Introduction

Surgery, disease, burns, or sports-related injuries always lead to skin wounds, and wound healing is an intricate and long-term process that involves cell proliferation, cell migration, collagen fibre formation, epidermal tissue formation, etc [1]. It has been reported that ADSCs affect the biofunction of skin fibroblasts via the paracrine effect of multiple growth factors, thereby promoting wound healing [2]. However, the underlying mechanism by which ADSCs promote skin wound healing remains unclear.

Cell bioactivities play vital roles in various biological processes, including embryogenesis, angiogenesis, inflammation, and skin wound healing [3]. Yao et al. reported that P311 promotes epidermal stem cell migration and invasion to accelerate skin wound healing [4]. Moreover, exosomes are a pivotal medium in the skin wound healing process [5]. Exosomes are ~30–150 nm in size and contain various macromolecular substances, and these macromolecules mediate local or systemic intercellular communication via target cells [6]. Previous studies indicate that ADSC-Exos regulate various cell bioactivities, including cell migration, invasion, autophagy and apoptosis. ADSC-Exos upregulated matrix metalloprotein 9 (MMP-9) expression via the PI3K/AKT pathway to accelerate HaCaT cell bioactivity [7] and promoted podocyte autophagy via the Smad1/mTOR signalling pathway in diabetic foot ulcers (DFUs) [8]. In addition, ADSC-Exos reduced endothelial cell inflammation and apoptosis by inhibiting TRADD expression [9]. Skin wound healing was accelerated by promoting angiogenesis in a rat model of DFUs [10]. However, the biofunction of ADSC-Exos in skin wound healing, as well as the potential underlying mechanism, remain unclear.

Long noncoding RNAs (lncRNAs) are vital intracellular regulatory molecules that function in various physiological processes [8]. It is worth noting that lncRNA H19 belongs to the highly conserved imprinted gene cluster and plays a regulatory role in cell bioactivity. H19 promotes liver cancer cell bioactivities by targeting miR-15b by activating the CDC42/PAK1 pathway [11]. H19 acts as a ceRNA of miR-29b-3p to regulate the epithelial-mesenchymal transition and metastasis of bladder cancer [12]. In addition, it has been reported that ADSC-Exos contain various lncRNAs, including H19. Jin et al. showed that extracellular vesicles secreted by ADSCs increase the survival rate of rats with acute liver failure by releasing H19 [13]. StarBase database analysis showed that H19 serves as a sponge for miR-19b, and this interaction promotes stem cell differentiation [11]. However, the physical interaction between H19 and miR-19b in skin wound healing remains unclear.

SRY-related high-mobility-group box 9 (SOX9) belongs to the SOX family of transcription factors and plays a vital role in skin wound healing. Ge et al. suggested that SOX9 promotes the proliferation, differentiation and adipogenesis of primary cultured human sebaceous cells [14]. In addition, SOX9 plays a positive role in cartilage formation [15]. Moreover, SOX9 is targeted by multiple miRNAs, including miR-19b, miR-590-3p and miR-101 [16]. StarBase database analysis showed that a binding site between miR-19b and SOX9 was observed. Therefore, we speculate that SOX9 may promote skin wound healing by targeting miR-19b.

In this paper, we speculated that ADSC-Exos, which contain H19, may interact with miR-19b and SOX9 to promote skin wound healing. Our findings may provide a promising means of cell-free treatment for skin wound healing.

Materials and methods

Ethics statement

The study was approved by the Institutional Review Board of the First Affiliated Hospital of Kunming Medical University and was conducted in strict accordance with the Declaration of Helsinki. Written informed consent was obtained from each participant. The animal protocol and experimental procedure was approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Kunming Medical University Hospital.

Cell lines and culture

Human skin fibroblast (HSF) cells were provided by Yun University (Yunnan, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Roche, Basel, Switzerland), supplemented with 1% penicillin-streptomycin solution (Solarbio, Beijing, China) and 10% FBS, and the cells were cultured in a humidified incubator containing 5% CO2 at 37 °C.

Isolation and identification of ADSCs

ADSCs were isolated from human adipose tissues according to a previously described method [17]. When the ADSCs grew to 80–90%, they were digested with trypsin and filtered with a cell strainer with a pore size of 100 µm. Subsequently, the ADSCs were resuspended in prechilled 1 × PBS buffer at a density of 2 × 105 cells/mL. ADSCs were stained with anti-CD105 (1:1000), anti-CD44 (1:1000), anti-CD90 (1:1000), anti-CD34 (1:1000), and anti-CD45 (1:1000) antibodies. All the antibodies were purchased from Santa Cruz (San Francisco, USA). Furthermore, the ADSCs were stained with FITC-labelled secondary antibodies for 30 min and washed twice with 1 × PBS. Finally, Flow Jo was used to generate the graphs, and MoFlo XDP software was used for all the flow cytometry data analyses.

Isolation and identification of ADSC-Exos

ADSC-Exos were isolated from ADSCs by using Ribo™ Exosome Isolation Reagent (RiboBio, Guangzhou, China) according to the manufacturer’s instructions. Transmission electron microscopy (BD Biosciences, San Diego, CA) was used to observe the morphology of ADSC-Exos, and Western blotting was conducted to identify ADSC surface marker antigens, including CD9, CD63 and CD81. Anti-CD9 antibodies were purchased from Santa Cruz. The protein content, which was used to quantify the exosomes, was determined using a BCA protein assay kit (CWBIO, Beijing, China). The final concentration of exosomes used for treating skin cells in vitro was 160 mg/ml, and a total of 200 mg exosomes were used to treat each animal.

Fluorescence labelling of ADSC-Exos

After thawing the separated ADSC-Exos on ice, the PKH67 Universal Cell Membrane Labeling Green Fluorescent Cell Linker Mini Kit (Invitrogen, Carlsbad, CA) was used for fluorescent labelling. Subsequently, the labelled ADSC-Exos were resuspended in DMEM cell culture medium. On the other hand, 1 × 105 HSF cells were seeded in a 24-well plate. When the HSF cells reached 80–90% confluence, the suspended ADSC-Exos were added to a 24-well plate with the HSF cells. Following 24 h of incubation, internalization was observed via a fluorescence microscope (BD Biosciences, San Diego, CA).

Cell transfection

The empty vector (control plasmid) and plasmids containing oe-H19, scramble negative control (sh-NC), sh-H19, mimics NC, miR-19b mimics, inhibitor NC, and miR-19b inhibitor were synthesized by Sangon Biotech (Shanghai, China). Lipofectamine™ 3000 Transfection Reagent (Takara, Kusatsu, Japan) was used to transfect the plasmids. Following 48 h of transfection, HSF cells were used in subsequent experiments.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

TRIzol reagent (Invitrogen, Thermo Fisher Scientific, USA) was used to extract the total RNA. An M-MLV Reverse Transcriptase (RNase H) kit (Takara, Kusatsu, Japan) was used to synthesize cDNA. RT-qPCR was conducted by using SYBR Green PCR Master Mix (Takara, Kusatsu, Japan). For mRNA detection, GAPDH served as the negative control; for miRNA detection, U6 served as the negative control. The 2−ΔΔCt method was used to calculate the relative expression. The primers were synthesized with sequences as follows: H19 Forward, 5ʹ-TACAACCACTGCACTACCTG-3ʹ; reverse, 5ʹ-TGGAATGCTTGAAGGCTGCT-3ʹ; miR-19b forward, 5ʹ‑TGTTGCATGGATTTGCACA‑3ʹ; reverse, 5ʹ- GTGCAGGGTCCGAGGT ‑3ʹ; SOX9 forward, 5ʹ‑CCCTTCAACCTCCCACACTA‑3ʹ; reverse, 5ʹ- GAGCGGGGTTCATGTAGGT‑3ʹ; Collagen I forward, 5ʹ‑ CCTGGATGCCATCAAAGTCT‑3ʹ; reverse, 5ʹ-AATCCATCGGTCATGCTCTC‑3ʹ; Collagen III forward, 5ʹ‑GGAGAGTCCATGGATGGTGG‑3ʹ; reverse, 5ʹ-TTTGCTCCATTCCCCAGTGT‑3ʹ; U6 forward, 5ʹ-CTCGCTTCGGCAGCACA-3ʹ; reverse, 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ; GAPDH forward, 5ʹ-GGGAGCCAAAAGGGTCAT -3ʹ; reverse, 5ʹ-GAGTCCTTCCACGATACCAA -3ʹ. All primers were synthesised by Procell Life Science & Technology Co,.Ltd (Wuhan, China).

Western blot analysis

The total proteins from tissue or cells were extracted in RIPA buffer and quantified by BCA assay (Beyotime, Shanghai, China). The proteins were analysed by 10% sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE), and the proteins were transferred onto polyvinylidene fluoride (PVDF) membranes, which were blocked with 5% nonfat dried milk in TBST for 1 h. The PVDF membranes were incubated at 4 °C overnight with the following primary antibodies: anti-CD9, anti-CD63, anti-CD81, anti-SOX9, anti-p-β-Catenin, anti-PCNA, anti-E-cadherin, anti-N-Cadherin, anti-Collagen I and anti-Collagen II. β-actin served as the internal control. All antibodies were purchased from Abcam (Cambridge, UK). The optical density of the protein bands was quantified by ImageJ software (ImageJ Software, Inc.).

CCK-8 assay

Cell proliferation was evaluated by Cell Counting Kit-8 (Beyotime, Nanjing, China) according to the instructions. In detail, HSF cells transfected with the corresponding plasmids were cultured in 96-well plates. Ten μL CCK-8 solution was added to every well at the indicated times. Subsequently, the medium mixed with CCK-8 solution was added to a new 96-well plate. A fluorescence microplate reader was used to detect the absorbance at 450 nm, which reflected the cell proliferation ability.

Scratch assay

HSF cells transfected with the corresponding plasmids were used in the scratch assay. Then, the cells were added to a 24-well cell culture plate. When the cells reached 80% confluence, they were transfected with the indicated plasmids. Following transfection, the cells were scratched across the cell monolayer by a yellow pipette tip, forming an artificial wound gap. Then, the cells were photographed on a cell culture plate (from 0 h to 48 h) under an inverted microscope to determine the migration ability of HSF cells.

Transwell chamber assay

A transwell chamber with a pore size of 8 μm in diameter was used to assess cell migration. In detail, 1 × 105 HSF cells were seeded in the upper chamber in serum-free medium. Simultaneously, medium containing 20% FBS was added to the bottom chamber. Following incubation for 24 h, the cells remaining on the upper side of the membrane were removed with a cotton swab, and the cells invading the bottom side of the membrane were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The stained cells in five randomly selected areas were quantified under an inverted microscope, and the average value was used to determine the cell invasion ability.

Bioinformatics and luciferase reporter assay

TargetScan (www.targetscan.org) was used to predict putative target genes. Luciferase vectors carrying the 3′-UTR of SOX9 or H19 with the wild-type or mutant miR-19b binding site were purchased from Sangon Biotech (Shanghai, China). miR-19b mimics and NC mimics were cotransfected into HSF cells by using Lipofectamine™ 3000 (Takara, Kusatsu, Japan) according to the manufacturer’s instructions. The luciferase activity was assessed using the Dual-Light Chemiluminescent Reporter Gene Assay System (Applied Biosystems, Foster City, USA) and normalized to Renilla luciferase activity.

RIP assay

RIP assays were performed using a Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, Billerica, MA, USA) according to the manufacturer’s instructions. HSF cell lysates were obtained and incubated with RIP buffer containing magnetic beads conjugated to human anti-Argonaute2 (anti-Ago2) antibodies (Millipore) or normal mouse IgG (control; Millipore). RNA was extracted from the immunoprecipitated pellets and analysed by RT-qPCR.

Mice skin wound model and treatment

Forty BALB/c male mice (4 weeks old) were used in this study and were provided by Fudan University (Shanghai, China). The mice were housed in a facility with a regulated temperature (21 ± 3 °C) and humidity (55 ± 5%) and a 12-h light/dark cycle. The animal experiments involved in this paper were carried out in accordance with the Guidelines for the Care and Use of Laboratory Animals issued by the National Institutes of Health (NIH). After anesthetizing and shaving the mice, full-thickness wounds of the same size (1 × 1 cm) were created on the back.

A total of 1 × 106 cells (ADSC) suspended in 200 μL PBS, the exosomes isolated from 1 × 106 ADSC suspended in 200 μL PBS, or 200 μL PBS (NC) were subcutaneously injected. The animals were housed individually.

ADSC-Exos, ADSC-Exos carrying sh-NC or sh-H19, and ADSC-Exos carrying OE-NC or OE-H19 were injected into the skin around the wound (ten mice for each), and another ten mice remained untreated as normal controls (NC). The animals were housed individually and were imaged prior to surgery and regularly postsurgery. Five mice from each group were sacrificed at day 7 postsurgery. Half of the wound skin tissues were collected for RT-qPCR and Western blot analysis; the other half of the samples were used for HE staining. The remaining mice were observed to compare the healing rate of the dorsal wounds. Wound areas were measured and calculated using image analysis software.

Haematoxylin and eosin (H&E) staining

Mouse skin tissue healing was assessed by H&E staining. Briefly, skin tissues were sectioned into blocks (5 μm thickness) and fixed in 10% (w/v) neutral-buffered formalin at 4 °C overnight. Next, tissue sections were dehydrated with a graded ethanol series, cleaned, and embedded in paraffin. The sections were stained with haematoxylin for 10 min and then eosin for 5 min. Skin tissue slices were imaged by light microscopy (BD Pharmingen, San Diego, CA).

Statistical analysis

The data are shown as the mean ± SD from three independent experiments. GraphPad Prism version 5.0 software (GraphPad Software, Inc.) was used for statistical analysis of all data. Student’s t test or one-way ANOVA was used for comparisons between two groups, and Tukey’s post hoc test was used for comparisons within multiple groups. A P < 0.05 indicated that the difference was statistically significant.

Results

Isolation and identification of ADSCs and ADSC-Exos

Inverted fluorescence microscopy was used to observe the morphology of ADSCs isolated from human adipose tissues. The results showed that cells exhibited long shapes and grew in colonies (Fig. 1A). Subsequently, the morphology of ADSCs was identified by flow cytometry. The findings showed the enrichment of the exosome markers CD44, CD90 and CD-105 in ADSCs (Fig. 1B). This was consistent with the surface antigen characteristics of ADSCs, and there was no significant change in molecular expression on the surface of ADSCs following continuous subculture. Collectively, these results suggested that ADSCs were successfully separated from human adipose tissues. In an attempt to evaluate the roles of exosomes in the response to skin wound healing, we extracted exosomes from ADSCs. Transmission electron microscopy (TEM) revealed that the exosomes were round vesicles with typical cup-shaped structures (Fig. 1C). As shown in Fig. 1D, the levels of CD9, CD63 and CD81, which serve as ADSC-Exo markers, were upregulated. Moreover, confocal microscopy revealed that there was a higher absorption rate following HSF cell coculture with PKH-67-labelled ADSC-Exos, indicating that isolated ADSC-Exos were successfully internalized by HSF cells (Fig. 1E). Taken together, these results suggest that ADSCs and ADSC-Exos were successfully isolated, and the isolated ADSC-Exos were internalized by HSF cells.

Fig. 1: Isolation and identification of ADSCs and ADSC-Exos.
figure 1

A Inverted fluorescence microscopy was performed to observe the morphology of ADSCs. B Flow cytometry was carried out to detect the surface marker antigens on ADSCs, including CD105, CD44, CD90, CD45, and CD34. C Electron microscopy was used to observe ADSC-Exos. D Western blotting was performed to assess the protein levels of CD9, CD63 and CD81. E Confocal microscopy was used to observe ADSC-Exos labelled with PKH-67.

Full size image

ADSC and ADSC-Exos promote skin wound healing

To investigate the roles of ADSC-Exos in wound healing, we established a mouse skin wound model and infused exosomes or their derived cells into injured rats separately. The results of histological evaluation of the wound showed that the wound healing rate was significantly increased in ADSC or ADSC-Exo wounds (Figs. 2A, B). These findings revealed that ADSCs and ADSC-Exos promote skin wound healing, and ADSC-Exos has the same effect as ADSCs.

Fig. 2: ADSC-Exos promote skin wound healing.
figure 2

A Light microscopy was used to observe the skin wounds of mice. B Statistics of the wound closure.

Full size image

ADSC-Exos promote HSF cell proliferation, migration and invasion via H19

Given that ADSC-Exos can be internalized by HSF cells, we inhibited or overexpressed H19 expression in ADSCs, from which exosomes were subsequently extracted, and we cocultured these exosomes with HSF cells to test the biological roles of H19 in HSF cells. RT-qPCR analysis showed that compared with the control, the levels of H19 were significantly inhibited following sh-H19 plasmid transfection, and H19 expression was upregulated by oe-H19 transfection. SOX9 expression showed a similar trend. However, the levels of miR-19b showed the opposite trend (Figs. 3A, B). These findings indicated that H19 inhibits miR-19b expression but upregulates the SOX9 levels. Subsequently, HSF cell bioactivities were analysed by CCK-8 assay, scratch assay and transwell assay. The findings revealed that compared with the control, H19-silenced ADSC-Exos inhibited HSF cell proliferation, migration and invasion, while H19-overexpressing ADSC-Exos accelerated HSF cell bioactivities (Fig. 3C–E). suggesting that ADSC-Exos may regulate HSF cell bioactivity via H19. Moreover, RT-qPCR analysis indicated that H19-silenced ADSC-Exos inhibited Collagen I and Collagen III expression, while H19-overexpressing ADSC-Exos exerted the opposite effect. (P < 0.05; Fig. 3F–G). Collectively, ADSC-Exos promote HSF cell proliferation, migration and invasion via H19, and ADSC-Exos may promote collagen gene synthesis via H19 in HSF cells.

Fig. 3: ADSC-Exos promote HSF cell proliferation, migration and invasion via H19.
figure 3

A–B RT-qPCR was carried out to assess the levels of H19, miR-19b and SOX9. C A CCK-8 assay was performed to evaluate HSF cell proliferation. D A scratch assay was carried out to assess HSF cell migration. E Transwell chamber assay was performed to detect HSF cell invasion. F–G RT-qPCR was performed to evaluate the mRNA levels of Collagen I and Collagen III.

Full size image

H19 serves as a sponge of miR-19b, which targets SOX9

MiRNAs are extensively involved in disease progression by regulating the posttranscriptional translation of target genes [18]. To confirm the downstream effect of miR-19b in HSF cells, miR-19b mimics or inhibitor was transfected into HSF cells for miR-19b overexpression or inhibition. RT-qPCR analysis showed that miR-19b overexpression inhibited the SOX9 mRNA levels, but miR-19b inhibition promoted SOX9 expression, compared with the control (Figs. 4A, B). Subsequently, potential binding sites of H19 and miR-19b, miR-19b and SOX9 were identified (Figs. 4C, D), and the binding sites were mutated for subsequent mechanistic assays. Furthermore, the dual-luciferase reporter assay confirmed the prediction, and HSF cells cotransfected with the wild-type plasmid of H19 and miR-19b mimics had reduced luciferase activity, while the luciferase activity was not altered in HSF cells transfected with the mutant H19-containing plasmid (Fig. 4E), suggesting that H19 acts as a sponge of miR-19b. A similar method was used to prove the correlation between miR-19b and SOX9 (Fig. 4F). Moreover, the physical interaction between H19 and miR-19b was proven by RIP assay, where H19 and miR-19b were enriched in AGO2 immunoprecipitants compared with the control (Fig. 4G). Thus, we suggest that miR-19b, which is the target of H19, targets SOX9. These findings reveal that H19 serves as a sponge of miR-19b and that miR-19b targets SOX9.

Fig. 4: MiR-19b, which is the target of H19, targets SOX9.
figure 4

A–B RT-qPCR was carried out to assess the levels of miR-19b and SOX9. C–D The potential binding sites between H19 and miR-19b, miR-19b and SOX9 were predicted by StarBase software. E–F The dual-luciferase reporter gene assay was performed to confirm the direct binding relationship between H19 and miR-19b, miR-19b and SOX9. G RIP assay was performed to determine the interaction between H19 and miR-19b, miR-19b and SOX9.

Full size image

ADSC-Exos inhibit miR-19b expression via H19, resulting in the promotion of HSF proliferation, migration and invasion

To further investigate the underlying mechanism by which ADSC-Exos regulate the biological activities of HSF cells, miR-19b inhibitor plasmids were transfected into HSF cells, and H19-silenced ADSC-Exos were cocultured with transfected HSF cells. RT-qPCR analysis showed that compared with the control, H19-silenced ADSC-Exos accelerated miR-19b expression. However, the miR-19b levels were promoted by sh-H19-Exos but reduced by the miR-19b inhibitor. SOX9 expression showed the opposite trend, indicating that SOX9 was negatively regulated by miR-19b (Figs. 5A, B). Functionally, CCK-8, scratch and Transwell assays revealed that compared with the control, H19-silenced ADSC-Exos inhibited HSF cell bioactivation. However, the miR-19b inhibitor accelerated HSF cell proliferation, migration and invasion, which was antagonized by H19-silenced ADSC-Exos (Fig. 5C–E). Moreover, RT-qPCR analysis showed that Collagen I and Collagen III expression was inhibited by H19-silenced ADSC-Exos, while the miR-19b inhibitor accelerated Collagen I and Collagen III expression, and the upregulated trend was antagonized by H19-silenced ADSC-Exos (Figs. 5F, G). These findings revealed that ADSC-Exos inhibit miR-19b expression via H19, resulting in the promotion of HSF cell bioactivity.

Fig. 5: ADSC-Exos inhibit miR-19b expression via H19, resulting in the promotion of HSF cell proliferation, migration and invasion.
figure 5

A–B RT-qPCR was carried out to evaluate the levels of miR-19b and SOX9. C A CCK-8 assay was conducted to assess HSF cell proliferation. D A scratch assay was conducted to evaluate HSF cell migration. E A transwell chamber assay was performed to detect HSF cell invasion. F–G RT-qPCR was conducted to measure the mRNA levels of Collagen I and Collagen III.

Full size image

ADSC-Exos upregulate SOX9 to activate the Wnt/β-catenin pathway, resulting in the promotion of HSF cell proliferation, migration and invasion

It has been reported that SOX9 is involved in the regulation of cell bioactivity [19]. To further explore whether ADSC-Exos promote HSF cell bioactivity by regulating SOX9 and its potential mechanisms, Western blotting was conducted to measure p-β-catenin, PCNA, E-cadherin, N-cadherin, Collagen I, and Collagen III protein expression. The findings showed that H19-silenced ADSC-Exos inhibited the protein levels of SOX9, p-β-catenin, PCNA, N-cadherin, Collagen I, and Collagen III and promoted the protein levels of E-cadherin, compared with the control, whereas H19-overexpressing ADSC-Exos exerted the opposite effect (Fig. 6A). Consistently, H19-silenced ADSC-Exos inhibited the protein levels of SOX9, p-β-catenin, PCNA, N-cadherin, Collagen I, and Collagen III and accelerated E-cadherin expression compared with the control, and miR-19b inhibition attenuated this inhibitory effect (Fig. 6B). Thus, based on the results, we conclude that ADSC-Exos may upregulate SOX9 to activate the Wnt/β-catenin pathway, resulting in the promotion of HSF cell proliferation, migration and invasion.

Fig. 6: ADSC-Exos upregulate H19 to activate the Wnt/β-catenin pathway, resulting in the promotion of HSF cell proliferation, migration and invasion.
figure 6

A Western blotting was conducted to measure the levels of the Wnt/β-catenin pathway, proliferation, EMT and synthesis of collagen-related proteins, including SOX9, p-β-catenin, PCNA, N-cadherin, E-cadherin, Collagen I and Collagen III. sh-H19 or miR-19b inhibitor was transfected into HSF cells for H19 or miR-19b inhibition, and sh-NC or inhibitor-NC served as a negative control. Then, ADSC-Exos were incubated with the treated HSF cells for 24 h. B Western blotting was conducted to measure the levels of Wnt/β-catenin pathway-, proliferation-, EMT- and collagen synthesis-related proteins, including SOX9, p-β-catenin, PCNA, N-cadherin, E-cadherin, Collagen I and Collagen III.

Full size image

ADSC-Exos promote skin wound healing via H19 in mice

To further explore the role of ADSC-Exos in wound healing of skin tissues, ADSC-Exos and H19-silenced ADSC-Exos were injected into the wound skin tissues of mice for 21 days. The wound closure statistics showed that compared with the normal control, ADSC-Exos promoted wound skin tissue healing, whereas H19-silenced ADSC-Exos antagonized this promotion effect; inversely, H19-overexpressing ADSC-Exos enhanced the effect of ADSC-Exos (Figs. 7A, B). On the 7th day of treatment, HE staining was conducted to observe skin tissue healing. The results showed that in the control group, there were a large number of inflammatory cells in the skin wound tissue, and the epidermal tissues were unformed. Following ADSC-Exo injection, the numbers of inflammatory cells in the wound tissue were reduced, with a small number of fibroblasts and a large amount of collagen fibres generated, and epidermal tissue gradually formed. However, H19-silenced ADSC-Exos attenuated this positive effect, whereas H19-overexpressing ADSC-Exos enhanced the effect of ADSC-Exos (Fig. 7C). Furthermore, the RT-qPCR results indicated that H19 was upregulated and miR-19b was downregulated following ADSC-Exo injection, and H19-silenced ADSC-Exos antagonized this effect, while H19-overexpressing ADSC-Exos enhanced the effect of ADSC-Exos (Figs. 7D, E). Moreover, Western blot analysis showed that the levels of SOX9, β-catenin, Collagen I and Collagen III proteins were upregulated following ADSC-Exo injection, whereas H19-silenced ADSC-Exos antagonized the promotion effect, but H19-overexpressing ADSC-Exos enhanced the effect of ADSC-Exos (Fig. 7F). Collectively, ADSC-Exos may promote skin wound healing via H19 in mice.

Fig. 7: ADSC-Exos promote skin wound healing via H19 in mice.
figure 7

A Light microscopy was used to observe the skin wounds of mice. B Statistical analysis of the wound closure. C HE staining was conducted to observe skin wound tissues. D–E RT-qPCR was conducted to assess the levels of H19 and miR-19b in skin wound tissues. F Western blotting was carried out to measure the levels of SOX9, p-β-catenin, Collagen I and Collagen III proteins in skin wound tissues.

Full size image

Discussion

It has been reported that ADSCs promote skin wound healing via their paracrine function. Exosomes, as one of the most important paracrine factors, play a vital role in this process [20]. However, the underlying mechanism remains unclear. In this paper, our findings demonstrated that high expression of H19 in ADSC-Exos may upregulate SOX9 expression via miR-19b to accelerate wound healing of skin tissues, indicating that the clinical application of ADSC-Exos may provide novel views for cell-free therapy to accelerate skin wound healing.

Skin wounds are ubiquitous in daily life but difficult to cure. Fibroblasts, which are the main targets and effector cells in skin wound healing, interact with surrounding keratinocytes and collagen in the healing process [21]. Furthermore, age may be a vital factor in wound healing. Increasing age may reduce the speed of wound healing [22, 23]. Simultaneously, studies have shown that ADSCs play a vital role in skin wound healing due to their paracrine effect. Further findings showed that ADSCs promote human skin fibroblast proliferation during wound healing due to the presence of exosomes [24]. Zhang et al. reported that ADSC-Exos accelerate fibroblast proliferation and migration and accelerate collagen accumulation via the PI3K/Akt pathway to accelerate skin wound healing [1]. The interaction between ADSC-Exos and lncRNAs to promote wound healing has also been widely reported. Li et al. indicated that ADSC-Exos promote wound healing in DFUs by upregulating PTEN via H19 [25]. We speculate that ADSC-Exos accelerate skin wound healing via H19. Functionally, findings show that ADSC-Exos accelerate HSF cell proliferation, migration and invasion via H19, and this regulatory effect may be achieved by H19, which inhibits miR-19b expression and promotes the protein levels of SOX9, Collagen I, and Collagen III. Attentively, some studies indicate that miR-19a promotes cell viability and migration of chondrocytes by upregulating SOX9 [26]. Moreover, the roles of miR-19b and SOX9 in regulating cell proliferation and invasion have also been widely reported [27].

LncRNAs play a vital role in ceRNAs, which act as ceRNAs to target and degrade miRNAs [28]. In this paper, our findings indicate that H19 acts as a sponge of miR-19b, which targets SOX9. Increasing evidence indicates that the lncRNA/microRNA axis is involved in the regulation of various physiological and pathological processes. For example, the H19/microRNA-675 axis regulates hepatitis B virus-induced liver cell damage via the Akt/mTOR pathway [29]. H19 protects against hypoxia-induced PC-12 cell injury by downregulating miR-28 expression [30]. In addition, MSC-Exos accelerate wound healing by upregulating PTEN via the H19/microRNA-152-3p axis in DFUs [25]. We speculate that ADSC-Exos accelerate skin wound healing via the H19/miR-19b axis. The results show that ADSC-Exos promote HSF cell proliferation, migration and invasion via the H19/miR-19b/SOX9 axis, thereby promoting skin wound healing in mice. This indicates that the H19/miR-19b/SOX9 axis plays a vital role in the process by which ADSC-Exos promote skin wound healing.

The Wnt/β-catenin pathway plays a vital role in regulating cell bioactivity and maintaining homeostasis [31]. Epithelial-mesenchymal transition (EMT) regulates bladder cancer cell invasion and metastasis via the Wnt/β-catenin pathway [32]. OIP5-AS1 upregulation activates the Wnt/β-catenin pathway to promote thyroid cancer cell proliferation and migration [33]. Furthermore, there are multiple genes involved in the regulation of the Wnt/β-catenin pathway, including forkhead box protein f1 (Foxf1), BMP2, RBM5 and LNGFR [34]. In summary, the Wnt/β-catenin pathway has a particularly vital relationship with the differentiation of stem cells and their biofunctions. Moreover, findings show that the Wnt/β-catenin pathway is regulated by SOX9 genes to mediate cell proliferation, migration and differentiation. Chen et al. showed that SOX9 inhibits chondrocyte apoptosis by regulating the Wnt/β-catenin pathway [35]. SOX9 regulates the Wnt/β-catenin pathway to mediate the chondrogenic differentiation of bone marrow mesenchymal stem cells (BMMSCs) [36]. The findings show that ADSC-Exos upregulate SOX9 expression, thereby activating the Wnt/β-catenin pathway to promote HSF cell proliferation, migration and invasion. This indicates that SOX9 plays an active role in the process by which ADSC-Exos promote HSF cell proliferation, migration and invasion to accelerate skin wound healing.

In summary, our findings demonstrated that H19-overexpressing ADSC-Exos may upregulate SOX9 expression via miR-19b to accelerate wound healing of skin tissues. Furthermore, studies show that the age, sex and diet of patients may affect wound healing. Certainly, more research is necessary to prove this point. Our findings may provide a theoretical basis for the clinical treatment of skin wounds by ADSC-Exos.