Table 1 Optional primer sets for phylogenetic screening of single-cell MDA products.

From: Obtaining genomes from uncultivated environmental microorganisms using FACS–based single-cell genomics

Description Name Sequence (5′→3′) Refs.
Bacterial full length 27F-YM AGAGTTTGATYMTGGCTCAG 33,34
  1492R TACGGYTACCTTGTTACGACTT 35
Universal i-tag 515F GTGCCAGCMGCCGCGGTAA 36
(targeting V4 region) 806R GGACTACHVGGGTWTCTAAT 36
Universal pyrotag 926wF AAACTYAAAKGAATTGRCGG 37,38
(targeting V6-8 regions) 1392R ACGGGCGGTGTGTRC 39,40
Bacterial 27F AGRGTTYGATYMTGGCTCAG 41
  907R CCGTCAATTCMTTTRAGTTT 35,39
Archaeal Arc344F ACGGGGYGCAGCAGGCGCGA 42,43
  Arc915R GTGCTCCCCCGCCAATTCCT 44
Eukarya Euk528F CCGCGGTAATTCCAGCTC 45
  EukB GATCCTTCTGCAGGTTCACCTAC 46
  1. 'Universal' refers to primers targeting bacteria and archaea; for all nonuniversal primers the domain bacteria, archaea or eukarya is specified.