certain toxicities, foremost thrombocytopenia, have been noted in patients chronically exposed to the compound. Our results suggest that NAMPT inhibition may prove highly effective in malignancies such as ALK + ALCL which are selectively dependent on activity of this metabolic enzyme. While normal activated T lymphocytes were also affected by NAMPT inhibition, this effect was much less pronounced indicating the existence of a considerable “therapeutic window” for compounds targeting NAMPT. A distinct subset of glioblastomas which carry mutation of the IDH1 gene is also very sensitive to NAMPT inhibition [57]. Therefore, therapy with NAMPT inhibitors may need to focus on cancers that display high degree of dependence on this enzyme, rather than solely showing expression of the NAMPT protein. This tumor-type targeted approach may increase drug efficacy and limit toxicities. Furthermore, combination therapy of an NAMPT inhibitor with other compounds may prove highly effective. In regard to ALK + ALCL, combination with an CD30 antibody-toxin conjugate could be the most attractive among several other options [4] as this conjugate is highly effective as a single agent in this entity [58, 59].

Finally, it was found that normal murine hepatocytes express much less NAMPT in the morning (with nadir at 10 A.M.) than in the evening (peak at 9 PM; [60]), whereas c-MYC-driven malignant cells express NAMPT at a much more steady rate [28]. This observation suggests that deregulated expression of NAMPT in cancer opens even wider a therapeutic window when the circadian rhythm of NAMPT synthesis by normal cells is taken into consideration to further diminish the dose-limiting toxicity of thrombocytopenia.

In summary, we report that NPM1::ALK induces via STAT3 expression of NAMPT and, strikingly, strictly depends on NAMPT activity to induce and sustain malignant cell phenotype by affecting key cellular functions, foremost activation of metabolic and signaling pathways including enzymatic activity of NPM1::ALK itself. These findings strongly suggest that NAMPT is an attractive novel therapeutic target in ALK + ALCL and other ALK-driven malignancies. In the broader perspective, our results suggest that oncogenic kinases selectively hyperactivate specific metabolic pathways, similar to the “standard” intracellular signaling pathways. Similar to ALK, other oncogenic kinases most likely also depend selectively on specific metabolic pathways. Therefore, selective targeting of these metabolic pathways may prove highly effective as an alternative, or more likely complementary therapeutic approach to direct kinase inhibition.