Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

The miR-487b-3p/GRM3/TGFβ signaling axis is an important regulator of colon cancer tumorigenesis

Oncogene volume 36, pages 3477–3489 (2017)Cite this article

Subjects

Abstract

Molecular targeting is an import strategy to treat advanced colon cancer. The current study demonstrates that expression of GRM3, a metabotropic glutamate receptor mainly expressed in mammalian central nervous system, is significantly upregulated in majority of human colonic adenocarcinomas tested and colon cancer cell lines. Knockdown of GRM3 expression or inhibition of GRM3 activation in colon cancer cells reduces cell survival and anchorage-independent growth in vitro and inhibits tumor growth in vivo. Mechanistically, GRM3 antagonizes TGFβ-mediated activation of protein kinase A and inhibition of Protein kinase B (AKT). In addition, TGFβ signaling increases GRM3 protein stability and knockdown of GRM3 enhances TGFβ-mediated tumor suppressor function. Further studies indicate that miR-487b-3p directly targets GRM3. Overexpression of miR-487b-3p mimics the effects of GRM3 knockdown and suppresses the tumorigenicity of colon cancer cells in vivo. Expression of miR-487b-3p is decreased in colon adenocarcinomas and inversely correlates with GRM3 expression. Taken together, these studies indicate that upregulation of GRM3 expression is a functionally important molecular event in colon cancer, and that GRM3 is a promising molecular target for colon cancer treatment. This is particularly interesting and important from a therapeutic standpoint because numerous metabotropic glutamate receptor antagonists are available, many of which have been found unsuitable for treatment of neuropsychiatric disorders for reasons such as inability to readily penetrate blood brain barriers. As GRM3 is upregulated in colon cancer, but rarely expressed in normal peripheral tissues, targeting GRM3 with such agents would not likely cause adverse neurological or peripheral side effects, making GRM3 an attractive and specific molecular target for colon cancer treatment.

Download PDF

Introduction

Treatment of advanced colon cancer with molecularly targeted drugs has not had large clinical impact in part due to high degree of heterogeneity. Therefore, there is a need to identify new molecule targets and develop efficient target-specific therapies.

Glutamate functions as a major excitatory neurotransmitter in mammalian central nervous system (CNS).1, 2 Glutamate signaling is mediated by two classes of glutamate receptors, ionotropic and metabotropic receptors.3 Metabotropic receptors (mGluR), a group C family of G-protein-coupled receptors (GPCRs), consist of eight members, classified into three subtypes.4, 5 Group I receptors (mGluR1 and 5) are coupled to phospholipase C leading to activation of protein kinase C, whereas group II (mGluR2 and 3) and group III (mGluR4, 6, 7 and 8) receptors are negatively coupled to adenylyl cyclase, inhibiting production of cyclic AMP (cAMP).3, 4, 5 Although glutamatergic system is mainly restricted to the CNS, expression of functional glutamate receptors has been reported in non-neuronal peripheral cells such as skin and pancreatic islets.6, 7 Furthermore, studies have revealed that glutamate signaling is dysregulated and may have a role in cancer.8, 9, 10

GRM3 is the gene encoding mGluR3, which is frequently mutated in melanoma.11 Mutant GRM3 selectively activates MEK, leading to increased anchorage-independent growth and migration.11 Activation of GRM3 has been reported to suppress bone morphogenetic protein (BMP) signaling and sustain tumorigenic potential of glioma-initiating cells.12 Pharmacological blockade of GRM3 reduced growth of glioma cells in vitro and in vivo.13, 14, 15 These studies suggest that GRM3 has a role in cancer and could be a potential target for cancer treatment.

Transforming growth factor β (TGFβ) signaling has a dual role in cancer. Although studies show that TGFβ promotes metastasis and is associated with worse prognosis,16, 17, 18, 19 others demonstrate that it suppresses tumorigenicity and metastasis20, 21, 22, 23, 24, 25, 26 and that loss or reduction of TGFβ signaling is associated with development of metastasis.27, 28 In genetically engineered mouse models, inactivation of TGFβ signaling increases malignancy and invasiveness of intestinal tumors of Apc mutant mice.29, 30, 31, 32, 33

MicroRNAs (miRNAs) are a group of small non-protein coding RNAs evolutionarily conserved.34 MiRNAs suppress expression of gene targets at the post-transcriptional level through sequence-specific interaction with the 3′-untranslated regions (UTR), leading to translation inhibition or mRNA degradation.35 Alterations in miRNA expression are found to be associated with many human cancers.36

Here, we demonstrate that GRM3 expression is significantly upregulated in majority of human colonic adenocarcinomas tested and colon cancer cell lines. Knockdown of GRM3 expression or pharmacological blockade of GRM3 in colon cancer cells reduces cell survival and anchorage-independent growth in vitro and inhibits tumor growth in vivo. Mechanistically, GRM3 antagonizes TGFβ-mediated activation of protein kinase A (PKA) and inhibition of Protein kinase B (AKT) activation. In addition, TGFβ signaling increases GRM3 protein stability and knockdown of GRM3 expression enhances TGFβ-mediated tumor suppressor function. Further studies indicate that GRM3 is a direct target of miR-487b-3p and that miR-487b-3p mimics the effects of GRM3 knockdown in colon cancer cells in vitro and in vivo. Expression of miR-487b-3p is decreased in colon adenocarcinomas and inversely correlates with GRM3 expression. Taken together, these studies indicate that the miR-487b-3p/GRM3/TGFβ signaling axis is an important regulator of colon cancer tumorigenesis and that upregulation of GRM3 is a functionally important molecular event in colon cancer. Therefore, GRM3 is a promising molecular target for colon cancer treatment. This is particularly interesting and important from a therapeutic standpoint because numerous metabotropic glutamate receptor antagonists are available,37 many of which have been found unsuitable for treatment of neuropsychiatric disorders due to their inability to readily penetrate blood brain barriers. As GRM3 is upregulated in colon cancer, but rarely expressed in normal peripheral tissues, targeting GRM3 with such agents would not likely cause adverse neurological or peripheral side effects, making GRM3 an attractive and specific molecular target for colon cancer treatment.

Results

Expression of GRM3 is markedly increased in colon cancer specimens

Although it has been implicated that GRM3 is an important player in melanoma and glioma,11, 12, 13, 14, 15 it is unknown whether GRM3 has a role in colon cancer. GRM3 expression was therefore examined in human specimens using immunohistochemistry (IHC) analysis. Verification of the anti-GRM3 antibody is shown in Figure 3c. Tissue micro-arrays (TMAs) consisting of 29 normal colon and 65 colon adenocarcinomas were analyzed. Mouse brain tissue was used as a positive control. GRM3 expression was very low in normal colon epithelium, but increased significantly in colon tumors (Figure 1a). Quantification showed that the average intensity of GRM3 staining and percentage of GRM3-positive cells were ~5.5-fold and 3.8-fold higher respectively in tumors than in normal colon (Figures 1b and c). In addition, GRM3 expression was increased in more than 90% of colon tumors examined (Figures 1b and c). These results demonstrate that GRM3 expression is upregulated in majority of colon adenocarcinomas. However, analysis of TCGA databases revealed that GRM3 mRNA was not increased in colon adenocarcinomas (data not shown).

Figure 2
figure 3

GRM3 expression is upregulated in colon cancer cells. (a) GRM3 expression was determined in colon cancer cell lines and HCECs by western blot analysis (left). GRM2 and GRM3 mRNA expression was determined by RT–PCR assays. Mouse brain tissue was used as a positive control (middle). GRM3 mRNA expression was determined by Q-PCR assays (right). (b) GRM3 expression was knocked down by two shRNAs. (c, d) Control or GRM3 knockdown cells were subjected to GFDS. Cleaved PARP (c) and apoptosis (d) were determined. (e) Colony numbers were determined in soft agarose assays of control or GRM3 knockdown cells. (f) Cell motility and migration were determined in Transwell assays of control or GRM3 knockdown HCT116 cells. The data are presented as the mean±s.d. of three replications. **P<0.01.

Full size image
Figure 1
figure 1

GRM3 expression is elevated significantly in colon cancer specimens. (a) Immunohistochemistry staining of GRM3 was performed in normal colon and colon adenocarcinomas. Mouse brain tissue stained with the anti-GRM3 antibody in the absence or presence of a specific blocking peptide was used as a positive and negative control respectively. Representative images are shown. Scale bars, 100 μm. (b, c) Quantification of GRM3 staining intensity (b) and percentage of GRM3-positive cells (c) was performed. The values of individual samples are shown. Error bars indicate s.e.m. of the values. ***P<0.001.

Full size image

GRM3 is critical for tumor growth in vivo

These observations prompted us to investigate whether GRM3 has a functional role in colon cancer. A panel of human colon cancer cell lines and an immortalized human colon epithelial cell line, HCEC,38 were used. HCT116 and RKO cells are defective in TGFβ signaling due to lack of TGFβ RII.39 HCT116b cells were isolated from the same colon tumor as HCT116, but displayed much lower metastatic potential.40 FET cells, isolated from a well-differentiated colon tumor, are sensitive to TGFβ-mediated growth inhibition and apoptosis.20 CBS and GEO cells are partially responsive to TGFβ due to low TGFβ RII and RI expression, respectively.22, 41 HT29 cells do not express Smad4 due to mutations.42 All cell lines bear either KRAS or BRAF mutations, and all except RKO43 have mutated APC or β-catenin.

GRM3 expression was much higher in colon cancer cells than in HCECs (Figure 2a, left), consistent with the results from human specimens. However, GRM3 mRNA levels were similar between HCECs and most of colon cancer cell lines (Figure 2a, middle and right), suggesting that upregulation of GRM3 may be through post-transcriptional mechanism(s). Of note, expression of GRM2, the other member of group II metabotropic glutamate receptors, was almost undetectable in all cell lines (Figure 2a, middle). Mouse brain tissue was used as a positive control. These results indicate that expression of GRM3 but not GRM2 is increased in colon cancer cells.

Figure 3
figure 2

GRM3 mediates tumor growth in vivo. (a) Xenograft tumor growth curves of CBS control and GRM3 shRNA-expressing cells are shown. n=16. (b) Images of tumors at the endpoint of experiments are shown. The pictures were taken on the same scale with the ruler with each tumor (Supplementary Figure S9). (c) Representative images of GRM3 staining in xenograft tumors are shown (left). Quantification of staining intensity and percentage of GRM3-positive cells was performed (right). (d) Representative images of TUNEL and Ki67 staining are shown (upper). Percentage of positive staining cells was determined (lower). Scale bars, 100 μm. The data are presented as the mean±s.d. *P<0.05, **P<0.01.

Full size image

To determine GRM3 function, its expression was knocked down in FET, CBS and HCT116, three colon cancer cell lines with different genetic background. Each of two independent shRNAs (sh1 and sh2) reduced GRM3 expression by more than 90% as compared with a scrambled shRNA and had no effect on GRM2 expression (Figure 2b, data not shown). Knockdown of GRM3 increased sensitivity to growth factor deprivation stress (GFDS)-induced apoptosis, reflected by enhanced PARP cleavage (Figure 2c) and increased apoptosis in DNA fragmentation assays (Figure 2d). In addition, GRM3 knockdown decreased anchorage-independent growth (Figure 2e; Supplementary Figure S1a and b) and inhibited motility and migration (Figure 2f).

We next examined the effect of GRM3 knockdown in vivo. Mice were subcutaneously injected with CBS cells stably expressing a scrambled shRNA or GRM3 shRNAs. Xenograft tumor growth curves showed that tumors of GRM3 shRNA-expressing cells (designated GRM3 shRNA tumors) grew at a significantly lower rate than those of control cells (designated control tumors) (Figure 3a). As a result, GRM3 shRNA tumors were much smaller than control tumors (Figure 3b). IHC staining confirmed GRM3 knockdown in GRM3 shRNA tumors and verified the specificity of the anti-GRM3 antibody (Figure 3c). TUNEL and Ki67 staining showed much more apoptotic cells and fewer proliferative cells in GRM3 shRNA tumors than in control tumors (Figure 3d). These results indicate that knockdown of GRM3 inhibits tumor growth in vivo and that this inhibitory effect is a combined result of increased apoptosis and suppressed proliferation.

A GRM3 antagonist mimics GRM3 knockdown in vitro and in vivo

LY341495 is a potent and selective antagonist of GRM2/3.44 As shown in Figure 4a and Supplementary Figure S1c, LY341495 reduced colony formation of HCT116 cells in soft agar. When mice subcutaneously injected with HCT116 cells were treated with LY341495, tumors grew at a slower rate than those treated with vehicle control (Figure 4b). Therefore, tumors were markedly smaller in LY341495-treated group than in control group (Figure 4c). TUNEL and Ki67 staining showed that LY341495 increased apoptotic cells and decreased proliferative cells (Figure 4d). These results indicate that pharmacological blockade of GRM3 reduces anchorage-independent growth in vitro and tumor growth in vivo.

Figure 4
figure 4

The GRM3 antagonist inhibits tumor growth in vivo. (a) Colony numbers were determined in soft agarose assays of control or LY341495-treated HCT116 cells. (b) Xenograft tumor growth curves of HCT116 cells treated with LY341495 or vehicle are shown. n=14. (c) Images of tumors at the endpoint of experiments are shown. (d) Representative images of TUNEL and Ki67 staining are shown (left). Percentage of positive staining cells was determined (right). Scale bars, 100 μm. The data are presented as the mean±s.d. *P<0.05, **P<0.01.

Full size image

GRM3 antagonizes TGFβ to regulate cell survival through the PKA/AKT signaling axis

GRM3 is negatively coupled to adenylyl cyclase, inhibiting production of cAMP.3, 4, 5 As cAMP activates PKA,45 which inhibits AKT activation,23 activation of PKA and AKT was determined. PKA activity assays showed that knockdown of GRM3 increased PKA activity (Figure 5a). Phosphorylation of CREB, a target of PKA,45 was also used to indicate PKA activity. Knockdown of GRM3 increased pCREB and decreased pAKT (Figure 5b, left and Figure 5c). Treatment with LY341495 or forskolin, a PKA activator, showed similar effect (Figure 5b, middle). Complementarily, overexpression of GRM3 reduced pCREB and increased pAKT (Figure 5b, right). These results indicate that GRM3 inhibits PKA and activates AKT in colon cancer cells.

Figure 5
figure 5

GRM3 antagonizes TGFβ-mediated activation of PKA/AKT. (a) PKA activity was determined in FET, HCT116 and CBS cells. (b) pCREB, and pAKT were determined in FET control and GRM3 knockdown cells (left), FET cells treated with LY341495 or forskolin (middle) and vector- or GRM3-expressing FET cells (right). (c, d) pCREB, and pAKT were determined in HCT116 and CBS control and GRM3 knockdown cells (c) and FET control and PKACα KD cells each infected with GRM3 sh2 or treated with 4 ng/ml TGFβ or both (d). (e) PKACα was knocked down in FET control or GRM3 knockdown cells. Cells were subjected to GFDS for 24 h. Cleaved PARP (upper) and apoptosis (lower) were determined. (f) FET control or GRM3 knockdown cells were treated with 4 ng/ml TGFβ under GFDS for 14 h. Cleaved PARP (upper) and apoptosis (lower) were determined. (g) Colony numbers were determined in soft agarose assays of FET control or GRM3 knockdown cells treated with 0.5 ng/ml TGFβ. (h) Cells were treated with 4 ng/ml TGFβ for 6 h. GRM3 expression was determined by western blot assays. (i) FET cells were treated with 4 ng/ml TGFβ for 6 h. GRM3 mRNA was determined by RT–PCR assays. (j) FET cells were treated with 4 ng/ml TGFβ for the indicated time. GRM3 expression was determined by western blot assays. (k) FET cells were treated with cycloheximide in the presence or absence of TGFβ. GRM3 expression was determined by western blot assays. (l) Expression of Smad2 or Smad3 was knocked down individually in FET cells (left). Cells were treated with TGFβ. GRM3 protein and mRNA expression was determined by western blot assays (middle) and RT–PCR analysis (right) respectively. The data are presented as the mean±s.d. of three replications. *P<0.05, **P<0.01.

Full size image

To determine whether PKA is involved in GRM3-mediated cell survival, the PKA catalytic α subunit (PKACα) was knocked down in FET cells.46 GRM3 knockdown-induced PKA activation and AKT inhibition were abrogated (Figure 5d, right). Consequently, knockdown of PKACα attenuated GRM3 knockdown-mediated increase of apoptosis under GFDS (Figure 5e). These results indicate that GRM3 knockdown inhibits AKT and suppresses cell survival through PKA activation.

Unlike GRM3’s coupling to cAMP,3, 4, 5 TGFβ activates PKA independent of cAMP, which inhibits AKT and suppresses cell survival.23 We confirmed TGFβ effect on pCREB and pAKT in FET cells (Figure 5d, left). As GRM3 knockdown and TGFβ activate PKA independently, we determined whether combination of both would further activate PKA and inhibit AKT. The results showed that GRM3 knockdown and TGFβ treatment concomitantly led to additional increase in pCREB and decrease in pAKT (Figure 5d, left). As a result, when cells were treated with TGFβ under GFDS for 14 hours, TGFβ had little effect in control cells but induced apoptosis in GRM3 knockdown cells (Figure 5f). In addition, GRM3 knockdown sensitized FET cells to TGFβ-mediated inhibition of anchorage-independent growth (Figure 5g; Supplementary Figure S1a). These results indicate that GRM3 antagonizes TGFβ-mediated tumor suppressor function and that GRM3 knockdown enhances TGFβ effects.

To determine the mechanism underlying collaborative effect of TGFβ and GRM3 knockdown on PKA/AKT activation, cell survival and anchorage-independent growth, we investigated whether GRM3 mediates TGFβ signaling and found that GRM3 knockdown had no effect on expression of Smad2, Smad3, Smad4 or on canonical TGFβ signaling (data not shown). However, TGFβ increased GRM3 protein expression in FET and CBS cells (Figure 5h, left and middle) while had little effect on GRM3 mRNA (Figure 5i). Inactivation of TGFβ signaling by a dominant negative TGFβ RII (DNRII) in FET cells20, 41 abrogated TGFβ effect on GRM3 expression (Figure 5h, right). Time course experiments showed that TGFβ increased GRM3 expression as early as 30 min (Figure 5j), suggesting that TGFβ may increase GRM3 protein stability. Treatment with cycloheximide indicated that TGFβ markedly increased the half-life of GRM3 protein (Figure 5k). Moreover, knockdown of Smad2 or Smad3 attenuated TGFβ-induced GRM3 protein expression but had little effect on GRM3 mRNA levels (Figure 5l), indicating that Smad2/3 contributes to TGFβ-mediated GRM3 protein expression.

MiR-487b-3p regulates GRM3 expression in colon cancer cells

Although TGFβ increases GRM3 expression (Figure 5h), it cannot fully explain ubiquitous upregulation of GRM3 expression in colon cancer cell lines regardless of their response to TGFβ signaling (Figure 2a, left). As GRM3 expression may be regulated post-transcriptionally (Figure 2a), we turned our attention to miRNAs, which function as post-transcriptional regulators of mRNA expression and/or translation.35 We performed an in silico search for putative miRNA-binding sites in the 3′UTR of human GRM3 mRNA using TargetScan,47 PicTar48 and miRanda-mirSVR.49 Among miRNA candidates conserved between human and mouse, miR-487b-3p was identified as a potential regulator of GRM3. Q-PCR assays indicated that expression of miR-487b-3p was much lower in colon cancer cell lines than in HCECs (Figure 6a), suggesting that decreased miR-487b-3p expression may contribute to upregulated GRM3 expression in colon cancer cells.

Figure 6
figure 6

GRM3 is a direct target of miR-487b-3p. (a) Expression of miR-487b-3p was determined in HCECs and colon cancer cells by Q-PCR assays. (b) Expression of miR-487b-3p was determined after infection with miR-487b precursor (left) or transfection with the miR-487b inhibitor (right). (c) GRM3 expression was determined by western blot assays (left) and by RT–PCR assays (right) after infected with miR-487b precursor or transfected with the miR-487b-3p inhibitor. (d) The predicted miR-487b-3p recognition site in the 3′UTR of GRM3 and corresponding mutated sequences are indicated by lines (left). After transfection with psiCheck-2 constructs containing the wild type (Wt) or mutant (Mut) sequences, luciferase assays were performed in FET control and miR-487b-3p-expressing cells (right). (e) PKA activity was determined in colon cancer cells. (f) pCREB and pAKT were determined in vector- or miR-487b-3p-expressing FET and CBS cells. (g) Vector- or miR-487b-3p-expressing FET and CBS cells were subject to GFDS for 24 h and 48 h, respectively. Cleaved PARP (upper) and apoptosis (lower) were determined. (h) Colony numbers were determined in soft agarose assays of vector- or miR-487b-3p-expressing FET and CBS cells. (i) FET and HCT116b cells transfected with the miR-487b-3p inhibitor were subjected to GFDS for 24 h or 48 h, respectively. Cleaved PARP (upper) and apoptosis (lower) were determined. (j,k) GRM3 was ectopically expressed in miR-487b-3p-expressing FET and CBS cells (j), which were subjected to GFDS for 24 and 48 h respectively. Cleaved PARP (k, upper) and apoptosis (k, lower) were determined. The data are presented as the mean±s.d. of three replications. **P<0.01, ***P<0.001.

Full size image

To demonstrate that miR-487b-3p regulates GRM3 expression, miR-487b precursor was stably infected into FET and CBS cells. As a result, expression of mature miR-487b-3p was significantly increased (Figure 6b, left). Complementarily, a chemically synthesized miR-487b-3p inhibitor markedly reduced endogenous miR-487b-3p expression (Figure 6b, right). Overexpression of miR-487b-3p decreased GRM3 protein expression whereas the inhibitor increased GRM3 protein expression (Figure 6c, left). However, GRM3 mRNA expression was not affected (Figure 6c, right). These results indicate that miR-487b-3p suppresses GRM3 expression by inhibiting its translation. To determine whether GRM3 is a direct target of miR-487b-3p, 3′-UTRs of GRM3 containing potential miR-487b-3p recognition element or mutated seed sequence (Figure 6d, left) was cloned into a luciferase construct. Luciferase assays revealed that miR-487b-3p repressed wild type but not mutant 3′-UTRs of GRM3 (Figure 6d, right). These results indicate that GRM3 is a direct target of miR-487b-3p. Of note, miR-487b-5p did not target GRM3 (Supplementary Figure S2).

MiR-487b-3p regulates PKA/AKT activation and mimics GRM3 knockdown effect in colon cancer cells

Similar to GRM3 knockdown, miR-487b-3p enhanced PKA activity (Figure 6e), increased pCREB and decreased pAKT (Figure 6f). MiR-487b-3p-expressing cells displayed increased apoptosis under GFDS (Figure 6g) and decreased anchorage-independent growth (Figure 6h; Supplementary Figure S3), indicating that miR-487b-3p mimicked the effect of GRM3 knockdown. In contrast, the miR-487b-3p inhibitor decreased GFDS-induced apoptosis (Figure 6i).

To determine whether miR-487b-3p-mediated effect could be reversed by restoration of GRM3 expression, GRM3 cDNA was infected into miR-487b-3p-expressing cells (Figure 6j). Ectopically expressed GRM3 is resistant to miR-487b-3p inhibition due to the lack of 3′-UTR. Restored GRM3 expression reversed miR-487b-3p-mediated increase of apoptosis (Figure 6k). These results indicate that miR-487b-3p sensitizes colon cancer cells to GFDS-induced apoptosis through down-regulation of GRM3.

To demonstrate that miR-487b-3p enhances TGFβ-mediated tumor suppressor function, FET cells were treated with TGFβ under GFDS for 14 hours. TGFβ induced apoptosis in miR-487b-3p-expressing cells but not in control cells (Figure 7a). In addition, TGFβ inhibited anchorage-independent growth by 96% in miR-487b-3p-expressing cells but only by 50% in control cells (Figure 7b; Supplementary Figure S3a). Restoration of GRM3 expression reversed miR-487b-3p-mediated sensitization to TGFβ-induced apoptosis (Figure 7c). Complementarily, FET cells were treated with TGFβ under GFDS for 24 hours. Although TGFβ-induced apoptosis in control cells, the miR-487b-3p inhibitor attenuated TGFβ-induced apoptosis (Figure 7d). These results indicated that miR-487b-3p enhances TGFβ-induced apoptosis by repressing GRM3 expression and that inhibition of miR-487b-3p antagonizes TGFβ effect. Of note, TGFβ does not regulate miR-487b-3p expression (data not shown).

Figure 7
figure 7

MiR-487b-3p mimics the effect of GRM3 knockdown in colon cancer cells. (a) Vector- or miR-487b-3p-expressing FET cells were treated with 4 ng/ml TGFβ under GFDS for 14 h. Cleaved PARP (left) and apoptosis (right) were determined. (b) Colony numbers were determined in soft agarose assays of vector- or miR-487b-3p-expressing FET cells treated with 0.5 ng/ml TGFβ. (c) MiR-487b-3p-expressing FET cells were infected with GRM3 cDNA and treated with 4 ng/ml TGFβ under GFDS for 14 h. Cleaved PARP (left) and apoptosis (right) were determined. (d) FET cells transfected with the miR-487b-3p inhibitor were treated with 4 ng/ml TGFβ under GFDS for 24 h. Cleaved PARP (left) and apoptosis (right) were determined. The data are presented as the mean±s.d. of three replications. *P<0.05, **P<0.01.

Full size image

MiR-487b-3p inhibits tumor growth in vivo

To determine the function of miR-487b-3p in vivo, athymic nude mice were subcutaneously inoculated with CBS control or miR-487b-3p-expressing cells. Xenograft tumor growth curves indicated that tumors of control cells (designated control tumors) grew at a significantly higher rate than those of miR-487b-3p-expressing cells (designated miR-487b-3p tumors; Figure 8a). Consequently, control tumors were much bigger than miR-487b-3p tumors (Figure 8b). Analysis of GRM3 expression showed that the intensity of GRM3 staining and percentage of GRM3-positive cells were notably lower in miR-487b-3p tumors than in control tumors (Figure 8c). Moreover, TUNEL and Ki67 staining indicated more apoptotic cells and fewer proliferative cells in miR-487b-3p tumors than in control tumors (Figures 8d and e). These results demonstrate that miR-487b-3p suppresses GRM3 expression and inhibit tumor growth in vivo.

Figure 8
figure 8

MiR-487b-3p suppresses GRM3 expression and inhibits tumor growth in vivo. (a) Xenograft tumor growth curves of CBS control and miR-487b-3p-expressing cells is shown. n=16. (b) Representative images of tumors at the endpoint of experiments are shown. The pictures were taken on the same scale with the ruler with each tumor (Supplementary Figure S10). (c) Representative images of GRM3 staining in xenograft tumors are shown (upper). Quantification of staining intensity and percentage of GRM3-positive cells was performed (lower). (d, e) Representative images of TUNEL (d) and Ki67 (e) staining are shown (left). Percentage of positive TUNEL (d) and Ki67 (e) staining cells were determined (right). Scale bars, 100 μm. The data are presented as the mean±s.d. *P<0.05, **P<0.01. (f) A proposed model of crosstalk between miR-487b-3p, GRM3 and TGFβ signaling in regulation of PKA/AKT activation, cell survival, proliferation and tumorigenesis of colon cancer cells.

Full size image

Expression of miR-487b-3p is decreased in colon cancer specimens

To explore clinical relevance of miR-487b-3p, its expression was determined by in situ hybridization in the same sets of TMAs utilized in Figure 1. The staining intensity of miR-487b-3p was much stronger in miR-487b-3p-expressing tumors than in control tumors (Figure 9a), verifying the specificity of the probe. Analysis of TMAs indicated that miR-487b-3p expression was very high in normal colon epithelium, but decreased markedly in colon tumors (Figure 9b). Quantification of staining showed that the average intensity was significantly lower in colon adenocarcinomas than in normal colon (Figure 9c), which is consistent with results from TCGA databases (Supplementary Figure S4). In addition, the correlation study revealed a significant inverse correlation between miR-487b-3p and GRM3 expression (Figure 9d, ***P=0.0003). These results demonstrate that miR-487b-3p expression is decreased in colon adenocarcinomas and that miR-487b-3p expression is inversely correlated with GRM3 expression.

Figure 9
figure 9

Expression of miR-487b-3p is decreased in colon cancer specimens. In situ hybridization analysis of miR-487b-3p was performed in xenograft tumors and human specimens. (a) Representative images of miR-487b-3p staining in xenograft tumors are shown. Scale bars, 100 μm. (b) Normal colon in the absence of the probe was used as a negative control. Representative images of miR-487b-3p staining in normal colon and colon tumors are shown. Scale bars, 100 μm. (c) Quantification of the staining intensity was performed. The values of individual samples are shown. Error bars indicate s.e.m. of the values. **P<0.01. (d) Correlation of expression of miR-487b-3p and GRM3 was determined using Pearson's test (r=0.439, ***P=0.0003; n=64). The slope was generated by lineage regression analysis.

Full size image

Taken together, our studies suggest a novel model of crosstalk between miR-487b-3p, GRM3 and TGFβ signaling (Figure 8f). In this model, although miR-487b-3p inhibits GRM3 translation, TGFβ increases GRM3 protein stability as a negative feedback mechanism to antagonize TGFβ-induced PKA activation, AKT inhibition and suppression of cell survival, proliferation and tumorigenesis. Therefore, inhibition of GRM3 or expression of miR-487b-3p prevents this negative feedback and enhances TGFβ-mediated tumor suppressor function.

Discussion

Although GRM3 protein expression is considerably higher in colon adenocarcinomas than in normal colon (Figure 1), analysis of TCGA databases reveals that GRM3 mRNA remains unchanged (data not shown). It suggests that GRM3 upregulation is mediated at the post-transcriptional level. Although transcriptional regulation of GRM3 has been reported,50, 51, 52, 53 our findings that miR-487b-3p directly targets GRM3 to suppress its translation and that TGFβ increases GRM3 protein stability provide novel mechanisms of post-transcriptional regulation of GRM3 in colon cancer. Of note, GRM2, the other group II metabotropic glutamate receptor, and GRM4, reported to be present in colon cancer cells,8 are barely expressed in colon cancer cells used in the study (Figure 2a; Supplementary Figure S5), suggesting that they may not have a role in colon cancer.

When correlating GRM3 expression with clinicopathological features of tumors, no significant correlation was found between GRM3 expression and tumor grades or stages (data not shown). However, percentage of GRM3-positive cells is noticeably higher in poorly-differentiated tumors than moderately-differentiated ones (Supplementary Figure S6a). Owing to the small sample size of well-differentiated tumors, the difference between well-differentiated tumors and moderately- or poor-differentiated ones is not significant. In addition, GRM3 expression is significantly higher in pancreatic tumors than in normal pancreas (Supplementary Figures S6b and c), indicating that upregulation of GRM3 expression is not specific to colon cancer.

It has been shown that mGluRs, such as GRM1 and mutant GRM3, activate the MEK pathway in nervous and melanoma cells.9, 11 In this study, we show that GRM3 knockdown activates PKA and inhibits AKT in colon cancer cells. In addition, GRM3 knockdown or overexpression of miR-487b-3p also decreases ERK activity (Supplementary Figure S7). It indicates that GRM3 can activate multiple cancer-related signaling pathways and that the components of the glutamatergic system are active in colon cancer cells. Although we show that GRM2 expression is not upregulated in colon cancer cells, it remains to be determined whether other glutamate receptors or other elements of glutamate signaling are aberrantly expressed in colon cancer.

Our studies indicate that GRM3 antagonizes TGFβ-mediated tumor suppressor effect and that TGFβ increases GRM3 protein stability in a Smad2/3-dependent manner. These results suggest that there is a negative feedback regulation between GRM3 and TGFβ signaling (Figure 8f). This is of significance as TGFβ is a major tumor suppressor in colon cancer.21, 22, 39, 41 The negative feedback regulation between TGFβ and GRM3 could potentially prevent efficient intervention of tumor growth and progression by TGFβ signaling. In addition, it will be interesting to investigate whether TGFβ increases GRM3 expression in cancers where TGFβ functions as a tumor promoter (that is, breast cancer). If so, given that GRM3 activates AKT and MEK signaling pathways, GRM3 could potentially contribute to TGFβ-mediated tumor promoting function (that is, EMT and so on). Therefore, inhibition of GRM3 could not only enhance TGFβ-mediated tumor suppressor function but also counteract TGFβ-mediated tumor promoting function, making targeting GRM3 an efficient anti-cancer approach despite of dual function of TGFβ signaling. Furthermore, GRM3 can also function independently of TGFβ signaling as GRM3 knockdown in HCT116 cells with defective TGFβ signaling increased apoptosis and reduced anchorage-independent growth (Figure 2). Hence, GRM3 can be a promising molecular target in colon cancer defective of TGFβ signaling, which occurs in 30–40% of colon cancer patients.

It has been reported that GRM3 negatively regulates BMP signaling in glioma cells.12 However, we found that GRM3 knockdown did not activate BMP signaling in colon cancer cells (Supplementary Figure S8a). In addition, unlike TGFβ, BMP treatment did not increase GRM3 expression (Supplementary Figure S8b). These results suggest that BMP signaling is not likely involved in the effects mediated by GRM3 knockdown and in the regulation of GRM3 expression.

Taken together, we have identified a signaling axis, miR-487b-3p/GRM3/TGFβ/PKA/AKT, as an important regulator of tumorigenesis in colon cancer. Our studies suggest that GRM3 could be a novel molecular target for colon cancer treatment. However, one concern to target glutamate signaling for cancer treatment is whether it would affect brain or neuron function. A significant amount of work has gone into designing and testing of drugs to modulate glutamatergic system to treat neurological and psychiatric disorders. Pharmaceutical companies have generated libraries of compounds that are not optimal for treating neuropsychiatric disorders due to problems such as inability to readily penetrate blood brain barriers. However, those compounds could be ideal agents for other applications, for example, anti-cancer therapy. As GRM3 is mainly upregulated in colon cancer but rarely expressed in normal peripheral tissues, targeting GRM3 with such agents would not likely cause adverse neurological or peripheral side effects, making GRM3 an attractive and specific target for colon cancer treatment.

Materials and methods

Cell lines and reagents

The immortalized human colon epithelial cells (HCEC) were provided by Dr. Jerry Shay.38 The human colon cancer HCT116, RKO, FET, CBS, HCT116b,GEO and HT29 cells were cultured in McCoy’s 5A medium (Sigma, St Louis, MO, USA) with 10 ng/ml epidermal growth factor (EGF), 20 μg/ml insulin and 4 μg/ml transferrin.54 When subjected to GFDS, cells were cultured in medium without EGF, insulin and transferrin. Cells were maintained at 37 °C in a humidified incubator with 5% CO2 and checked periodically for mycoplasma contamination. TGFβ, LY341495 and miR-487b-3p inhibitor were obtained from R&D Systems (Minneapolis, MN, USA), Cayman (Ann Arbor, MI, USA) and Qiagen (Hilden, Germany), respectively. Antibodies for western blot or IHC analyses were described in Supplementary Table 1.

RT–PCR and Q-PCR assays

Expression of miR-487b-3p was determined by miScript primer assays and miScript SYBR Green PCR Kit from Qiagen. RNU6-2 was used as an endogenous reference gene.

Q-PCR analysis of GRM3 mRNA was performed using SYBR Green qPCR Mastermixes (Qiagen). The primer sequences are GCACCTCAACAGGTTCAGTGT-F and TGGTGGAGTCGAGGACTTCC-R.

RT–PCR analysis of GRM2 and GRM3 mRNA was performed using primers GRM2, GAGAAGGTGGGCCGTGCCATGAG-F and CGCTGCCTGCCCGCAGATAGGT-R and GRM3, GCTCCAACATCCGCAAGTCCTA-F and TGTCAATGGCCAGGTGCTTGTC-R.

Apoptosis assays

Apoptosis was detected using a DNA fragmentation ELISA assay kit (Roche, Basel, Switzerland) according to manufacturer’s protocol. Briefly, cells were seeded in 96-well plates and subjected to GFDS and/or treated with TGFβ. The cells were stained with MTT to determine cell numbers or lysed for ELISA assays to determine apoptosis. The relative apoptosis was determined by dividing ELISA values by MTT values of each sample.

Soft agarose assays

Cells were seeded in medium containing low melting agar (Thermo Scientific, Waltham, MA, USA) at 3000 cells per well in 6-well plates. Two weeks later, colonies were stained with 1% iodonitrotetrazolium violet (Sigma-Aldrich, St Louis, MO, USA) and counted.

Transwell assays

Cells were seeded onto the upper surface of 8-μm pore, 6.5 mm polycarbonate filters (Corning Costar, Corning, NY, USA) in medium without growth factors or serum, allowed to migrate towards medium with 10% FBS for 18 h and stained with MTT. The cells on the upper surface of the filter were removed with a cotton swab, and those migrated to the underside were dissolved in DMSO. Absorbance was read at 570 nm.

Plasmids construction

The miR-487b precursor-expressing lentiviral vector, pCDH-CMV, was from SBI. ShRNAs targeting GRM3 were cloned into FSIPPW lentiviral vector. The targeting sequences of GRM3 were: sh1, 5′-CAGAACATGGAAATAACCATT-3′and sh2, 5′-GCCTGTTTCCTATTAACGAAA-3′.11 ShRNAs for Smad2 and Smad3 are 5′-GCACTTGCTCTGAAATTTG-3′ and 5′-GGATTGAGCTGCACCTTGAATG-3′, respectively. PKACα shRNA was described previously.23 pCDF1-GRM3 was a gift from Yardena Samuels (Addgene, Cambridge, MA, USA; #31798).

Luciferase assays

The predicted miR-487b-3p recognition site in the 3′UTR of GRM3 and corresponding mutated sequences were synthesized and cloned into psiCHECK-2 (Promega, Madison, WI, USA) downstream of Renilla reporter gene. The reporter was transfected into cells and luciferase activity was measured 48 h later using Dual-Luciferase Reporter Assay (Promega). Values were normalized with firefly luciferase activity.

PKA assays

Kinase activity of PKA was measured with DetectX PKA activity kit (Arbor assays, Ann Arbor, MI, USA) following manufactory’s protocol.

In vivo xenograft model

Animal experiments were approved by University of Nebraska Medical Center (UNMC) Institutional Animal Care and Use Committee. CBS cells (4 × 106) expressing a control vector, miR-487b precursor, a scrambled shRNA or GRM3 shRNAs were injected into the flank of 4-6 week old male athymic nude mice on both sides (Harlan Laboratories, Indianapolis, IN, USA). In addition, mice injected with HCT116 cells (2 × 106) were treated with 10 mg/kg LY341495 (dissolved in 1.2 e.q. NaOH) by subcutaneous injection every day for 10 days. There were 7–8 mice and 14–16 tumors in each experimental group. Tumor volumes (V) were calculated by the formula V=W2 × L × 0.5, where W represents the largest tumor diameter and L represents the next largest tumor diameter.55, 56 On termination of the experiments, tumors were dissected out and photographed on the same scale.

TUNEL and Ki67 staining

Formalin-fixed paraffin embedded tissue blocks of xenograft tumors were stained for TUNEL and Ki67 as described previously.34, 35

IHC staining of GRM3 in xenograft tumors and human patient samples

Human sample study was performed with the approval of Institutional Review Board. TMAs consisting of triplicates of 1 mm cores of 65 colon adenocarcinomas and 29 adjacent normal tissues of patients treated at UNMC in 2008 and 2009 were obtained from tissue core.

IHC staining was performed in paraffin slides using Novolink Min Polymer Detection System (Leica, Wetzlar, Hesse, Germany) as described previously.56, 57 Briefly, slides were subjected to antigen retrieval using Novocastra Epitope Retrieval Solutions (Leica), pH6, followed by incubation with an anti-GRM3 antibody overnight at 4 °C. Slides were developed with DAB after incubation with Novolink polymer (Leica). Finally, slides were counterstained with hematoxylin. For each sample, ten randomly chosen fields were captured at × 40 magnification and quantified with Imagescope Software (Aperio Technologies, Vista, CA, USA).

In situ hybridization

The double DIG labeled probe for miR-487b-3p and hybridization kit were purchased from Exiqon. Hybridization was performed following Exiqon’s protocol. Briefly, tissues were deparaffinized and digested with proteinase K (15 μg/ml; Exiqon) for 10 min at 37 °C. Slides were incubated in hybridization buffer with 40 nM miR-487b-3p probe (5DigN/AAGTGGATGACCCTGTACGATT/3Dig_N/) in a humidified chamber at 45 °C overnight. Slides were then blocked with anti-digoxigenin-alkaline phosphatase antibodies (Roche) at 1:800 dilution for 1 h and stained with AP substrate (NBT/BCIP tablet, Roche) at 30 °C for 6 h. The nuclei were counterstained with nuclear fast red (Sigma). The staining intensity was determined using image pro plus (Media Cybernetics, Rockville, MD, USA).

Statistical analysis

Statistical analyses were performed using Bonferroni two-sided t-test, two-way ANOVA or Student’s t-test.

References

  1. Curtis DR, Phillis JW, Watkins JC . Chemical excitation of spinal neurones. Nature 1959; 183: 611–612.

    CAS  Article  PubMed  Google Scholar 

  2. Hayashi T . A physiological study of epileptic seizures following cortical stimulation in animals and its application to human clinics. Jpn J Physiol 1952; 3: 46–64.

    CAS  Article  PubMed  Google Scholar 

  3. Tanabe Y, Masu M, Ishii T, Shigemoto R, Nakanishi S . A family of metabotropic glutamate receptors. Neuron 1992; 8: 169–179.

    CAS  Article  PubMed  Google Scholar 

  4. Aramori I, Nakanishi S . Signal transduction and pharmacological characteristics of a metabotropic glutamate receptor, mGluR1, in transfected CHO cells. Neuron 1992; 8: 757–765.

    CAS  Article  PubMed  Google Scholar 

  5. Skerry TM . Genever PG. Glutamate signalling in non-neuronal tissues. Trends Pharmacol Sci 2001; 22: 174–181.

    CAS  Article  PubMed  Google Scholar 

  6. Hoogduijn MJ, Hitchcock IS, Smit NP, Gillbro JM, Schallreuter KU, Genever PG . Glutamate receptors on human melanocytes regulate the expression of MiTF. Pigment Cell Res 2006; 19: 58–67.

    CAS  Article  PubMed  Google Scholar 

  7. Tong Q, Ouedraogo R, Kirchgessner AL . Localization and function of group III metabotropic glutamate receptors in rat pancreatic islets. Am J Physiol Endocrinol Metab 2002; 282: E1324–E1333.

    CAS  Article  PubMed  Google Scholar 

  8. Chang HJ, Yoo BC, Lim SB, Jeong SY, Kim WH, Park JG . Metabotropic glutamate receptor 4 expression in colorectal carcinoma and its prognostic significance. Clin Cancer Res 2005; 11: 3288–3295.

    CAS  Article  PubMed  Google Scholar 

  9. Martino JJ, Wall BA, Mastrantoni E, Wilimczyk BJ, La Cava SN, Degenhardt K et al. Metabotropic glutamate receptor 1 (Grm1) is an oncogene in epithelial cells. Oncogene 2013; 32: 4366–4376.

    CAS  Article  PubMed  Google Scholar 

  10. Kim MS, Chang X, Nagpal JK, Yamashita K, Baek JH, Dasgupta S et al. The N-methyl-d-aspartate receptor type 2A is frequently methylated in human colorectal carcinoma and suppresses cell growth. Oncogene 2008; 27: 2045–2054.

    CAS  Article  PubMed  Google Scholar 

  11. Prickett TD, Wei X, Cardenas-Navia I, Teer JK, Lin JC, Walia V et al. Exon capture analysis of G protein-coupled receptors identifies activating mutations in GRM3 in melanoma. Nat Genet 2011; 43: 1119–1126.

    CAS  Article  PubMed  Google Scholar 

  12. Ciceroni C, Arcella A, Mosillo P, Battaglia G, Mastrantoni E, Oliva MA et al. Type-3 metabotropic glutamate receptors negatively modulate bone morphogenetic protein receptor signaling and support the tumourigenic potential of glioma-initiating cells. Neuropharmacology 2008; 55: 568–576.

    CAS  Article  PubMed  Google Scholar 

  13. Arcella A, Carpinelli G, Battaglia G, D'Onofrio M, Santoro F, Ngomba RT et al. Pharmacological blockade of group II metabotropic glutamate receptors reduces the growth of glioma cells in vivo. Neuro Oncol 2005; 7: 236–245.

    CAS  Article  PubMed  Google Scholar 

  14. D'Onofrio M, Arcella A, Bruno V, Ngomba RT, Battaglia G, Lombari V et al. Pharmacological blockade of mGlu2/3 metabotropic glutamate receptors reduces cell proliferation in cultured human glioma cells. J Neurochem 2003; 84: 1288–1295.

    CAS  Article  PubMed  Google Scholar 

  15. Zhou K, Song Y, Zhou W, Zhang C, Shu H, Yang H et al. mGlu3 receptor blockade inhibits proliferation and promotes astrocytic phenotype in glioma stem cells. Cell Biol Int 2014; 38: 426–434.

    CAS  Article  PubMed  Google Scholar 

  16. Wakefield LM, Roberts AB . TGF-beta signaling: positive and negative effects on tumorigenesis. Curr Opin Genet Dev 2002; 12: 22–29.

    CAS  Article  PubMed  Google Scholar 

  17. Bu P, Wang L, Chen KY, Rakhilin N, Sun J, Closa A et al. miR-1269 promotes metastasis and forms a positive feedback loop with TGF-beta. Nat Commun 2015; 6: 6879.

    CAS  Article  PubMed  Google Scholar 

  18. Calon A, Espinet E, Palomo-Ponce S, Tauriello DV, Iglesias M, Cespedes MV et al. Dependency of colorectal cancer on a TGF-beta-driven program in stromal cells for metastasis initiation. Cancer Cell 2012; 22: 571–584.

    CAS  Article  PubMed  Google Scholar 

  19. Gulubova M, Manolova I, Ananiev J, Julianov A, Yovchev Y, Peeva K . Role of TGF-beta1, its receptor TGFbetaRII, and Smad proteins in the progression of colorectal cancer. Int J Colorectal Dis 2010; 25: 591–599.

    Article  PubMed  Google Scholar 

  20. Wang J, Yang L, Yang J, Kuropatwinski K, Wang W, Liu XQ et al. Transforming growth factor beta induces apoptosis through repressing the phosphoinositide 3-kinase/AKT/survivin pathway in colon cancer cells. Cancer Res 2008; 68: 3152–3160.

    CAS  Article  Google Scholar 

  21. Wang J, Sun L, Myeroff L, Wang X, Gentry LE, Yang J et al. Demonstration that mutation of the type II transforming growth factor beta receptor inactivates its tumor suppressor activity in replication error-positive colon carcinoma cells. J Biol Chem 1995; 270: 22044–22049.

    CAS  Article  PubMed  Google Scholar 

  22. Wang J, Han W, Zborowska E, Liang J, Wang X, Willson JK et al. Reduced expression of transforming growth factor beta type I receptor contributes to the malignancy of human colon carcinoma cells. J Biol Chem 1996; 271: 17366–17371.

    CAS  Article  PubMed  Google Scholar 

  23. Chowdhury S, Howell GM, Rajput A, Teggart CA, Brattain LE, Weber HR et al. Identification of a novel TGFbeta/PKA signaling transduceome in mediating control of cell survival and metastasis in colon cancer. PLoS One 2011; 6: e19335.

    CAS  Article  PubMed  Google Scholar 

  24. Simms N, Rajput A, Sharratt EA, Ongchin M, Teggart CA, Wang J et al. Transforming growth factor-ss suppresses metastasis in a subset of human colon carcinoma cells. BMC Cancer 2012; 12: 221.

    CAS  Article  PubMed  Google Scholar 

  25. Forrester E, Chytil A, Bierie B, Aakre M, Gorska AE, Sharif-Afshar AR et al. Effect of conditional knockout of the type II TGF-beta receptor gene in mammary epithelia on mammary gland development and polyomavirus middle T antigen induced tumor formation and metastasis. Cancer Res 2005; 65: 2296–2302.

    CAS  Article  PubMed  Google Scholar 

  26. Yang L, Huang J, Ren X, Gorska AE, Chytil A, Aakre M et al. Abrogation of TGF beta signaling in mammary carcinomas recruits Gr-1+CD11b+ myeloid cells that promote metastasis. Cancer Cell 2008; 13: 23–35.

    CAS  Article  PubMed  Google Scholar 

  27. Veenendaal LM, Kranenburg O, Smakman N, Klomp A, Borel RI, van Diest PJ . Differential Notch and TGFbeta signaling in primary colorectal tumors and their corresponding metastases. Cell Oncol 2008; 30: 1–11.

    CAS  PubMed Central  PubMed  Google Scholar 

  28. Bacman D, Merkel S, Croner R, Papadopoulos T, Brueckl W, Dimmler A . TGF-beta receptor 2 downregulation in tumour-associated stroma worsens prognosis and high-grade tumours show more tumour-associated macrophages and lower TGF-beta1 expression in colon carcinoma: a retrospective study. BMC Cancer 2007; 7: 156.

    Article  PubMed  Google Scholar 

  29. Hamamoto T, Beppu H, Okada H, Kawabata M, Kitamura T, Miyazono K et al. Compound disruption of smad2 accelerates malignant progression of intestinal tumors in apc knockout mice. Cancer Res 2002; 622: 5955–5961.

    Google Scholar 

  30. Munoz NM, Upton M, Rojas A, Washington MK, Lin L, Chytil A et al. Transforming growth factor beta receptor type II inactivation induces the malignant transformation of intestinal neoplasms initiated by Apc mutation. Cancer Res 2006; 66: 9837–9844.

    CAS  Article  PubMed  Google Scholar 

  31. Sodir NM, Chen X, Park R, Nickel AE, Conti PS, Moats R et al. Smad3 deficiency promotes tumorigenesis in the distal colon of ApcMin/+ mice. Cancer Res 2006; 66: 8430–8438.

    CAS  Article  PubMed  Google Scholar 

  32. Takaku K, Oshima M, Miyoshi H, Matsui M, Seldin MF, Taketo MM . Intestinal tumorigenesis in compound mutant mice of both Dpc4 (Smad4) and Apc genes. Cell 1998; 92: 645–656.

    CAS  Article  Google Scholar 

  33. Zeng Q, Phukan S, Xu Y, Sadim M, Rosman DS, Pennison M et al. Tgfbr1 haploinsufficiency is a potent modifier of colorectal cancer development. Cancer Res 2009; 69: 678–686.

    CAS  Article  PubMed  Google Scholar 

  34. Du T, Zamore PD . microPrimer: the biogenesis and function of microRNA. Development 2005; 132: 4645–4652.

    CAS  Article  PubMed  Google Scholar 

  35. Bartel DP . MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: 215–233.

    CAS  Article  PubMed  Google Scholar 

  36. Zhang B, Pan X, Cobb GP, Anderson TA . microRNAs as oncogenes and tumor suppressors. Dev Biol 2007; 302: 1–12.

    CAS  Article  PubMed  Google Scholar 

  37. Schoepp DD, Jane DE, Monn JA . Pharmacological agents acting at subtypes of metabotropic glutamate receptors. Neuropharmacology 1999; 38: 1431–1476.

    CAS  Article  PubMed  Google Scholar 

  38. Roig AI, Eskiocak U, Hight SK, Kim SB, Delgado O, Souza RF et al. Immortalized epithelial cells derived from human colon biopsies express stem cell markers and differentiate in vitro. Gastroenterology 2010; 138: 1012–1021.

    Article  PubMed  Google Scholar 

  39. Markowitz S, Wang J, Myeroff L, Parsons R, Sun L, Lutterbaugh J et al. Inactivation of the type II TGF-beta receptor in colon cancer cells with microsatellite instability. Science 1995; 268: 1336–1338.

    CAS  Article  Google Scholar 

  40. Chowdhury S, Ongchin M, Sharratt E, Dominguez I, Wang J, Brattain MG et al. Intra-tumoral heterogeneity in metastatic potential and survival signaling between iso-clonal HCT116 and HCT116b human colon carcinoma cell lines. PLoS One 2013; 8: e60299.

    CAS  Article  PubMed  Google Scholar 

  41. Ye SC, Foster JM, Li W, Liang J, Zborowska E, Venkateswarlu S et al. Contextual effects of transforming growth factor beta on the tumorigenicity of human colon carcinoma cells. Cancer Res 1999; 59: 4725–4731.

    CAS  PubMed Central  PubMed  Google Scholar 

  42. Woodford-Richens KL, Rowan AJ, Gorman P, Halford S, Bicknell DC, Wasan HS et al. SMAD4 mutations in colorectal cancer probably occur before chromosomal instability, but after divergence of the microsatellite instability pathway. Proc Natl Acad Sci USA 2001; 98: 9719–9723.

    CAS  Article  PubMed  Google Scholar 

  43. da Costa LT, He TC, Yu J, Sparks AB, Morin PJ, Polyak K et al. CDX2 is mutated in a colorectal cancer with normal APC/beta-catenin signaling. Oncogene 1999; 18: 5010–5014.

    CAS  Article  PubMed  Google Scholar 

  44. Kingston AE, Ornstein PL, Wright RA, Johnson BG, Mayne NG, Burnett JP et al. LY341495 is a nanomolar potent and selective antagonist of group II metabotropic glutamate receptors. Neuropharmacology 1998; 37: 1–12.

    CAS  Article  PubMed  Google Scholar 

  45. Banerjee A, Pirrone V, Wigdahl B, Nonnemacher MR . Transcriptional regulation of the chemokine co-receptor CCR5 by the cAMP/PKA/CREB pathway. Biomed Pharmacother 2011; 65: 293–297.

    CAS  Article  PubMed  Google Scholar 

  46. Geng L, Chaudhuri A, Talmon G, Wisecarver JL, Wang J . TGF-Beta suppresses VEGFA-mediated angiogenesis in colon cancer metastasis. PLoS One 2013; 8: e59918.

    CAS  Article  PubMed  Google Scholar 

  47. Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP . MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 2007; 27: 91–105.

    CAS  Article  PubMed  Google Scholar 

  48. Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ et al. Combinatorial microRNA target predictions. Nat Genet 2005; 37: 495–500.

    CAS  Article  PubMed  Google Scholar 

  49. Betel D, Koppal A, Agius P, Sander C, Leslie C . Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol 2010; 11: R90.

    Article  PubMed  Google Scholar 

  50. Cha JH, Kosinski CM, Kerner JA, Alsdorf SA, Mangiarini L, Davies SW et al. Altered brain neurotransmitter receptors in transgenic mice expressing a portion of an abnormal human huntington disease gene. Proc Natl Acad Sci USA 1998; 95: 6480–6485.

    CAS  Article  PubMed  Google Scholar 

  51. Lourenco NF, Schadrack J, Platzer S, Zieglgansberger W, Tolle TR, Castro-Lopes JM . Expression of metabotropic glutamate receptors mRNA in the thalamus and brainstem of monoarthritic rats. Brain Res Mol Brain Res 2000; 81: 140–154.

    Article  Google Scholar 

  52. Minoshima T, Nakanishi S . Structural organization of the mouse metabotropic glutamate receptor subtype 3 gene and its regulation by growth factors in cultured cortical astrocytes. J Biochem 1999; 126: 889–896.

    CAS  Article  PubMed  Google Scholar 

  53. Neto FL, Schadrack J, Platzer S, Zieglgansberger W, Tolle TR, Castro-Lopes JM . Up-regulation of metabotropic glutamate receptor 3 mRNA expression in the cerebral cortex of monoarthritic rats. J Neurosci Res 2001; 63: 356–367.

    CAS  Article  PubMed  Google Scholar 

  54. Boyd DD, Levine AE, Brattain DE, McKnight MK, Brattain MG . Comparison of growth requirements of two human intratumoral colon carcinoma cell lines in monolayer and soft agarose. Cancer Res 1988; 48: 2469–2474.

    CAS  PubMed Central  PubMed  Google Scholar 

  55. Zhang Y, Geng L, Talmon G, Wang J . MicroRNA-520g confers drug resistance by regulating p21 expression in colorectal cancer. J Biol Chem 2015; 290: 6215–6225.

    CAS  Article  PubMed  Google Scholar 

  56. Zhang Y, Talmon G, Wang J . MicroRNA-587 antagonizes 5-FU-induced apoptosis and confers drug resistance by regulating PPP2R1B expression in colorectal cancer. Cell Death Dis 2015; 6: e1845.

    CAS  Article  PubMed  Google Scholar 

  57. Geng L, Chaudhuri A, Talmon G, Wisecarver JL, Are C, Brattain M et al. MicroRNA-192 suppresses liver metastasis of colon cancer. Oncogene 2014; 33: 5332–5340.

    CAS  Article  PubMed  Google Scholar 

Download references

Acknowledgements

This work was supported by NIH/NCI R01CA140988-01 to JW. HY was partially supported by Chinese Scholar Council.

Author information

Affiliations

  1. Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, USA

    H Yi & J Wang

  2. Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, NE, USA

    L Geng, A Black & J Wang

  3. Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, NE, USA

    G Talmon

  4. Department of Internal Medicine Oncology/Hematology, University of Nebraska Medical Center, Omaha, NE, USA

    L Berim

  5. Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, USA

    J Wang

Authors
  1. H Yi
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. L Geng
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. A Black
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. G Talmon
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. L Berim
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. J Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to J Wang.

Ethics declarations

Competing interests

The authors declare no conflict of interest.

Additional information

Supplementary Information accompanies this paper on the Oncogene website

Supplementary information

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Yi, H., Geng, L., Black, A. et al. The miR-487b-3p/GRM3/TGFβ signaling axis is an important regulator of colon cancer tumorigenesis. Oncogene 36, 3477–3489 (2017). https://doi.org/10.1038/onc.2016.499

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/onc.2016.499

Further reading

Search

Advanced search

Quick links