Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Asynchronous combinatorial action of four regulatory factors activates Bcl11b for T cell commitment

Nature Immunology volume 17, pages 956–965 (2016)Cite this article

Subjects

Abstract

During T cell development, multipotent progenitors relinquish competence for other fates and commit to the T cell lineage by turning on Bcl11b, which encodes a transcription factor. To clarify lineage commitment mechanisms, we followed developing T cells at the single-cell level using Bcl11b knock-in fluorescent reporter mice. Notch signaling and Notch-activated transcription factors collaborate to activate Bcl11b expression irrespectively of Notch-dependent proliferation. These inputs work via three distinct, asynchronous mechanisms: an early locus 'poising' function dependent on TCF-1 and GATA-3, a stochastic-permissivity function dependent on Notch signaling, and a separate amplitude-control function dependent on Runx1, a factor already present in multipotent progenitors. Despite their necessity for Bcl11b expression, these inputs act in a stage-specific manner, providing a multitiered mechanism for developmental gene regulation.

This is a preview of subscription content, access via your institution

Relevant articles

Open Access articles citing this article.

Access options

Rent or buy this article

Prices vary by article type

from$1.95

to$39.95

Learn more

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Bcl11b expression turns on in developing T cell progenitors and stays on throughout development and maturation.
Figure 2: Bcl11b activation coincides with T cell commitment.
Figure 3: Notch and IL-7 have opposing, stage-specific roles during early T cell development.
Figure 4: Bcl11b activation is not coupled to Notch-dependent cell proliferation.
Figure 5: Notch signaling increases the probability of 'all-or-none' Bcl11b activation.
Figure 6: Notch signaling increases Bcl11b activation probability in a dose-dependent manner.
Figure 7: GATA-3 and TCF-1 control initial Bcl11b activation.
Figure 8: Runx1 controls Bcl11b expression amplitude.

Accession codes

Accessions

NCBI Reference Sequence

References

  1. Rothenberg, E.V. T cell lineage commitment: identity and renunciation. J. Immunol. 186, 6649–6655 (2011).

    Article  CAS  PubMed  Google Scholar 

  2. Yui, M.A. & Rothenberg, E.V. Developmental gene networks: a triathlon on the course to T cell identity. Nat. Rev. Immunol. 14, 529–545 (2014).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Avram, D. & Califano, D. The multifaceted roles of Bcl11b in thymic and peripheral T cells: impact on immune diseases. J. Immunol. 193, 2059–2065 (2014).

    Article  CAS  PubMed  Google Scholar 

  4. Ciofani, M. et al. A validated regulatory network for Th17 cell specification. Cell 151, 289–303 (2012).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Liu, P., Li, P. & Burke, S. Critical roles of Bcl11b in T-cell development and maintenance of T-cell identity. Immunol. Rev. 238, 138–149 (2010).

    Article  CAS  PubMed  Google Scholar 

  6. Li, L., Leid, M. & Rothenberg, E.V. An early T cell lineage commitment checkpoint dependent on the transcription factor Bcl11b. Science 329, 89–93 (2010).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Ikawa, T. et al. An essential developmental checkpoint for production of the T cell lineage. Science 329, 93–96 (2010).

    Article  CAS  PubMed  Google Scholar 

  8. Wakabayashi, Y. et al. Bcl11b is required for differentiation and survival of αβ T lymphocytes. Nat. Immunol. 4, 533–539 (2003).

    Article  CAS  PubMed  Google Scholar 

  9. Inoue, J. et al. Expression of TCRαβ partly rescues developmental arrest and apoptosis of αβ T cells in Bcl11b−/− mice. J. Immunol. 176, 5871–5879 (2006).

    Article  CAS  PubMed  Google Scholar 

  10. Li, P. et al. Reprogramming of T cells to natural killer–like cells upon Bcl11b deletion. Science 329, 85–89 (2010).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Yui, M.A., Feng, N. & Rothenberg, E.V. Fine-scale staging of T cell lineage commitment in adult mouse thymus. J. Immunol. 185, 284–293 (2010).

    Article  CAS  PubMed  Google Scholar 

  12. Naito, T., Tanaka, H., Naoe, Y. & Taniuchi, I. Transcriptional control of T-cell development. Int. Immunol. 23, 661–668 (2011).

    Article  CAS  PubMed  Google Scholar 

  13. Manesso, E., Chickarmane, V., Kueh, H.Y., Rothenberg, E.V. & Peterson, C. Computational modelling of T-cell formation kinetics: output regulated by initial proliferation-linked deferral of developmental competence. J. R. Soc. Interface 10, 20120774 (2013).

    Article  PubMed  PubMed Central  Google Scholar 

  14. Guo, Y., Maillard, I., Chakraborti, S., Rothenberg, E.V. & Speck, N.A. Core binding factors are necessary for natural killer cell development and cooperate with Notch signaling during T-cell specification. Blood 112, 480–492 (2008).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Weber, B.N. et al. A critical role for TCF-1 in T-lineage specification and differentiation. Nature 476, 63–68 (2011).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. García-Ojeda, M.E. et al. GATA-3 promotes T-cell specification by repressing B-cell potential in pro-T cells in mice. Blood 121, 1749–1759 (2013).

    Article  CAS  PubMed  Google Scholar 

  17. Scripture-Adams, D.D. et al. GATA-3 dose-dependent checkpoints in early T cell commitment. J. Immunol. 193, 3470–3491 (2014).

    Article  CAS  PubMed  Google Scholar 

  18. Franco, C.B. et al. Notch/Delta signaling constrains reengineering of pro-T cells by PU.1. Proc. Natl. Acad. Sci. USA 103, 11993–11998 (2006).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Germar, K. et al. T-cell factor 1 is a gatekeeper for T-cell specification in response to Notch signaling. Proc. Natl. Acad. Sci. USA 108, 20060–20065 (2011).

    Article  PubMed  PubMed Central  Google Scholar 

  20. Del Real, M.M. & Rothenberg, E.V. Architecture of a lymphomyeloid developmental switch controlled by PU.1, Notch and Gata3. Development 140, 1207–1219 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Panne, D. The enhanceosome. Curr. Opin. Struct. Biol. 18, 236–242 (2008).

    Article  CAS  PubMed  Google Scholar 

  22. Spitz, F. & Furlong, E.E. Transcription factors: from enhancer binding to developmental control. Nat. Rev. Genet. 13, 613–626 (2012).

    Article  CAS  PubMed  Google Scholar 

  23. Iwafuchi-Doi, M. & Zaret, K.S. Pioneer transcription factors in cell reprogramming. Genes Dev. 28, 2679–2692 (2014).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Zhang, D.X. & Glass, C.K. Towards an understanding of cell-specific functions of signal-dependent transcription factors. J. Mol. Endocrinol. 51, T37–T50 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Zhang, J.A., Mortazavi, A., Williams, B.A., Wold, B.J. & Rothenberg, E.V. Dynamic transformations of genome-wide epigenetic marking and transcriptional control establish T cell identity. Cell 149, 467–482 (2012).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Wang, H. et al. NOTCH1-RBPJ complexes drive target gene expression through dynamic interactions with superenhancers. Proc. Natl. Acad. Sci. USA 111, 705–710 (2014).

    Article  CAS  PubMed  Google Scholar 

  27. Yu, M. et al. Direct recruitment of polycomb repressive complex 1 to chromatin by core binding transcription factors. Mol. Cell 45, 330–343 (2012).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Li, L. et al. A far downstream enhancer for murine Bcl11b controls its T-cell specific expression. Blood 122, 902–911 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Tydell, C.C. et al. Molecular dissection of prethymic progenitor entry into the T lymphocyte developmental pathway. J. Immunol. 179, 421–438 (2007).

    Article  CAS  PubMed  Google Scholar 

  30. Mingueneau, M. et al. Immunological Genome Consortium. The transcriptional landscape of αβ T cell differentiation. Nat. Immunol. 14, 619–632 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Schmitt, T.M. & Zúñiga-Pflücker, J.C. Induction of T cell development from hematopoietic progenitor cells by Delta-like-1 in vitro. Immunity 17, 749–756 (2002).

    Article  CAS  PubMed  Google Scholar 

  32. De Obaldia, M.E. & Bhandoola, A. Transcriptional regulation of innate and adaptive lymphocyte lineages. Annu. Rev. Immunol. 33, 607–642 (2015).

    Article  CAS  PubMed  Google Scholar 

  33. Weng, A.P. et al. c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev. 20, 2096–2109 (2006).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Kueh, H.Y., Champhekar, A., Nutt, S.L., Elowitz, M.B. & Rothenberg, E.V. Positive feedback between PU.1 and the cell cycle controls myeloid differentiation. Science 341, 670–673 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Varnum-Finney, B. et al. Immobilization of Notch ligand, Delta-1, is required for induction of Notch signaling. J. Cell Sci. 113, 4313–4318 (2000).

    CAS  PubMed  Google Scholar 

  36. Schmitt, T.M., Ciofani, M., Petrie, H.T. & Zúñiga-Pflücker, J.C. Maintenance of T cell specification and differentiation requires recurrent notch receptor-ligand interactions. J. Exp. Med. 200, 469–479 (2004).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Taghon, T.N., David, E.S., Zúñiga-Pflücker, J.C. & Rothenberg, E.V. Delayed, asynchronous, and reversible T-lineage specification induced by Notch/Delta signaling. Genes Dev. 19, 965–978 (2005).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Hosokawa, H. et al. Gata3/Ruvbl2 complex regulates T helper 2 cell proliferation via repression of Cdkn2c expression. Proc. Natl. Acad. Sci. USA 110, 18626–18631 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Yu, S. et al. The TCF-1 and LEF-1 transcription factors have cooperative and opposing roles in T cell development and malignancy. Immunity 37, 813–826 (2012).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Kawazu, M. et al. Functional domains of Runx1 are differentially required for CD4 repression, TCRβ expression, and CD4/8 double-negative to CD4/8 double-positive transition in thymocyte development. J. Immunol. 174, 3526–3533 (2005).

    Article  CAS  PubMed  Google Scholar 

  41. Zarnegar, M.A., Chen, J. & Rothenberg, E.V. Cell-type-specific activation and repression of PU.1 by a complex of discrete, functionally specialized cis-regulatory elements. Mol. Cell. Biol. 30, 4922–4939 (2010).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Peter, I.S. & Davidson, E.H. Genomic Control Process: Development and Evolution (Academic Press, 2015).

  43. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676 (2006).

    Article  CAS  PubMed  Google Scholar 

  44. Ebina, W. & Rossi, D.J. Transcription factor-mediated reprogramming toward hematopoietic stem cells. EMBO J. 34, 694–709 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Lin, Y.C. et al. Global changes in the nuclear positioning of genes and intra- and interdomain genomic interactions that orchestrate B cell fate. Nat. Immunol. 12, 1196–1204 (2012).

    Article  CAS  Google Scholar 

  46. Liu, P., Jenkins, N.A. & Copeland, N.G. A highly efficient recombineering-based method for generating conditional knockout mutations. Genome Res. 13, 476–484 (2003).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Hernández-Hoyos, G., Anderson, M.K., Wang, C., Rothenberg, E.V. & Alberola-Ila, J. GATA-3 expression is controlled by TCR signals and regulates CD4/CD8 differentiation. Immunity 19, 83–94 (2003).

    Article  PubMed  Google Scholar 

  48. Telfer, J.C., Hedblom, E.E., Anderson, M.K., Laurent, M.N. & Rothenberg, E.V. Localization of the domains in Runx transcription factors required for the repression of CD4 in thymocytes. J. Immunol. 172, 4359–4370 (2004).

    Article  CAS  PubMed  Google Scholar 

  49. Champhekar, A. et al. Regulation of early T-lineage gene expression and developmental progression by the progenitor cell transcription factor PU.1. Genes Dev. 29, 832–848 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Nakano, T., Kodama, H. & Honjo, T. Generation of lymphohematopoietic cells from embryonic stem cells in culture. Science 265, 1098–1101 (1994).

    Article  CAS  PubMed  Google Scholar 

  51. Schroeder, T. Long-term single-cell imaging of mammalian stem cells. Nat. Methods 8 (suppl.), S30–S35 (2011).

    Article  CAS  PubMed  Google Scholar 

  52. Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7, 562–578 (2012).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We thank M. Lerica Gutierrez Quiloan for assistance with mouse genotyping and maintenance; N. Verduzco and I. Soto for animal husbandry; J. Longmate for help with statistical analysis of alternate-lineage-potential experiments; R.A. Diamond, K. Beadle, J. Grimm, D. Perez and J. Verceles for cell sorting; N. Feng for initial flow cytometric analysis; J. Hahn for advice on BAC recombineering; S. Qin for assistance with qPCR experiments; X.Wang for performing pilot studies with microwell arrays; and J. Ungerbäck for assistance with visualizing genome track data. We also thank A. Bhandoola, L. Xu and W. Pear (University of Pennsylvania); J. Telfer (University of Massachusetts) and N. Masuyama (University of Tokyo) for constructs. This work was funded by a CRI/Irvington Postdoctoral Fellowship and a US National Institutes of Health (NIH) K99/R00 Award (K99HL119638A) to H.Y.K.; a California Institute for Regenerative Medicine Bridges to Stem-Cell Research award to K.K.H.N. (TB1-01176); NIH grants to E.V.R. (R01 AI083514, R01 AI095943, RC2 CA148278, R33 HL089123, R01 CA90233 and R01 HL119102) and M.A.Y. (R01 AI064590); NIH/HHS grant U01HL100395 (I.D.B.); the Albert Billings Ruddock Professorship to E.V.R.; and the Al Sherman Foundation and the Louis A. Garfinkle Memorial Laboratory Fund to E.V.R.'s lab.

Author information

Author notes

  1. Hao Yuan Kueh, Jingli A Zhang, Sagar S Damle & George Freedman

    Present address: Present addresses: Department of Bioengineering, University of Washington, Seattle, Washington, USA (H.Y.K.), Genentech, South San Francisco, California, USA (J.A.Z.), Department of Bioinformatics, Antisense Drug Discovery, Isis Pharmaceuticals, Carlsbad, California, USA (S.S.D.), and Department of Pediatrics, University of California, San Francisco School of Medicine, San Francisco, California, USA (G.F.).,

Authors and Affiliations

  1. Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, California, USA

    Hao Yuan Kueh, Mary A Yui, Kenneth K H Ng, Shirley S Pease, Jingli A Zhang, Sagar S Damle, George Freedman, Sharmayne Siu, Michael B Elowitz & Ellen V Rothenberg

  2. Clinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, Washington, USA

    Irwin D Bernstein

  3. Howard Hughes Medical Institute, California Institute of Technology, Pasadena, California, USA

    Michael B Elowitz

Authors
  1. Hao Yuan Kueh
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Mary A Yui
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Kenneth K H Ng
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Shirley S Pease
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jingli A Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Sagar S Damle
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. George Freedman
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Sharmayne Siu
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Irwin D Bernstein
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Michael B Elowitz
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Ellen V Rothenberg
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

H.Y.K. designed research, performed experiments, analyzed data and wrote the paper. M.A.Y. designed research, performed experiments, analyzed data and wrote the paper. K.K.H.N., and S.S.P. performed experiments. S.S.D., G.F. and I.D.B. provided reagents. J.A.Z. performed experiments and analyzed data. S.S. analyzed data. M.B.E. designed research. E.V.R. designed research, analyzed data and wrote the paper.

Corresponding authors

Correspondence to Hao Yuan Kueh or Ellen V Rothenberg.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Integrated supplementary information

Supplementary Figure 1 Binding profiles of key transcription factors to the Bcl11b gene and enhancer.

A)-C) UCSC genome browser tracks (mm9 coordinates) showing published ChIP-Seq binding data of the following transcription factors to the Bcl11b gene: Notch11, CSL1, Gata32, PU.12, TCF-13, Runx14 (both WT and Runx1-/- control) and Ikaros5. The H3K4me2 histone mark is also included2. The primary cell types on which ChIP-Seq was performed are also indicated. A) Global view of Bcl11b locus, showing gene body in relation to distal enhancer and downstream gene desert. Shaded yellow bars indicate gene and enhancer locations. B) Bcl11b gene body, and C) Bcl11b enhancer domain. Gray shaded bars indicate regions containing clusters of transcription factor binding sites and H3K4me marks. Asterisk indicates binding sites tested in enhancer transfection assays6. Note that a high resolution version of this figure is also provided separately.

Supplementary Figure 2 Generation and validation of Bcl11b-YFP knock-in reporter.

A) Schematic showing targeted insertion of fluorescent protein reporter into 3’-untranslated region (UTR) of Bcl11b locus (top), along with excision of the loxP-flanked PGK-neomycin cassette using Cre recombinase. Cut sites for restriction enzymes PacI, CspCI, used for Southern Blot validation of targeted insertion in B) are shown. Diagram is not drawn to scale. B) Correct insertion of fluorescent protein cassette was validated by Southern Blot analysis on the targeted ES cell clone (left), which was later used for knock-in mouse generation. Bacterial Artificial Chromosomes (BAC) containing either the wildtype Bcl11b locus (center), or a Bcl11bYFP (+neo) locus (right) were used as controls.

Supplementary Figure 3 Bcl11b-YFP levels are not affected by presence of the neomycin drug resistance cassette.

Flow cytometry analysis of Bcl11bYFP/+ mice either with or without the neomycin drug selection cassette [Bcl11b‑YFP(+neo), Bcl11b-YFP(-neo)], together with non-fluorescent controls (B6), using cells from the whole thymus (A), DN thymus (B), or the spleen (C). Bcl11b-YFP reporter expression is identical with or without the drug resistance cassette. ISP – immature single positive, DP – double positive.

Supplementary Figure 4 Experimental and analysis workflow for time-lapse imaging of Bcl11b-YFP levels in progenitor cells.

A) Experimental setup, microscope configuration and illumination settings used for timelapse image acquisition. To confine cells to a single imaging field-of-view, progenitors were seeded into hollow PDMS microwells (Microsurfaces; Flemington, Australia) adhered to a glass-bottomed 24 well dish (Mattek; Ashland, MA). B) Workflow for image analysis showing (I) raw differential interference contrast (DIC), mCherry and YFP images; (II) representative images overlaid with automatically segmented cell boundaries; and (III) heat maps showing cytometric analysis of segmented cells, showing OFF and ON populations.

Supplementary Figure 5 Notch signaling promotes all-or-none Bcl11b activation in a dose-dependent manner.

Flow cytometry analysis of bone marrow derived Bcl11b-YFP- DN2 cells cultured under the indicated conditions with 5 ng/mL IL-7 and Flt3L for four days. CD25 versus Bcl11b-YFP levels (top), and histograms of Bcl11b-YFP and CellTrace Violet levels (bottom) are shown. Initial levels (Day 0) are shown as gray dotted lines. GSI: γ-secretase inhibitor (Calbiochem/EMD Millipore, Billerica, MA), a small molecule inhibitor of Notch signaling.

Supplementary Figure 6 shTcf7 constructs reduce Tcf7 transcript levels in ETP and DN2 cells.

Quantitative real time (RT)-PCR analysis of Tcf7 transcript levels in DN progenitors from E14.5 fetal livers infected with the indicated shRNA constructs for 2 days and sorted. RNA was extracted and processed as previously described7. Forward and reverse primers used for Tcf7 detection are CAAGGCAGAGAAGGAGGCTAAG and GGCAGCGCTCTCCTTGAG respectively, as previously described8.

Supplementary Figure 7 Effects of TCF-1 perturbation on Bcl11b activation in pro-T cells.

A) Flow cytometry analysis of bone marrow DN progenitors transduced with either shRNA to Tcf7 (shTcf7) or a non-targeting control (shRandom), then cultured on plates coated with 6 μg/mL DL1 with 5 ng/mL SCF, IL-7 and Flt3L for four days. Levels of the dendritic cell marker CD11c against FSC (top), as well as CD25 levels versus Bcl11b-YFP levels (middle) or Bcl11b-YFP level distributions (bottom) for CD11c- populations are shown. Knockdown of Tcf7 promotes DC trans-differentiation in DN2 cells, but does not impede Bcl11b activation. B) Flow cytometry analysis of Bcl11b-YFP expression levels in bone marrow DN progenitors transduced with a control or VEX-GFP retroviral construct for over-expression of TCF-1 (encoded by Tcf7), and cultured on OP9- or OP9-DL1 monolayers in 5 ng/mL IL-7 and Flt3L for three days. TCF-1 over-expression does not affect Bcl11b activation from either ETP or DN2 progenitors.

Supplementary Figure 8 Runx1, but not TCF-1 or GATA-3, controls Bcl11b expression amplitude in mature T cells.

A) Published transcriptomic data on Bcl11b expression in wildtype or Tcf7-/- DN3 thymocytes9 (left), or in wildtype or Gata3-/- Th2 cells10 (right). Levels of Bcl11b expression are similar in the absence or presence of either factor. B) Flow cytometry analysis of CD4 and CD8 splenic T-cells activated with anti-TCRb and anti-CD28 for 1 day, transduced with shRNA constructs, and cultured for 3 days. Plots show CD8 versus CD3 for cells transduced with retrovirus (top), along with Bcl11b level distributions for gated non-CD8 T-cell populations (bottom). Corresponding data for CD8 T-cells are shown in Fig. 8. Solid black lines indicate cells transduced with random shRNA, and dotted lines indicate background levels from non-fluorescent T-cells. Data from (A) represent mean and S.D. of two independent experiments.

Supplementary information

Supplementary Text and Figures

Supplementary Figures 1–8 and Supplementary Tables 3 and 4 (PDF 2633 kb)

Supplementary Table 1

Transcript levels for genes differentially expressed in Bcl11b-YFP– versus Bcl11b-YFP+ cells (XLSX 49 kb)

Supplementary Table 2

Transcript levels for transcriptional regulators expressed in developing T cells (XLSX 243 kb)

Source data

Rights and permissions

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Kueh, H., Yui, M., Ng, K. et al. Asynchronous combinatorial action of four regulatory factors activates Bcl11b for T cell commitment. Nat Immunol 17, 956–965 (2016). https://doi.org/10.1038/ni.3514

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/ni.3514

This article is cited by

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing