Main

Despite the well-known health risks of smoking, the use of cigarettes and tobacco continues to contribute significantly to health-care problems in our society. Twenty-two percent of women of reproductive age smoke cigarettes, exposing nearly 20% of pregnancies to this toxin (1,2,3). It is clear that in utero and postnatal exposure to smoking increases the risk of serious lower respiratory tract infections in infants and children (4). Specifically for the newborn, smoking during pregnancy increases the risks of prematurity, alters immune defenses, and increases risk factors for neonatal sepsis (5,6). Despite advances in neonatal intensive care, infection increases mortality and morbidity, particularly for the premature newborn (7,8).

Nicotine, the fat soluble and addictive component of tobacco, readily crosses the placenta, is present in the amniotic fluid, and adversely affects lung development (9). Levels of nicotine and its metabolites in the fetus closely mirror those observed in maternal plasma (10). In utero nicotine exposure alters multiple developing organs including the lung and affects branching morphogenesis (11,12,13). The effects of nicotine on the developing lung are likely mediated through the α7 nicotinic acetylcholine receptor (nAChR), one of a family of cation channels predominantly found in the nervous system (12,14). However, the direct effects of nicotine or the role of the α7nAChR on inflammatory-mediated functioning of the resident immune cell of the lung, the alveolar macrophage (AM), are not fully known.

Several pathways govern the activation states of the normally resting AM (15). Classical activation of AM (TH1 response or M1 macrophage) is predominantly characterized by a robust cellular response to eliminate microbes with efficient phagocytosis, respiratory burst, and the generation of pro-inflammatory cytokines. In contrast, alternative activation of AM (TH2 response or M2 macrophage) is currently defined by signature gene expression profiles and response to pathogenic stimuli that have been observed mainly in murine models. Although the definition of alternative activation has been evolving, alternatively activated macrophages are presently characterized by a dampening of the immune response with decreased phagocytosis and respiratory burst. While the classical pathway involves microbial stimuli and efficient clearance of microbes, the alternative pathway can skew the AM response away from microbial clearance to leave the lung more susceptible to infections if the M2 phenotype persists. Another described feature of M2 activation is increased expression and activity of arginase 1, which shunts arginine away from the production of the antimicrobial nitric oxide and promotes remodeling and repair through enhanced collagen deposition (15).

In this study, we hypothesized that exposure to nicotine in utero places the neonate at risk for respiratory infections by influencing AM function through alternative activation (M2 activation). Using the mouse macrophage cell line MH-S and a mouse model of in utero nicotine exposure, the goals of this study were (i) to determine whether chronic nicotine exposure polarized the AM toward an M2 phenotype and (ii) whether these changes were mediated via the α7 nAChR.

Results

Nicotine Exposure Increased α7 nAChR on the AM

By western blot techniques, chronic nicotine exposure to the MH-S cell line significantly increased the protein expression of α7 nAChR 1.3-fold as compared with control cells ( Figure 1a ). Similarly, primary postnatal day 7 (P7) AMs exposed to in utero nicotine demonstrated significant increase in α7 nAChR immunofluorescence as compared with controls ( Figure 1b,c ).

Figure 1
figure 1

Nicotine induced α7 nicotinic acetylcholine receptor (nAChR) expression in alveolar macrophages. Cultured murine alveolar macrophages (MH-S cells) were serum-starved overnight and treated with 50 µg/ml of nicotine for 24 h. By western blot (n = 4), nicotine (N) treatment increases expression of α7 nAChR in MH-S cells after 24 h as compared with the untreated control (C) (a). Female C57 BL/6J mice were administered 100 µg/ml of nicotine in drinking water for 6–8 wk before the timed breeding. Alveolar macrophages (AMs) were harvested from the offspring at postnatal day 7. In AMs harvested from pups exposed to nicotine (bottom color panel, b), expression of α7 nAChR in relative fluorescent units per cell (RFU/cell) was significantly increased compared to untreated control (top color panel, b) when analyzed with confocal microscopy (c). *P < 0.05 vs. control, four separate litters in each condition were analyzed; image is representative image at 100× original magnification. Scale bar represents 5 μm.

Full size image

In Utero Nicotine Skewed Cytokines in the Neonatal Lung and the AM Toward TH2 via the α7 nAChR

At baseline, neonatal lungs exposed to nicotine demonstrated significantly increased interleukin (IL)-13 and decreased IL1β at the mRNA level at P7 ( Figure 2a,b ), suggesting that the cytokine milieu of the nicotine-exposed lung was shifted toward TH2. This shift toward TH2 was supported by significantly increased active transforming growth factor–β1 (TGFβ1) in the epithelial lining fluid (ELF) of P7 pups exposed to in utero nicotine ( Figure 3 ). The α7 nAChR modulated these nicotine-induced changes in active TGFβ1, as nicotine did not induce active TGFβ1 in the ELF of the α7 nAChR−/− neonatal mice.

Figure 2
figure 2

Neonatal lungs exposed to nicotine in utero exhibited a shift towards a TH2 profile. Female C57 BL/6J mice were administered 100 µg/ml of nicotine in the drinking water for 6–8 wk before the timed breeding. Whole lung homogenates were collected from the offspring at postnatal day (P)7 for mRNA analysis. Using semi-quantitative bioluminescent reverse-transcriptase PCR, P7 lungs had increased mRNA expression of IL-13 (a) and decreased mRNA expression of interleukin-1β (b). *P < 0.05 vs. control. n = 4. n-LU denotes luciferase units normalized to endogenous loading control.

Full size image
Figure 3
figure 3

α7 Nicotinic acetylcholine receptor (nAChR) signaling mediated increased active transforming growth factor–β1 (TGFβ1) found in the alveolar epithelial lining fluid (ELF) of postnatal day (P)7 pups exposed to nicotine in utero. Alveolar ELF was collected from P7 litters and pooled for measurement of active TGFβ1 by enzyme-linked immunosorbent assay. In utero nicotine exposure induced increased active TGFβ1 expression in P7 pups. In utero nicotine exposure did not induce active TGFβ1 expression in α7 nAChR−/− pups. *P < 0.05 vs. control, †P < 0.05 vs. nicotine. Minimum of four separate litters in each experimental condition.

Full size image

The neonatal AM contributed to these nicotine-induced changes in IL-13 and TGFβ1. Nicotine in vitro significantly increased IL-13 and TGFβ1 in MH-S cells at the mRNA level ( Figure 4a,b ). Blockage of the α7 nAChR with the addition of α-bungarotoxin (αBGT) significantly blunted nicotine effects on both IL-13 and TGFβ1 mRNA. Furthermore, primary P7 AMs demonstrated a significant increase in TGFβ1 via immunohistochemistry ( Figure 4c ); this was significantly attenuated in the α7-knockout mice despite in utero nicotine exposure.

Figure 4
figure 4

Nicotine-induced increases in mRNA expression of transforming growth factor–β1 (TGFβ1) and interleukin (IL)-13 were dependent on α7 nicotinic acetylcholine receptor (nAChR)-mediated signals. MH-S cells were serum-starved overnight and treated with 50 µg/ml of nicotine (N) after 1 h pretreatment with 5 nM of α-bungarotoxin (αBGT), a snake venom toxin that is an inhibitor of α7 nAChR. Cells were harvested after 24 h for mRNA analysis using quantitative real-time PCR. Nicotine induced mRNA expression of TGFβ1 (a) and IL-13 (b) and pretreatment with αBGT blocked induction of TGFβ1 (a) and IL-13 (b) by nicotine. Primary alveolar macrophages (AMs) were harvested from the offspring at postnatal day 7. Immunofluorescent staining for TGFβ1 was significantly increased after in utero nicotine exposure in primary AMs, whereas TGFβ1 was not increased in α7 nAChR−/− pups despite nicotine exposure (c). *P < 0.05 vs. control, †P < 0.05 vs. nicotine. Three to four separate litters in each experimental condition.

Full size image

Nicotine Exposure Induced Alternative Activation in the AM via the α7 nAChR

In vitro exposure to nicotine induced markers of alternative activation in the MH-S cell as demonstrated by significant increases in arginase 1, Ym1 (also known as ECF-L or T lymphocyte-derived eosinophil chemotactic factor) and fibronectin (FN) at the mRNA level ( Figure 5a–c ). Correspondingly, in utero nicotine also demonstrated significant increases in these markers of alternative activation ( Figure 5d–f ). Blockade of the α7 nAChR with αBGT blunted in vitro nicotine-induced increases in arginase 1, Ym1, and FN on the MH-S cell line. Similarly, nicotine-induced increases in these markers were blocked in the P7 α7 nAChR–deficient AM.

Figure 5
figure 5

Nicotine promoted M2 activation of alveolar macrophages (AMs) in vitro and in vivo. Primary AMs were harvested at postnatal day (P)7. In addition, MH-S cells were serum-starved overnight and treated with 50 µg/ml of nicotine after 1 h pretreatment with 5 nM of α-bungarotoxin (αBGT). Cells were harvested after 24 h for mRNA analysis using quantitative real-time PCR. Nicotine induced mRNA expression of the following markers of M2 activation: arginase 1 (Arg1), Ym1, and fibronectin (a–c, respectively). Similarly, increased expressions of Arg1, Ym1, and fibronectin were seen by immunofluorescent staining in relative fluorescent units per cell (RFU/cell) using confocal microscopy in primary AMs at P7 (d–f, respectively). Pre-treatment with αBGT blocked in the nicotine-induced changes in mRNA expression. In utero nicotine exposure did not induce changes in mRNA expression of Arg1, Ym1, or fibronectin in primary AMs from α7 nAChR−/− pups. *P < 0.05 vs. control, **P < 0.01 vs. control, †P < 0.05 vs. nicotine, ‡P < 0.01 vs. nicotine. Figure is a composite of three to five separate litters in each experimental condition.

Full size image

Nicotine-Exposed AMs Promote FN Expression in a Paracrine Fashion

In addition to increased FN induced by nicotine exposure, AMs treated with nicotine in vitro can also promote FN transcription in adjacent cells. MH-S cells treated with nicotine in vitro and cultured on permeable membrane supports separating them from NIH 3T3 fibroblasts permanently transfected with an FN–luciferase reporter were able to induce FN transcription in fibroblasts, as evidenced by increased luciferase production by the transfected NIH 3T3 cells ( Figure 6a ). These effects were dependent on α7 nAChR signaling because concurrent incubation with αBGT abrogated the nicotine effect. Increased FN transcription was absent in fibroblasts cultured without MH-S cells in the membrane supports, demonstrating that the nicotine-exposed MH-S cells were capable of promoting FN transcription in fibroblasts. Nicotine-exposed MH-S cells also affected type I collagen expression in fibroblasts ( Figure 6b ).

Figure 6
figure 6

Nicotine promotes expression of extracellular matrix proteins associated with alternative activation. MH-S cells were serum-starved overnight, pretreated with 5 nM of bungarotoxin (BGT) to inhibit α7 nicotinic acetylcholine receptor, then treated with 50 µg/ml of nicotine and co-cultured with fibroblasts permanently transfected with a fibronectin–luciferase reporter for 24 h. MH-S cells treated with nicotine promoted transcription of fibronectin in co-cultured fibroblasts as measured by luciferase assay (a). Pretreatment with αBGT blocked the nicotine-induced increase in fibronectin transcription. Collagen type I expression was also analyzed in the MH-S cells co-cultured with fibroblasts in (a). Nicotine-treated MH-S cells (N, black bars) also had increased collagen type I expression by western blot analysis after 24 h as compared with untreated MH-S cells (C, white bars) (b). Image is a representative western blot. *P < 0.05 vs. control, †P < 0.05 vs. nicotine. n = 3.

Full size image

In Utero Nicotine Impaired AM Phagocytic Function via the α7 nAChR

Last, we evaluated the effects of in utero nicotine exposure on the phagocytic function of the primary neonatal AM. In utero nicotine exposure significantly impaired the ability of the neonatal AM to phagocytose inactivated Staphylococcus aureus by approximately 50% ( Figure 7 ). Despite nicotine exposure, AMs lacking the α7 nAChR maintained phagocytosis at control levels, suggesting that nicotine-induced deranged phagocytic function was modulated via the α7 nAChR.

Figure 7
figure 7

In utero nicotine exposure impaired the phagocytic response of alveolar macrophages (AMs), and nicotine’s effect was dependent on α7 nicotinic acetylcholine receptor (nAChR)-mediated signals. Primary AMs were harvested at postnatal day 7 and were administered pH rhodo-labeled Staphylococcus aureus, which fluoresces when incorporated into an acidic phagolysosome. AMs from in utero nicotine-exposed pups demonstrated diminished phagocytosis, but AMs from α7 nAChR−/− pups maintained their phagocytic ability despite in utero nicotine exposure. *P < 0.05 vs. control, †P < 0.05 vs. nicotine. Minimum of four separate litters in each experimental condition.

Full size image

Discussion

Despite the known risk of cigarette smoke exposure on childhood health, maternal use of cigarettes during pregnancy remains an issue with approximately 10–12% of pregnant women admitting to tobacco use (16). Use of cigarettes during pregnancy exposes the developing neonatal lung to nicotine. There remains a gap of knowledge regarding the specific effects of nicotine on the characteristics and functioning of the developing AM, the resident immune cell in the lung. This study demonstrated that in utero nicotine exposure induced a TH2 milieu in the neonatal lung at baseline and skewed the resting state of the neonatal AM toward M2 activation, impairing phagocytic function. The α7 nAChR played an important role in modulating the effect of nicotine as demonstrated by the effects of αBGT in vitro and the attenuation of the effect of nicotine in vivo in the α7 nAChR–deficient neonatal mouse.

The nAChRs are found in a number of cell types and non-neuronal organs, including the lung. Within the lung, nAChRs are present in epithelial cells, fibroblasts, smooth muscle cells, and AMs (12,14). We have previously demonstrated that nicotine increased branching morphogenesis of the developing lung in the pseudoglandular stage through α7 nAChR–mediated signals (12). Others have shown that nicotine induced α7 nAChR expression in fetal lung, particularly around the airways (14). α7 nAChRs have been found in peripheral blood monocytes and macrophages, and they are capable of influencing immune responses (17). An anti-inflammatory role for the α7 nAChR has been noted, as a specific α7 nAChR agonist decreased tumor necrosis factor-α release in the lung, and α7 nAChR agonists, including nicotine, also inhibited nuclear factor-κB activity and lipopolysaccharide-induced release of tumor necrosis factor-α in the lung (18). However, the literature also demonstrates that α7 nAChR has been associated with pro-inflammatory effects. Prostaglandins and cyclo-oxygenase 2 expression were enhanced by activation of α7 nAChR, whereas nicotine induced nuclear factor-κB and inducible nitric oxide synthase in peritoneal macrophages in a model of atherosclerosis (19,20). Expression of nAChRs was upregulated by tumor necrosis factor-α, supporting a potential link between inflammation and nAChRs (21). For the developing AM, our study suggested that nAChR activation via in utero nicotine shifted the baseline cytokine milieu toward TH2, increased TGFβ1, and skewed the resting AM state toward M2.

Currently available knowledge suggests the skewed responses of alternatively activated macrophages may leave the lung more susceptible to infections and remodeling. As a professional phagocyte within the lung, the AM patrols the lung, defending it against foreign particles and infection by initiating immune responses, participating in phagocytosis and particle clearance, and orchestrating subsequent inflammatory processes (22). Studies have demonstrated that complete absence of macrophages led to dramatically increased mortality after bacterial infection (23). Alternatively activated macrophages have also been shown to promote fibroblast proliferation as well as production of collagen and FN, extracellular matrix proteins important in remodeling (24). Our study shows that nicotine-induced alternative activation of the AM leads to increased FN within the alveolar macrophage and induction of FN transcription in fibroblasts in the setting of increased TGFβ1, a well-known stimulus for FN expression, potentially to promote airway remodeling (25). These effects on airway remodeling in the neonatal lung require additional investigation.

The nicotine-exposed neonatal lung and AM were hallmarked by increased TGFβ1, a well described anti-inflammatory mediator in monocytic cells and AMs (26,27). Furthermore, TGFβ1 contributes to the development of chronic lung disease (bronchopulmonary dysplasia) in the premature lung (28,29). In a neonatal hyperoxia model, neutralization of TGFβ1 improved alveologenesis and microvascular development (30). Taken together, our data suggest that not only are the AMs functionally impaired with in utero nicotine exposure, but also the lung parenchyma and vasculature are at greater risk for injury in the setting of increased TGFβ1.

Many studies focus on the effects of cigarette smoke exposure on the lung, but the complex nature of cigarette smoke can potentially impede full mechanistic understanding of pathophysiology. In other examinations of adult human AMs, adult human AMs exposed to cigarette smoke similarly exhibit signs of M2 activation (31,32). Taken together with previously published literature, our findings support the possible role of nicotine as a significant player in the pathophysiology behind the adverse effects of prenatal tobacco smoke exposure on the fetus because the effects from nicotine exposure alone mimic those seen with tobacco smoke exposure. Although cessation of cigarette smoking is advocated to all pregnant women, our results suggest that nicotine replacement therapy as a strategy for smoking cessation therapy may not be desirable in this population and alternative smoking cessation therapies may need to be considered.

Materials and Methods

All animal and experimental protocols were approved by the Emory University Institutional Animal Care and Use Committee and the Office of Biosafety.

Model of In Utero Nicotine Exposure and Timed Breeding

Female C57BL6/J mice and Chrna7−/− mice (α7 nAChR−/−, α7 knockout in C57BL6/J background; Jackson Laboratories, Bar Harbor, ME) were or were not administered nicotine (100 µg/ml) in the drinking water ad libitum for 6–8 wk before timed breeding. Pregnant female mice continued to drink nicotine-treated water throughout the pregnancy. In this model, pregnant female mice are able to establish a steady state plasma level of nicotine similar to that seen in heavy smokers (12,33). P0 was determined by the day of birth. Pups were evaluated at P7. A total of 100% of the pups in the nicotine group remained exposed to nicotine through maternal breast milk until P7.

In Vitro Nicotine Exposure

The MH-S murine AM cell line (ATCC, Manassas, VA) was cultured in Roswell Park Memorial Institute media containing 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B. Cells were or were not exposed to ± nicotine (50 µg/ml) for 24 h. In some experiments, the cells were incubated with αBGT (5 nM), a selective inhibitor of α7 nAChR (34).

Recovery of Primary AM and ELF

AMs were isolated from P7 neonatal pups as previously described (27).

Measurement of ELF Cytokine Levels

Pooled pup ELF was evaluated for IL-13 and active TGFβ1 via commercial enzyme-linked immunosorbent assays per the manufacturers’ instructions (IL-13, R&D Systems, Minneapolis, MN; Active TGFβ1, Promega, Madison, WI). Values were normalized to protein as determined by the bicinchoninic acid protein assay (Bio-Rad, Hercules, CA). Data are presented as the mean (IL-13 or TGF-β1 in pg/μg protein) ± SEM (27).

Measurement of α7 nAChR

Levels of AM α7 nAChR were measured by western blot analysis as previously described (35,36). Primary P7 mouse AMs obtained from pooled bronchoalveolar lavages were evaluated via immunofluorescence for α7 nAChR and markers of M2 activation using methods previously described (27).

RNA Extraction, and Semi-Quantitative Bioluminescent and Quantitative Real-Time Reverse-Transcriptase PCR

The determination of mRNA levels was done by a semi-quantitative bioluminescence-based reverse-transcriptase PCR assay and quantitative real-time reverse-transcriptase PCR as previously described (12). The primers used were synthesized on the basis of GenBank published sequences: IL-13: 5′ GGAGCTGAGCAACATCACACA 3′ and 5′ GGTCCTGTAGATGGCATTGCA 3′; TGFβ1: 5′ CCCACTCCCGTGGCTTC 3′ and 5′ TAGTAGTCCGCTTCGGGCT 3′; IL1-β: 5′ GAGCACCTTCTTTTCC 3′ and 5′ GGAAAAAGAAGGTGGTC 3′; Ym1/2: 5′ TTATCCTGAGTGACCCTTCTAAG 3′ and 5′ TCATTACCCAGATAGGCATAGG 3′; arginase 1: 5′ TGGACCTGGCCTTTGTTGA 3′ and 5′ GGTTGTCAGGGGAGTGTT 3′; FN: 5′ CTGTGACAACTGCCGTAG 3′ and 5′ACCAAGGTCAATCCACAC 3′.

FN Luciferase Assay

MH-S cells were cultured on a permeable membrane Transwell (Corning, Tewksbury, MA) support with NIH 3T3 fibroblasts permanently transfected with the FN promoter attached to a luciferase reporter (FN-luciferase) in the bottom well. After overnight serum starvation, MH-S cells on the permeable membrane were then treated with 5 nM αBGT for 1 h before the addition of 50 µg/ml of nicotine. After 24 h, the MH-S cells and membrane supports were removed and FN transcription in the transfected 3T3 fibroblasts was measured by luciferase activity. Relative luciferase units were recorded and are presented as mean ± SD (37).

Measurement of Phagocytosis

Phagocytosis was measured in freshly isolated P7 AMs as previously described (27,38).

Statistical Analyses

Sigma Stat for Windows (Systat Software, San Jose, CA) was used for all statistical analyses. ANOVA or ANOVA on Ranks was used as appropriate. Student Newman Keul’s or Dunn’s test was used for multiple comparisons. A P ≤ 0.05 was considered significant. Each n represents a separate mouse litter or a separate experimental condition.

Statement of Financial Support

This work was funded by National Institutes of Health grant K08 HL080293 (to C.W.) and a grant from the Children’s Center for Developmental Lung Biology (to T.W.G. and L.A.S.B.).