Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

An adapter ligation-mediated PCR method for high-throughput mapping of T-DNA inserts in the Arabidopsis genome

This article has been updated

Abstract

Agrobacterium transfer DNA (T-DNA) is an effective plant mutagen that has been used to create sequence-indexed T-DNA insertion lines in Arabidopsis thaliana as a tool to study gene function. Creating T-DNA insertion lines requires a dependable method for locating the site of insertion in the genome. In this protocol, we describe an adapter ligation-mediated PCR method that we have used to screen a mutant library and identify over 150,000 T-DNA insertional mutants; the method can also be applied to map individual mutants. The procedure consists of three steps: a restriction enzyme-mediated ligation of an adapter to the genomic DNA; a PCR amplification of the T-DNA/genomic DNA junction with primers specific to the adapter and T-DNA; and sequencing of the T-DNA/genomic junction to enable mapping to the reference genome. In most cases, the sequenced genomic region extends to the T-DNA border, enabling the exact location of the insert to be identified. The entire process takes 2 weeks to complete.

This is a preview of subscription content, access via your institution

Relevant articles

Open Access articles citing this article.

Access options

Buy article

Get time limited or full article access on ReadCube.

$32.00

All prices are NET prices.

Figure 1: Locating the T-DNA junction with adapter ligation-mediated PCR.
Figure 2: Photograph of seed spoon.

Change history

  • 13 December 2007

    In the version of this article initially published, the sequences for the three short strands listed in Table 1 (p. 2912) were incomplete. Each of the three should have started with “5'-Phosphate-” and ended with “-amino C7-3′ ”. The entry in the Comments section for each of the three sequences should have read: “5′ phosphorylated and 3′ C7 amino modification. HPLC purified". In the table footnote, “Blue text” and “Red text” should have been “Dotted underscore” and “Solid underscore” and the corresponding sequence segments in the table underscored appropriately. On the same page, a sentence was omitted from the third paragraph in the section “Adapter and primer design.” The third sentence should have been: "The short adapter has a 3′ C7 amino modification to prevent polymerase extension of the short adapter, as this would generate the latent primer-binding sites on all ligated molecules and not just those containing the T-DNA primer-binding site." Under “Reagents,” the entry for oligonucleotides should have included the name of the supplier, Operon. These errors have been corrected in the HTML and PDF versions of the article.

  • 25 March 2010

    In the version of this article initially published, the sequence shown in the top row (“Long strand of adapter 1”) of Table 1 was missing an adenosine at position 16. Instead of: GTAATACGACTCACTTAGGGCACGCGTGGTCGACGGCCCGGGCTGC, the sequence should have appeared as: GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGC. This error has been corrected in the HTML and PDF versions of the article.

References

  1. Chilton, M.D. et al. Stable incorporation of plasmid DNA into higher plant cells: the molecular basis of crown gall tumorigenesis. Cell 11, 263–271 (1977).

    CAS  Article  PubMed  Google Scholar 

  2. Clough, S.J. & Bent, A.F. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743 (1998).

    CAS  Article  PubMed  Google Scholar 

  3. Hiei, Y., Ohta, S., Komari, T. & Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6, 271–282 (1994).

    CAS  Article  PubMed  Google Scholar 

  4. Alonso, J.M. et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653–665 (2003).

    Article  PubMed  Google Scholar 

  5. Liu, Y. et al. Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 8, 457–463 (1995).

    CAS  Article  PubMed  Google Scholar 

  6. Sessions, A. et al. A High-throughput Arabidopsis reverse genetics system. Plant Cell 14, 2985–2994 (2002).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  7. Schröder, A. et al. HIV-1 integration in the human genome favors active genes and local hotspots. Cell 110, 521–529 (2002).

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

This work was funded by the National Science Foundation (award numbers 0115103 and 0420126). We thank Cesar Barragan, Mary Galli, Dr Ryan Lister and Dr Brian Gregory for critical reading of this manuscript.

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Joseph R Ecker.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

O'Malley, R., Alonso, J., Kim, C. et al. An adapter ligation-mediated PCR method for high-throughput mapping of T-DNA inserts in the Arabidopsis genome. Nat Protoc 2, 2910–2917 (2007). https://doi.org/10.1038/nprot.2007.425

Download citation

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nprot.2007.425

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing