Abstract
We have previously demonstrated that Krüppel-like factor 8 (KLF8) participates in oncogenic transformation of mouse fibroblasts and is highly overexpressed in human ovarian cancer. In this work, we first correlated KLF8 overexpression with the aggressiveness of ovarian patient tumors and then tested if KLF8 could transform human ovarian epithelial cells. Using the immortalized non-tumorigenic human ovarian surface epithelial cell line T80 and retroviral infection, we generated cell lines that constitutively overexpress KLF8 alone or its combination with the known ovarian oncogenes c-Myc, Stat3c and/or Akt and examined the cell lines for anchorage-independent growth and tumorigenesis. The soft agar clonogenic assay showed that T80/KLF8 cells formed significantly more colonies than the mock cells. Interestingly, the cells expressing both KLF8 and c-Myc formed the largest amounts of colonies, greater than the sum of colonies formed by the cells expressing KLF8 and c-Myc alone. These results suggested that KLF8 might be a weak oncogene that works cooperatively with c-Myc to transform ovarian cells. Surprisingly, overexpression of KLF8 alone was sufficient to induce tumorigenesis in nude mice resulting in short lifespan irrespective of whether the T80/KLF8 cells were injected subcutaneously, intraperitoneally or orthotopically into the ovarian bursa. Histopathological studies confirmed that the T80/KLF8 tumors were characteristic of human serous ovarian carcinomas. Comparative expression profiling and functional studies identified the cell cycle regulators cyclin D1 and USP44 as primary KLF8 targets and effectors for the T80 transformation. Overall, we identified KLF8 overexpression as an important factor in human ovarian carcinoma pathogenesis.
Introduction
Ovarian cancer remains the leading cause of death among cancers in women due to the lack of early detection methods and effective therapies for late-stage cancers.1 Although various oncogenes including H-Ras,2, 3, 4 K-Ras,3, 5 c-Myc,5 Akt,5, 6, 7, 8, 9, 10, 11, 12 HER213 and STAT3c14 and tumor suppressor genes such as p53,15 pRb,15 pTEN,16, 17 BRAC1 and BRCA218, 19, 20, 21, 22, 23 have been reported to contribute to ovarian cancer progression, the causes of ovarian cancer remain largely unknown. Further understanding of the mechanisms behind ovarian cancer progression is urgent for developing new diagnosis and treatment strategies to improve patient survival. The vast majority of ovarian cancer derives from the ovarian surface epithelium (OSE). Several experimental models have recently been developed to study the transformation of OSE, including genetically modified mouse models,15, 24 ex vivo oncogene introduction mouse models5 and manipulation of cultured human OSE cells.2 The immortalized human OSE cell lines are particularly useful for assessing molecular and signaling mechanisms directly relevant to human patients.2, 4, 13
Krüppel-like factor 8 (KLF8) is a widely expressed transcription factor and functions both as a transcription repressor25 and an activator26, 27, 28 of a growing list of target genes including γ-globin,25, 29 KLF4,27 E-cadherin,30, 31 cyclin D127, 28, 30, 32, 33 and MMP9.26 The expression and nuclear function of KLF8 are also tightly regulated by important signaling cascades including focal adhesion kinase through Src and PI3K signaling pathways,28, 34, 35 the transcription factors Sp1,34 KLF136 and KLF336 and by various types of post-translational modification mechanisms such as SUMOylation,27, 32 acetylation,32, 33 PARylation,37 ubiquitylation,37 phosphorylation38 and nuclear localization.38 Importantly, recent studies have correlated aberrant overexpression of KLF8 with the malignancy of several types of human cancer including breast,26, 30, 34 ovarian,34, 39 hepatocellular carcinoma,31 renal,39, 40 gastric41 and glioma.42, 43, 44 KLF8 has also been shown to have a role in the transformation of the mouse fibroblast NIH 3T3 cells.39 All these lines of evidence have pointed out a potentially causal role of KLF8 in human cancer progression that has not been investigated to date.
In this study, we demonstrate that ectopic overexpression of KLF8 in immortalized non-tumorigenic human OSE cells was sufficient to induce anchorage-independent growth in culture as well as tumorigenesis in mice, the hallmarks of malignant transformation. We also show a strong correlation of aberrant high levels of KLF8 with the aggressiveness of ovarian patient tumors. Our results support a potentially important role of KLF8 in human ovarian cancer development and provide a novel model for ovarian cancer studies.
Results
KLF8 protein is highly expressed in human malignant and metastatic ovarian tumors
Our previous reports have demonstrated that KLF8 is aberrantly overexpressed in human ovarian cancer cell lines at both message and protein levels and this aberrant overexpression was confirmed in tumor samples of ovarian patient at message levels.39 To determine the protein expression of KLF8 in ovarian patient tumors, we performed human ovarian cancer progression tissue array analysis by IHC staining (Figure 1a). We found that KLF8 protein is highly overexpressed in malignant and metastatic ovarian tumors. In borderline and benign tumors, the high levels of KLF8 protein were mostly limited to OSE. There was rare expression of KLF8 protein in normal tissues adjacent to tumors or in normal ovarian specimens. A gradually increased correlation between KLF8 expression and the multistep progression of the ovarian tumors was obvious (Figure 1b). These results suggest that aberrant elevation of KLF8 expression may have a critical role in transforming OSE cells into cancer cells, promoting the tumor progression and maintaining the tumor aggressiveness.
The aberrant overexpression of KLF8 protein is highly correlated with the aggressiveness of human ovarian tumors. (a) Representative IHC staining images of patient specimens. Human ovarian tissue array (OV1005, US Biomax) was stained with anti-KLF8 antibody (brown). The nuclei were counterstained with hematoxylin (blue). (b) Summary of the staining result from (a). Tumor scoring is described in Supplementary Table 1. *P-value was analyzed by Fisher’s exact test, comparing KLF8 expression to Normal. Normal, normal ovarian tissue; NAT, cancer adjacent normal ovarian tissue; Benign, mucinous or serous cystadenoma; Borderline, borderline mucinous of serous papillary cystadenoma; Invasive, Invasive ovarian carcinoma, adenocarcinoma or cystadenocarcinoma; Metastatic, metastasized ovarian cystadenocarcinoma or adenocarcinoma.
KLF8 has an important role in transforming human OSE cells
We have demonstrated that ectopic expression of KLF8 can partially transform mouse fibroblast cells in culture and enhance the oncogenic effect of v-Src in NIH 3T3 cells.39 To test whether KLF8 has a role in transforming human OSE cells, alone or in cooperation with other ovarian oncogenic proteins, we infected the immortalized non-tumorigenic human OSE T80 cells2 with retroviruses to generate T80 cell lines constitutively expressing the empty vector (mock), KLF8, c-Myc, Akt and Stat3c alone or in combination (Figure 2a). The cell lines were then tested for their capability of anchorage-independent growth in soft agar, a hallmark of malignant transformation of cells (Figure 2b). We found that mock cells, like the parental T80 cells,2 formed few or no colonies; in sharp contrast, the T80/KLF8 cells formed ∼2.5 times more colonies than the mock cells (Figure 2c, compare columns 2 and 1), though a little less than T80/c-Myc, T80/Akt, or T80/STAT3c cells (Figure 2c, compare columns 3–4 to 1). Interestingly, the cells expressing both KLF8 and c-Myc formed the largest amounts of colonies (column 6), comparable to that formed by the cells expressing the four proteins altogether (column 12), that were even greater than the sum of colonies formed by the cells expressing KLF8 alone and by the cells expressing c-Myc alone. Consistent with the colony formation result, the cell lines showed accelerated BrdU incorporation rate (Figure 2d) and proliferation rate (Figure 2e). Taken together, these results suggest that KLF8 alone may be capable of transforming T80 cells, and more potent on cooperation with c-Myc, but not with Akt or STAT3c, and that aberrant increase in cell cycle progression and proliferation may be a mechanism underlying KLF8-induced T80 transformation.28, 34, 39
Overexpression of KLF8 transforms human ovarian epithelial cells. (a) Confirmation of T80 cell lines (shown on the top) constitutively overexpressing KLF8 (K), c-Myc (M), Akt (A), Stat3c (S) or their combinations. The cell lines were generated as described in Materials and methods. Whole cell lysates were used for western blotting for the indicated proteins shown on the left. (b and c) KLF8 promotes anchorage-independent growth. The cell lines described in A were grown in soft agar culture and colonies were photographed and counted. (d) KLF8 accelerates G1 to S phase progression of the cell cycle. After 48 h serum starvation, the cells were stimulated with serum containing BrdU for 12 h and subject for BrdU incorporation analysis. (e), KLF8 increases cell proliferation. The cells were grown and subject to WST-1 assay as described in Material and methods. The numbers for the lanes and columns in all the panels label the same cell lines as indicated on the top of panel (a). *P<0.05 compared with mock by χ2-test.
KLF8 alone is sufficient to induce ovarian tumorigenesis in vivo
To further study the oncogenic-transforming role of KLF8 in T80 cells, we first injected subcutaneously the T80/KLF8 cells into athymic nude mice and examined the tumorigenesis by the cells. Surprisingly, overexpression of KLF8 alone, like c-Myc or Akt alone, was sufficient to induce tumorigenesis in more than 50% of the mice (Figure 3A, Table 1) although the tumors developed relatively slowly (∼3–5 months after injection) compared with the SKOV3-ip1 positive control tumors (1–2 months after injection) (Figure 3B). STAT3c alone induced significantly smaller tumors and, as expected, the mock cells formed no tumors (Figures 3A and B). Similarly, the T80/KLF8 cells also induced tumorigenesis after intraperitoneal injection (Table 1). Consistent with the tumor formation rate, the average survival time for the mice was ∼6 months for T80/KLF8 compared with ∼2 months for SKOV3ip1 (Figure 3C). IHC staining verified the ectopic overexpression of KLF8 in the tumors (Figures 3Dc and d) and high similarity of the tumors to those in patients as determined by expression of the human ovarian cancer tumor marker proteins cytokeratin, CA125, HE4 and mesothelin (Figures 3De–h).
KLF8 alone is sufficient to induce T80 cells to form subcutaneous tumors resulting in shortened lifespan. (A) Representative subcutaneous tumors formed by the indicated cell lines. Mock and SKOV3-ip1 were used as negative and positive controls, respectively. Tumorigenesis experiments were carried out as described in Materials and methods. Photos were taken on 30 days (for SKOV3-ip1) or 105 days after injection. (B) Tumor formation rates Tumor volumes were recorded at the indicated time points (see tumor incidence in Supplementary Table 1). (C) T80/KLF8 tumor formation shortened mouse survival time. Survival distribution was presented by Kaplan–Meier curve. (D) The T80/KLF8 tumors are highly similar to tumors of ovarian cancer patients. H & E and IHC staining of the tumors were performed as described in Materials and methods for expression of the KLF8 and human ovarian cancer marker proteins. (a), H & E (100 × ); (b), KLF8 (100 × ); (c), pan-cytokeratins (100 × ); (d), CA 125 (100 × ); (e), mesothelin (100 × ); (f), HE4 (100 × ). Inlets, 400 × .
To directly test whether the T80/KLF8 cells can form tumors right in the ovary, we injected the cells into the ovarian bursa of the mice and examined the tumor formation. Interestingly, the cells could form orthotopic tumors in two of six mice after 90 days post injections. SKOV3-ip3 formed tumors in five of six mice in 60 days post injection whereas the mock cells could not form any tumors within 90 days post injection (Figure 4A). Despite the smaller tumor sizes, lower incidence and longer latency than the SKOV3ip1 positive control tumors (Figure 4B, Table 1), histological analysis could not distinguish the T80 tumors from the tumors of clinical patients (Figure 4C).
KLF8 alone is sufficient to induce to induce T80 cells to form orthotopic ovarian tumors. (A) Representative ovarian tumors formed by KLF8 expressing T80 cells. Mock and SKOV3-ip1 were used as negative and positive controls, respectively. 5 × 105 cells per cell lines were injected into the ovarian bursa. Photos of representative mice (top) and tumors (bottom) were taken 60 days or (SKOV3-ip1) 90 days (mock and KLF8) after injection. (B) Tumor formation rate. The ovarian tumor volume recorded at the time of euthanasia is presented by box-plot (see tumor incidence in Supplementary Table 1). (C) The T80/KLF8 ovarian tumors are highly similar to tumors of ovarian cancer patients. H & E and IHC staining of the tumors were performed as described in Materials and methods for expression of the KLF8 and human ovarian cancer marker proteins. (a), H & E (100 × ); (b), KLF8 (100 × ); (c), pan-cytokeratins (100 × ); (d), CA 125 (100 × ); (e), mesothelin (100 × ); (f), HE4 (100 × ). Inlets, 400 × .
Taken together, these results further suggest that KLF8 can likely act alone as an ovarian oncogene.
KLF8 promotes ovarian cell proliferation by regulating the expression of cell cycle-associated genes including cyclin D1 and USP44
To understand the molecular mechanisms by which KLF8 transforms T80 cells, we first compared the gene expression profile in the T80/KLF8 cells with that in the mock cells using cDNA microarray (see Supplementary Table 1). We found that cyclin D1 was among the highly upregulated genes by KLF8, which is consistent with the results obtained in NIH 3T3 cells.28, 39 Interestingly, ubiquitin-specific protease 44 (USP44), a recently identified deubiquitinating enzyme targeting Cdc20 to counteract the ubiquitin E3 ligase APC at the spindle checkpoint of mitosis,45 was among the highly downregulated targets by KLF8 (see Supplementary Table 2). The regulation of cyclin D1 and USP44 by KLF8 was verified by RT-PCR and qRT-PCR at the mRNA levels and by western blotting at the protein levels in both T80 and SKOV3ip1 cells (Figures 5a–d). These results suggested that regulation of cyclin D1 and USP44 may be responsible for KLF8-promoted cell cycle progression and subsequent proliferation. Indeed, knockdown of cyclin D1 or re-expression of USP44 reversed the proliferation of T80/KLF8 cells back to the levels of the mock cells (Figure 5g). Knockdown of cyclin D1, but not re-expression of USP44, reversed the DNA synthesis back to the rate of the mock cells (Figure 5h), consistent with the positive role of cyclin D1 in G1 phase and the negative role of USP44 in M phase of the cell cycle. These results indicate that KLF8 regulation of cyclin D1 and USP44 at both G1 and M phases of the cell cycle has a critical role in the malignant transformation of immortalized human ovarian surface epithelial cells.
KLF8 promotes proliferation by upregulating cyclin D1 and downregulating USP44 expression in the human ovarian cells. (a–d) KLF8 upregulates cyclin D1 and downregulates USP44 expression. mRNA and whole cell lysates were prepared from T80 cells stably expressing empty vector (mock) or KLF8 (KLF8) (lanes or columns 1 and 2) or T80 cells transiently expressing wild type (wtKLF8) or transactivation-defective mutant (mKLF8) for 48 h (lanes or columns 3 and 4), or the SKOV3ip1 cells transiently transfected with control siRNA (siCtrl) or siRNA against KLF8 (siKLF8) for 48 h (lanes or columns 5 and 6) for RT-PCR (a), qRT-PCR (b and c) or western blotting (d). (e–h) Knockdown of cyclin D1 or re-expression of USP44 reverses the increased proliferation induced by KLF8 back to the mock level. T80 cells stably expressing KLF8 (KLF8) were transfected with non-targeting siRNA or siRNA against cyclin D1 for 72 h (lanes or columns 3 and 4, siCtrl and siCycD1) or with tet-on regulated USP44 vector for 24 h followed by induction of USP expression for 48 h (lanes or columns 5 and 6, USP44-U and USP44-I). A fraction of the cells were used for western blotting to confirm the cyclin D1 knockdown (a) and induced expression of USP44 (b). Two other fractions of the cells were used for analysis of cell proliferation (g) and BrdU incorporation (h), respectively. Mock and untreated KLF8 expressing T80 stable cells (lanes or columns 1 and 2, mock and untreated) were included as controls. U, expression uninduced; I, expression induced. *P<0.05.
Discussion
This novel study has demonstrated a close correlation of KLF8 expression with ovarian tumor progression, revealed a potentially significant role of KLF8 in the malignant transformation of human OSE, and sheds a new light on the mechanisms of ovarian cancer development.
KLF8 has been shown to transform both mouse fibroblast cells in vitro39 and human cells (this study) both in vitro and in vivo regardless of implantation sites. We have also observed that extopic expression of KLF8 promotes tumorigenesis of human mammary epithelial cells as well (submitted elsewhere) and that aberrant overexpression of KLF8 is well correlated with the aggressiveness of patient breast tumors.26, 30 These observations highly support an oncogenic role of KLF8 in human ovarian and breast cancer. Given its barely detectable expression in normal tissues, aberrant increase in KLF8 expression may have a causal role in cancer progression. It will be interesting to test whether KLF8 has a similar oncogenic role in tissue origins of other cancer types that also show abnormally high levels of KLF8.31, 40, 41, 43
KLF8 is considered to be widely expressed,25 although its expression in normal cells or tissues is frequently undetectable30, 34, 39, 46 (also see Figure 1). The mechanisms behind the differential expression of KLF8 between normal and tumor cells or tissues remain largely uninvestigated. Recent studies have demonstrated that the expression of KLF8 can be upregulated by overexpression and/or overactivation of focal adhesion kinase in the human ovarian cancer cell SKOV3ip134 or induced by TGF-β treatment in immortalized non-tumorigenic human breast epithelial cell MCF-10A.30 However, it is premature to consider these mechanisms as primary ones responsible for the aberrant overexpression of KLF8 in human cancer. Other mechanisms could also potentially contribute to the differential expression of KLF8 between normal and cancerous cells such as methylation or acetylation of KLF8 gene promoter, stabilization or destabilization of KLF8 protein and microRNA regulation of KLF8 message and protein translation.
Several other KLF family proteins have been shown to have either a tumor promoting (KLF4, KLF6, KLF9, KLF10, KLF11, and KLF17) or suppressing (KLF5, KLF12) role by intervening in cell signaling associated with proliferation and/or survival.47, 48, 49 Regardless of their apposing role in cancer, all the KLFs exert their cancer regulating function via altering the expression of some of their transcriptional target genes. The fact that both cyclin D1 and USP44 are involved in mediating the oncogenic function of KLF8 (see Figure 5) indicates that in the ovarian cells KLF8 promotes cell proliferation by accelerating the cell cycle progression at both G1 and M phase. This novel finding is consistent with a recent report that USP44 is highly expressed in normal ovaries.50 Interestingly, USP44 has been shown to be significantly downregulated in hepatocellular carcinoma serum,51 suggesting that USP44 may serve not only as a negative effector of KLF8 in hepatocellular carcinoma progression but also as a biomarker for the diagnosis of human cancers associated with the elevated expression of KLF8. Since USP44 has a key role in spindle-assembly checkpoint,45 whether or not KLF8 regulates this checkpoint and chromosomal stability is an interesting future work.
It is widely accepted that transformation process often involves alteration of more than one oncogene as well as tumor suppressor genes. The immortalized (by SV40 T/t antigens and hTERT) feature of the T80 cells suggests that KLF8 could work on top of the loss of p53 and pRb function or gain of the telomerase function to transform the cells. This could explain why KLF8 induces clonogenesis by T80 but not by NIH 3T3 cells.39 Alternatively, this discrepancy could be due to other differences between the T80/KLF8 (human, pooled lines with constitutive expression) and 3T3/KLF8 cell lines (mouse, clonal lines with inducible expression). Indeed, we found that KLF8 promoted tumorigenesis of an immortalized non-tumorigenic human breast cell line that expresses normal p53 and pRb (submitted elsewhere). The lack of apparent cooperation between KLF8 and Akt or STAT3c (see Figure 2) could be explained by the fact that KLF8 is downstream of both of them.34, 52 It is obvious that KLF8 cooperates with c-Myc in transforming T80 cells in vitro. Whether or not KLF8 and c-Myc regulate mutual expression in our experimental conditions is not known. However, a recent report has demonstrated that KLF8 has a role downstream of Wnt to upregulate c-Myc expression through β-catenin and subsequent expression of cyclin D1 in human liver cancer cells.46, 53 This could be the case in ovarian and/or breast cancer where KLF8 has been demonstrated to regulate cyclin D1 and/or β-catenin.30, 34, 46 It will be interesting to test whether and how co-overexpression of both similarly enhances transformation in vivo and increases the tumor aggressiveness such as ascites and metastasis. It is completely uninvestigated whether or not KLF8 regulates tumor suppressor genes or vice versa in ovarian or other types of cancer, which could further complicate the role and mechanisms of KLF8 in cancer. Nevertheless, these outstanding questions can be better answered using genetically engineered mouse models for KLF8 and the other oncogenes or tumor suppressor genes in combination with primary human epithelial cells. Experiments in these regards are in progress.
In summary, we have identified KLF8 as a potential ovarian oncogene. Given its barely detectable expression in normal ovarian cells and tissue, KLF8 may represent a novel intervention target against ovarian cancer. The cell and mouse models generated in this work provide new tools for the studies of mechanisms underlying human ovarian cancer progression.
Materials and Methods
Cell culture, cell lines and reagents
The immortalized human ovarian epithelial cell line T802 and human ovarian cancer cell line SKOV3ip1 were maintained as previously described.34 pBabe-puro-HA-KLF8 was described previously,30 pLPC-c-Myc was constructed by transferring human c-Myc cDNA from pBS vector54 to pLPC retroviral vector between Bam HI and Eco RI sites. pBabe-neo-Flag-Stat3c was made by transferring the Flag-STAT3c cDNA from Stat3-c Flag pRc/CMV (Plasmid # 8722, Addgene, Cambridge, MA, USA) by PCR using primers 5′- ATGAATTCTTCTGCAGATATCCATCACAC (forward) and 5′- ATGTCGACAGCGAGCTCTAGCATTTAGG (reverse) and ligation into pBABE-neo (Addgene, plasmid # 1767) between Eco RI and Sal I site), and pLNCX-myr-HA-Akt was from Addgene (plasmid # 9005). After verification by sequencing, these retroviral vectors were used to produce viruses and infect T80 cells alone or in combination as previously described.30 Each of the cell lines was established as a pool of positively infected cells selected with either puromycin (KLF8 and Myc) or G418 (Stat3c and Akt). Insertless vector was used to generate mock control cell line (mock). Constitutive expression of the proteins was confirmed by western blotting using an antibody against HA (F-7), Myc (9E10) or Flag (sc-807) (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). USP44 tet-on inducible expression vector was from Addgene (plasmid #2260455). Anti-cyclin D1 antibody (sc-718) and anti-USP44 antibody (sc-79329) were purchased from Santa Cruz Biotechnology Inc. Anti-Akt was purchased from Cell Signaling Technology Inc. (Danvers, MA, USA).
Soft agar colony formation assay
Assays were performed in 12-well plates with 1000 or 5000 cells/well, resuspended as a single cell suspension in 0.4% agar and layered on top of 0.8% agar. The plates were incubated for 14 days. Colonies were counted manually under 10 × objective lenses. The counting was performed for 10 fields in each well, and at least three wells per condition were counted in each experiment.
Cell proliferation assay
Premixed WST-1 cell proliferation reagent was used and assays were performed based on manufacturer’s instruction (Clontech Laboratories, Inc., Mountain View, CA, USA). Briefly, cells were seeded at 2 × 104 cells/well in 24-well plate. After 48–72 h, optical density values at 450 nm were measured 2 h after incubation with WST-1, using a multiple bio-reader (Perkin Elmer, Billerica, MA, USA).
BrdU incorporation assay, RNA interference, qRT-PCR and western blotting
These assays were performed as previously described.28, 30 OnTarget Plus siRNAs and scramble control siRNAs specific to human cyclin D1 and KLF8 were purchased from Dharmacon (Lafayette, CO, USA). The siRNA was transfected into T80/KLF8 cells or SKOV3ip1 cells using Oligofectamine according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). Primers for qRT-PCR: cyclin D1, 5′- CCGTCCATGCGGAAGATC (forward) and 5′- GAAGACCTCCTCCTCGCACT (reverse); USP44, 5′- CTCACAGAAGCCCAGAAACA (forward) and 5′- AAAGCCAACATGAACACCAA (reverse); GAPDH, 5′- TCGTACGTGGAAGGACTCA (forward) and 5′- CCAGTAGAGGCAGGGATGAT (reverse).
Ovarian epithelial tumorigenesis in mice
Four to 5-week-old nude athymic female mice (Taconic, Germantown, NY, USA) were injected subcutaneously or intraperitoneally with 5 × 106 T80 cell lines stably expressing ectopic KLF8, c-Myc, Akt or Stat3c, alone or in combination. Intrabursal orthotopic injection of the cells (5 × 105 in 10 μl) was performed as previously described.15 T80 and SKOV3ip1 cells were used as negative and positive controls, respectively. Subcutaneous tumor development was monitored by palpation twice a week, and tumor sizes were recorded. The tumor volume was calculated by the formula of V=0.5 × L × W2. Resected tumors were measured in three dimensions with a caliper, and their volume calculated using the formula of V=π/6 (L × W × H). The mice were housed and maintained in specific pathogen-free conditions in facilities approved by the American Association for Accreditation of Laboratory Animal Care and in accordance with current regulations and standards of the United States Department of Agriculture, United States Department of Health and Human Services, and the National Institute of Health. Animal care and use was approved by the Institutional Animal Care and Use Committee. Humane care of the mice was thoroughly considered.
Pathological analysis
Resected ovaries and tumors were characterized by microscopic evaluation of paraffin sections with H & E and IHC staining. IHC staining was performed following the manual instructions of Dako North America Inc. (Carpinteria, CA, USA). Briefly, paraffin sections were baked for 1 h at 62 °C for rehydration and microwaved in 0.01 M sodium citrate for 5 min for antigen retrieval. After incubation in 3% H2O2 for 6 min, the sections were serum-blocked for 30 min, incubated overnight at 4 °C with primary antibodies in phosphate-buffered saline and subsequently with biotin-labeled secondary antibodies for 30 min, followed by peroxidase-labeled avidin-biotin complex (Vector Laboratories, Burlingame, CA, USA) for 30 min. The sections were developed in 3,3-diaminobenzidine tetrahydrochloride for 2 min and counterstained with hematoxylin for 4 min. The stained sections were dehydrated, treated with xylene and mounted for microscopy. Positive staining was displayed in brown or black color. The antibodies used in IHC include anti-KLF8,30 anti-human CA125 (Clone M11, Dako), anti-human cytokeratin (Clones AE1/AE3, Dako), anti-cytokeratin 8 and18 (Clone Zym5.2, Invitrogen), anti-HE4 (Covance, Princeton, NJ, USA) and anti-mesothelin (Novocastra, Buffalo Grove, IL, USA).
Tissue array analysis
Human ovarian cancer progression tissue array (OV1005) was purchased from US Biomx Inc (Rockville, MD, USA). IHC staining was performed as previously described.26
Statistical analysis
All the data is summarized and presented as mean±s.d. for continuous variables and frequency counts for categorical variables with a minimum of three observations per group. The analysis of variance test or Fisher’s exact test was used to examine the statistical differences among treatment groups, as appropriate. The Bonferroni correction was used for multiple comparisons. Animal survival data were analyzed by Kaplan–Meier curve. Significance was determined at the alpha level of 0.05. All analyses were conducted using SAS (V9.2) (SAS Inc., Cary, NC, USA).
References
- 1
Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A et al. Cancer statistics, 2005. CA Cancer J Clin 2005; 55: 10–30.
- 2
Liu J, Yang G, Thompson-Lanza JA, Glassman A, Hayes K, Patterson A et al. A genetically defined model for human ovarian cancer. Cancer Res 2004; 64: 1655–1663.
- 3
Rosen DG, Yang G, Bast RC, Liu J . Use of Ras-transformed human ovarian surface epithelial cells as a model for studying ovarian cancer. Methods Enzymol 2006; 407: 660–676.
- 4
Yang G, Thompson JA, Fang B, Liu J . Silencing of H-ras gene expression by retrovirus-mediated siRNA decreases transformation efficiency and tumorgrowth in a model of human ovarian cancer. Oncogene 2003; 22: 5694–5701.
- 5
Orsulic S, Li Y, Soslow RA, Vitale-Cross LA, Gutkind JS, Varmus HE . Induction of ovarian cancer by defined multiple genetic changes in a mouse model system. Cancer Cell 2002; 1: 53–62.
- 6
Cheng JQ, Godwin AK, Bellacosa A, Taguchi T, Franke TF, Hamilton TC et al. AKT2, a putative oncogene encoding a member of a subfamily of protein-serine/threonine kinases, is amplified in human ovarian carcinomas. Proc Natl Acad Sci USA 1992; 89: 9267–9271.
- 7
Cheng JQ, Jiang X, Fraser M, Li M, Dan HC, Sun M et al. Role of X-linked inhibitor of apoptosis protein in chemoresistance in ovarian cancer: possible involvement of the phosphoinositide-3 kinase/Akt pathway. Drug Resist Updat 2002; 5: 131–146.
- 8
Fang Q, Naidu KA, Zhao H, Sun M, Dan HC, Nasir A et al. Ascorbyl stearate inhibits cell proliferation and tumor growth in human ovarian carcinoma cells by targeting the PI3K/AKT pathway. Anticancer Res 2006; 26: 203–209.
- 9
Liu AX, Testa JR, Hamilton TC, Jove R, Nicosia SV, JQ Cheng . AKT2, a member of the protein kinase B family, is activated by growth factors, v-Ha-ras, and v-src through phosphatidylinositol 3-kinase in human ovarian epithelial cancer cells. Cancer Res 1998; 58: 2973–2977.
- 10
Yang H, He L, Kruk P, Nicosia SV, Cheng JQ . Aurora-A induces cell survival and chemoresistance by activation of Akt through a p53-dependent manner in ovarian cancer cells. Int J Cancer 2006; 119: 2304–2312.
- 11
Yuan ZQ, Feldman RI, Sussman GE, Coppola D, Nicosia SV, Cheng JQ . AKT2 inhibition of cisplatin-induced JNK/p38 and Bax activation by phosphorylation of ASK1: implication of AKT2 in chemoresistance. J Biol Chem 2003; 278: 23432–23440.
- 12
Yuan ZQ, Sun M, Feldman RI, Wang G, Ma X, Jiang C et al. Frequent activation of AKT2 and induction of apoptosis by inhibition of phosphoinositide-3-OH kinase/Akt pathway in human ovarian cancer. Oncogene 2000; 19: 2324–2330.
- 13
Zheng J, Mercado-Uribe I, Rosen DG, Chang B, Liu P, Yang G et al. Induction of papillary carcinoma in human ovarian surface epithelial cells using combined genetic elements and peritoneal microenvironment. Cell Cycle 2010; 9: 140–146.
- 14
Yue P, Zhang X, Paladino D, Sengupta B, Ahmad S, Holloway RW et al. Hyperactive EGF receptor, Jaks and Stat3 signaling promote enhanced colony-forming ability, motility and migration of cisplatin-resistant ovarian cancer cells. Oncogene 2012; 31: 2309–2322.
- 15
Flesken-Nikitin A, Choi KC, Eng JP, Shmidt EN, Nikitin AY . Induction of carcinogenesis by concurrent inactivation of p53 and Rb1 in the mouse ovarian surface epithelium. Cancer Res 2003; 63: 3459–3463.
- 16
Shan W, Liu J . Epithelial ovarian cancer: focus on genetics and animal models. Cell Cycle 2009; 8: 731–735.
- 17
Yang H, Kong W, He L, Zhao JJ, O’Donnell JD, Wang J et al. MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. Cancer Res 2008; 68: 425–433.
- 18
Johnson NC, Dan HC, Cheng JQ, Kruk PA . BRCA1 185delAG mutation inhibits Akt-dependent, IAP-mediated caspase 3 inactivation in human ovarian surface epithelial cells. Exp Cell Res 2004; 298: 9–16.
- 19
Yang F, Guo X, Yang G, Rosen DG, Liu J . AURKAand BRCA2 expression highly correlate with prognosis of endometrioid ovarian carcinoma. Mod Pathol 2011; 24: 836–845.
- 20
Yang G, Chang B, Yang F, Guo X, Cai KQ, Xiao XS et al. Aurora kinase A promotes ovarian tumorigenesis through dysregulation of the cell cycle and suppression of BRCA2. Clin Cancer Res 2010; 16: 3171–3181.
- 21
Zhou C, Huang P, Liu J . The carboxyl-terminal of BRCA1 is required for subnuclear assembly of RAD51 after treatment with cisplatin but not ionizing radiation in human breast and ovarian cancer cells. Biochem Biophys Res Commun 2005; 336: 952–960.
- 22
Zhou C, Liu J . Inhibition of human telomerase reverse transcriptase gene expression by BRCA1 in human ovarian cancer cells. Biochem Biophys Res Commun 2003; 303: 130–136.
- 23
Zhou C, Smith JL, Liu J . Role of BRCA1 in cellular resistance to paclitaxel and ionizing radiation in an ovarian cancer cell line carrying a defective BRCA1. Oncogene 2003; 22: 2396–2404.
- 24
Connolly DC, Bao R, Nikitin AY, Stephens KC, Poole TW, Hua X et al. Female mice chimeric for expression of the simian virus 40 TAg under control of the MISIIR promoter develop epithelial ovarian cancer. Cancer Res 2003; 63: 1389–1397.
- 25
van Vliet J, Turner J, Crossley M . Human Kruppel-like factor 8: a CACCC-box binding protein that associates with CtBP and represses transcription. Nucleic Acids Res 2000; 28: 1955–1962.
- 26
Wang X, Lu H, Urvalek AM, Li T, Yu L, Lamar J et al. KLF8 promotes human breast cancer cell invasion and metastasis by transcriptional activation of MMP9. Oncogene 2011; 30: 1901–1911.
- 27
Wei H, Wang X, Gan B, Urvalek AM, Melkoumian ZK, Guan JL et al. Sumoylation delimits KLF8 transcriptional activity associated with the cell cycle regulation. J Biol Chem 2006; 281: 16664–16671.
- 28
Zhao J, Bian ZC, Yee K, Chen BP, Chien S, Guan JL . Identification of transcription factor KLF8 as a downstream target of focal adhesion kinase in its regulation of cyclin D1 and cell cycle progression. Mol Cell 2003; 11: 1503–1515.
- 29
Zhang P, Basu P, Redmond LC, Morris PE, Rupon JW, Ginder GD et al. A functional screen for Kruppel-like factors that regulate the human gamma-globin gene through the CACCC promoter element. Blood Cells Mol Dis 2005; 35: 227–235.
- 30
Wang X, Zheng M, Liu G, Xia W, McKeown-Longo PJ, Hung MC et al. Kruppel-like factor 8 induces epithelial to mesenchymal transition and epithelial cell invasion. Cancer Res 2007; 67: 7184–7193.
- 31
Li JC, Yang XR, Sun HX, Xu Y, Zhou J, Qiu SJ et al. Up-regulation of Kruppel-like factor 8 promotes tumor invasion and indicates poor prognosis for hepatocellular carcinoma. Gastroenterology 2010; 139: 2146–2157.e12.
- 32
Urvalek AM, Lu H, Wang X, Li T, Yu L, Zhu J et al. Regulation of the oncoprotein KLF8 by a switch between acetylation and sumoylation. Am J Transl Res 2011; 3: 121–132.
- 33
Urvalek AM, Wang X, Lu H, Zhao J . KLF8 recruits the p300 and PCAF co-activators to its amino terminal activation domain to activate transcription. Cell Cycle 2010; 9: 601–611.
- 34
Wang X, Urvalek AM, Liu J, Zhao J . Activation of KLF8 transcription by focal adhesion kinase in human ovarian epithelial and cancer cells. J Biol Chem 2008; 283: 13934–13942.
- 35
Zhao J, Guan JL . Signal transduction by focal adhesion kinase in cancer. Cancer Metastasis Rev 2009; 28: 35–49.
- 36
Eaton SA, Funnell AP, Sue N, Nicholas H, Pearson RC, Crossley M . A network of Kruppel-like Factors (Klfs). Klf8 is repressed by Klf3 and activated by Klf1 in vivo. J Biol Chem 2008; 283: 26937–26947.
- 37
Lu H, Wang X, Li T, Urvalek AM, Yu L, Li J et al. Identification of poly (ADP-ribose) polymerase-1 (PARP-1) as a novel Kruppel-like factor 8-interacting and -regulating protein. J Biol Chem 2011; 286: 20335–20344.
- 38
Mehta TS, Lu H, Wang X, Urvalek AM, Nguyen KH, Monzur F et al. A unique sequence in the N-terminal regulatory region controls the nuclear localization of KLF8 by cooperating with the C-terminal zinc-fingers. Cell Res 2009; 19: 1098–1109.
- 39
Wang X, Zhao J . KLF8 transcription factor participates in oncogenic transformation. Oncogene 2007; 26: 456–461.
- 40
Fu WJ, Li JC, Wu XY, Yang ZB, Mo ZN, Huang JW et al. Small interference RNA targeting Kruppel-like factor 8 inhibits the renal carcinoma 786-0 cells growth in vitro and in vivo. J Cancer Res Clin Oncol 2010; 136: 1255–1265.
- 41
Liu L, Liu N, Xu M, Liu Y, Min J, Pang H et al. Lentivirus-delivered Kruppel-like factor 8 small interfering RNA inhibits gastric cancer cell growth in vitro and in vivo. Tumour Biol 2012; 33: 53–61.
- 42
Cox BD, Natarajan M, Stettner MR, Gladson CL . New concepts regarding focal adhesion kinase promotion of cell migration and proliferation. J Cell Biochem 2006; 99: 35–52.
- 43
Schnell O, Romagna A, Jaehnert I, Albrecht V, Eigenbrod S, Juerchott K et al. Kruppel-like factor 8 (KLF8) is expressed in gliomas of different WHO grades and is essential for tumor cell proliferation. PLoS One 2012; 7: e30429.
- 44
Wan W, Zhu J, Sun X, Tang W . Small interfering RNA targeting Kruppel-like factor 8 inhibits U251 glioblastoma cell growth by inducing apoptosis. Mol Med Report 2012; 5: 347–350.
- 45
Stegmeier F, Rape M, Draviam VM, Nalepa G, Sowa ME, Ang XL et al. Anaphase initiation is regulated by antagonistic ubiquitination and deubiquitination activities. Nature 2007; 446: 876–881.
- 46
Lahiri SK, Zhao J . Kruppel-like factor 8 emerges as an important regulator of cancer. Am J Transl Res 2012; 4: 357–363.
- 47
Evans PM, Liu C . Roles of Krupel-like factor 4 in normal homeostasis, cancer and stem cells. Acta Biochim Biophys Sin 2008; 40: 554–564.
- 48
Gumireddy K, Li A, Gimotty PA, Klein-Szanto AJ, Showe LC, Katsaros D et al. KLF17 is a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer. Nat Cell Biol 2009; 11: 1297–1304.
- 49
McConnell BB, Yang VW . Mammalian Kruppel-like factors in health and diseases. Physiol Rev 2010; 90: 1337–1381.
- 50
Suresh B, Ramakrishna S, Lee HJ, Choi JH, Kim JY, Ahn WS et al. K48- and K63-linked polyubiquitination of deubiquitinating enzyme USP44. Cell Biol Int. 2010; 34: 799–808.
- 51
Kang X, Sun L, Guo K, Shu H, Yao J, Qin X et al. Serum protein biomarkers screening in HCC patients with liver cirrhosis by ICAT-LC-MS/MS. J Cancer Res Clin Oncol 2010; 136: 1151–1159.
- 52
Zhang X, Yue P, Page BD, Li T, Zhao W, Namanja AT et al. Orally bioavailable small-molecule inhibitor of transcription factor Stat3 regresses human breast and lung cancer xenografts. Proc Natl Acad Sci USA 2012; 109: 9623–9628.
- 53
Yang T, Cai SY, Zhang J, Lu JH, Lin C, Zhai J et al. Kruppel-like factor 8 is a new wnt/beta-catenin signaling target gene and regulator in hepatocellular carcinoma. PLoS One 2012; 7: e39668.
- 54
Siegel PM, Shu W, Massague J . Mad upregulation and Id2 repression accompany transforming growth factor (TGF)-beta-mediated epithelial cell growth suppression. J Biol Chem 2003; 278: 35444–35450.
- 55
Sowa ME, Bennett EJ, Gygi SP, Harper JW . Defining the human deubiquitinating enzyme interaction landscape. Cell 2009; 138: 389–403.
Acknowledgements
We thank Dr Alexander Yu Nikitin of Cornell University for helping with the intrabursal implantation techniques. We also thank all the members of Zhao lab for critical discussions and helpful comments. This work was supported by grants from NCI (CA132977), Susan G. Komen for Cure Breast Cancer Foundation (KG090444 and KG080616) and American Cancer Society (RSG CCG-111381) to JZ.
Author information
Affiliations
Corresponding author
Ethics declarations
Competing interests
The authors declare no conflict of interest.
Additional information
Supplementary Information accompanies the paper on the Oncogene website
Supplementary information
Rights and permissions
About this article
Cite this article
Lu, H., Wang, X., Urvalek, A. et al. Transformation of human ovarian surface epithelial cells by Krüppel-like factor 8. Oncogene 33, 10–18 (2014). https://doi.org/10.1038/onc.2012.545
Received:
Revised:
Accepted:
Published:
Issue Date:
Keywords
- KLF8
- transformation
- human ovarian epithelial cells
- human ovarian cancer
Further reading
-
The role of Krüppel-like factor 8 in cancer biology: Current research and its clinical relevance
Biochemical Pharmacology (2021)
-
EMT Factors and Metabolic Pathways in Cancer
Frontiers in Oncology (2020)
-
KLF7: a new candidate biomarker and therapeutic target for high-grade serous ovarian cancer
Journal of Experimental & Clinical Cancer Research (2020)
-
LncRNA DANCR promotes the proliferation, migration, and invasion of tongue squamous cell carcinoma cells through miR-135a-5p/KLF8 axis
Cancer Cell International (2019)
-
Galectin-8 induces partial epithelial–mesenchymal transition with invasive tumorigenic capabilities involving a FAK/EGFR/proteasome pathway in Madin–Darby canine kidney cells
Molecular Biology of the Cell (2018)