Abstract
Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease.
Similar content being viewed by others
Introduction
Mutations of mitochondrial DNA (mtDNA) are an important cause of human disease and are heavily implicated in the ageing process, consistent with the essential role for mtDNA in maintaining oxidative phosphorylation. MtDNA is fully coated with the mitochondrial transcription factor A (TFAM) protein and compacted into nucleoids1,2, which must be at least partly unpackaged to allow mtDNA replication3. The metazoan mtDNA is replicated by DNA polymerase gamma (POLγ)4, which belongs to the family A DNA polymerases, as does DNA polymerase I of Escherichia coli5. It consists of the catalytic (POLγA) and the accessory subunits (POLγB), which interact to form a heterodimer in insects6 and a heterotrimer in mammals7. A minimal mammalian mtDNA replisome, consisting of POLγ, TWINKLE DNA helicase and mitochondrial single-stranded DNA-binding protein (mtSSB), can synthesize DNA strands longer than 15 kb in length, thus showing that a single initiation event is sufficient to replicate one strand of mtDNA8. Mouse knockouts (KOs) for POLγA9, POLγB10 and TWINKLE11 have shown that all are essential for mtDNA maintenance and embryo survival.
The mode of mammalian mtDNA replication is debated and observations of replication intermediates by electron microscopy or two-dimensional (2D) neutral–neutral agarose gel electrophoresis have been interpreted to support either a strand-asynchronous or a strand-synchronous model12. The strand-asynchronous model proposes that leading (heavy (H)) strand replication initiates at a defined origin of replication (OH) in the control region. Once initiated the leading strand replication continues two-thirds around the circular genome until the origin of lagging (light (L)) strand replication (OL) is activated and lagging strand replication ensues13. Transcription by the mitochondrial RNA polymerase (POLRMT) at the light strand promoter provides the RNA primers necessary for initiation of replication at OH and POLRMT is also responsible for providing RNA primers for initiation of replication at OL14,15. Consistently, KO mice lacking POLRMT develop severe mtDNA depletion causing embryonic lethality16. The importance of light strand promoter, OH and OL is further underscored by the finding that replication-competent mtDNAs, which harbour large deletions in some forms of human mitochondrial disease, always retain these sequences17,18. In addition, an in vivo saturation mutagenesis approach in the mouse has shown that OL is indispensable for mtDNA maintenance14. Further support for the strand asymmetric model was recently presented in a study showing that mtSSB binds single-stranded mtDNA in a pattern consistent with initiation of replication at OH and OL19.
The occurrence of mtDNA mutations has traditionally been attributed to damage20, but several lines of evidence suggest that replication errors may in fact be the main source of mtDNA mutations in mammals21,22,23 and flies24. Consistently, mutations in the POLγA, POLγB and PEO1 (TWINKLE) genes are important causes of human disease25. More than 150 different pathogenic mutations have been reported in the POLγA gene and the majority of these causes either a severe depletion of mtDNA or the formation of large deletions. Such deletions can accumulate to high levels because mtDNA is replicated throughout the cell cycle in dividing cells and also undergoes replication in post-mitotic cells26. Similarly, point mutations of mtDNA can accumulate over time to high levels and affect respiratory chain function and cell viability27.
The mtDNA is strictly maternally inherited in mammals and transmitted without any apparent germline recombination28. This asexual mode of transmission is predicted to lead to accumulation of deleterious mutations over time29. Characterization of mtDNA sequence variation in animal models21,30,31,32, human populations33 and wild animals34 shows clear evidence of purifying selection. There is likely more than one mechanism that prevents the accumulation of mtDNA mutations between generations29. First, the bottleneck mechanism in the maternal mammalian germline can shift the mtDNA genotype in just a few generations and can thereby remove mutations from maternal lineages35,36,37,38,39. Second, there is very strong purifying selection against mutations that cause amino acid substitutions in mtDNA-encoded proteins32,40. Third, there is a selection against high levels of pathogenic mutations in transfer RNA genes post fertilization30. Fourth, females with high levels of mtDNA mutations in the germline have reduced fecundity41, which will decrease the risk of transmission of mtDNA mutations.
Given the substantial impact that mtDNA mutations have on human disease and ageing27, there is a strong interest in developing animal models that have increased or decreased levels of mtDNA mutations. The mtDNA mutator mice are homozygous for a knock-in mutation that leads to the expression of POLγA with a severely impaired proofreading during mtDNA replication. These mice develop a premature ageing syndrome and have a shortened life span42,43. Furthermore, mouse strains containing only a subset of all different mtDNA mutations present in mtDNA mutator mice can be derived by breeding and are valuable tools to study mtDNA transmission in the germline21,30,41. While mutator variants with decreased accuracy have been generated for many different DNA polymerases, only a handful of alterations are known to make DNA polymerases more accurate. High-fidelity DNA polymerases have been studied in unicellular organisms, for example, DNA polymerase I in E. coli44 and MIP1 (homolog of POLγA) in Saccharomyces cerevisiae45, but not yet in metazoans. A critical question concerning the role for mtDNA mutations in ageing is to determine whether a decreased mtDNA mutation rate would prolong life span. It is still elusive whether it is possible to engineer enzymes surpassing the accuracy of wild-type (WT) metazoan POLγA in vivo. To address this issue, we performed a detailed biochemical characterization of exonuclease-deficient (exo−, low fidelity) and polymerase-deficient (pol−, high fidelity) variants of human POLγA (HsPOLγA) in vitro and created genomically engineered fruit flies expressing the corresponding alleles of fruit fly POLγA (DmPOLγA). Homozygous expression of an exo−DmPOLγA variant in flies leads to accumulation of point mutations and linear deletions of mtDNA, whereas the high-fidelity variants cause mtDNA depletion, which in both situations result in larval lethality. Unexpectedly, exo− and pol− versions of POLγA complemented each other in trans, resulting in apparently normal compound heterozygous flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirmed that mtDNA replication is a highly dynamic process where HsPOLγA goes on and off the template to allow complementation during proofreading and elongation.
Results
HsPOLγA pol− mutants have increased exonuclease activity
Two amino acid substitutions (Q849A and H881A) in E. coli DNA polymerase I are known to cause an antimutator effect during DNA replication44. As both of these amino acids are highly conserved in family A polymerases and thus present in both DmPOLγA (Q1009A and H1038A) and HsPOLγA (Q1102A and H1134A; Supplementary Fig. 1), we engineered recombinant DmPOLγA and HsPOLγA proteins and tested their effects on DNA replication in vitro. In addition, we chose to introduce a mutation affecting the exonuclease domain of POLγA (DmD263A, HsD274A) because such a substitution has previously been shown to exert a mtDNA mutator phenotype in budding yeast46 and mice42,43.
Human recombinant HsPOLγA proteins were purified to near homogeneity after expression in insect cells to obtain WT, D274A, Q1102A and H1134A variants (Supplementary Fig. 2a). Unfortunately, despite several attempts we were not able to purify stable and enzymatically active recombinant DmPOLγA. Therefore all of the in vitro experiments were performed using the recombinant human proteins. We first tested the ability of these recombinant HsPOLγA proteins to bind DNA in the presence of the processivity factor HsPOLγB by using a primer-template and standard electrophoretic mobility shift assay (EMSA) (Supplementary Fig. 2b). All HsPOLγA mutants bound DNA and interacted with HsPOLγB in a manner indistinguishable from the WT enzyme (Supplementary Fig. 2b). We also determined the Kd for DNA binding for all of the HsPOLγ mutants and found values that were very similar to the Kd for the WT enzyme (Fig. 1a and Table 1).
The WT HsPOLγA has an exonuclease activity and will engage in 3′ to 5′ degradation of DNA in the absence of deoxynucleotide (dNTP)s (Fig. 1b, lane 1), whereas it exerts polymerase activity in the presence of dNTPs (Fig. 1b, lanes 2–5). The recombinant D274A protein displayed severely reduced exonuclease activity (Fig. 1b, lane 6), while maintaining polymerase activity (Fig. 1b, lane 7–10). In contrast, the Q1102A and H1134A variants had more pronounced exonuclease activities (Fig. 1b, lanes 11 and 16) compared with the WT protein (Fig. 1b, lane 1), indicating increased fidelity44. While the Q1102A variant retained a polymerase activity (Fig. 1b, lanes 12–15) similar to the WT enzyme on a short template (Fig. 1b, lanes 2–5), the H1134A mutant protein required higher dNTP concentrations to synthesize DNA (Fig. 1b, lanes 17–20). We additionally tested whether any of the HsPOLγA mutant variants were capable of synthesizing long stretches of DNA using a circular ssDNA template. The D274A variant fully replicated circular ssDNA with a similar efficiency as the WT polymerase (Fig. 1c). The Q1102A variant was also able to synthesize a full-length product, albeit at a slower rate (Fig. 1c lanes 11–15), whereas the H1134A variant was unable to replicate DNA under these assay conditions (Fig. 1c, lanes 16–20). The low polymerase activity of the two pol− variants was also verified in a processivity assay and the defect was again more severe for the H1134A mutant than for the Q1102A mutant (Supplementary Fig. 2c). In competition assays, we found that the H1134A mutant had some dominant negative effects (Supplementary Fig. 2d). We also tested whether the HsPOLγA variants could initiate DNA replication in vitro by performing rolling circle replication assays (Fig. 1d)15. Both WT and D274A enzymes generated DNA products of ∼20 kb in the presence of the mitochondrial replicative helicase TWINKLE, although D274A was a bit less efficient (Fig. 1e). In contrast, the pol− mutations Q1102A and H1134A failed to synthesize long DNA products (Fig. 1e). The in vitro DNA replication results thus show that the D274A variant of HsPOLγA has reduced exonuclease and high polymerase activities, whereas the Q1102A and H1134A variants have increased exonuclease and reduced polymerase activities.
DmPOLγA (tamas) KO flies show developmental lethality
We next proceeded to generate a founder line to allow subsequent introduction of mutant alleles into the endogenous tamas locus by using genomic engineering. This strategy ensures that the expression of the mutant DmPOLγA variants is regulated in a physiological way, which is important because previous studies have shown that forced expression of DmPOLγA in flies results in mtDNA depletion and lethality likely caused by an imbalance in the levels of DmPOLγA and DmPOLγB47. To this end, we first generated DmPOLγA KO flies by replacing the tamas gene with a short attP site after 'ends-out' homologous recombination (Supplementary Fig. 3a)48. Precise excision of the tamas gene and insertion of the attP site was verified by PCR and sequencing (Fig. 2a and Supplementary Fig. 3b). The tamas KO larvae contained no detectable tamas mRNA whereas the mRNA expression from neighboring genes was normal (Fig. 2b). The KO of tamas was thus efficient and the presence of the attP sequence does not disturb the expression of the adjacent genes. Heterozygous DmPOLγA KO flies (KO/+) developed normally to adulthood, whereas intercrosses produced no homozygous KO (KO/KO) flies, thus showing that DmPOLγA is essential for fly survival. To show that the lethality phenotype is caused by loss of tamas, we performed genetic complementation tests between tamas KO mutants and deficiency lines that cover the locus (Supplementary Fig. 3d and Supplementary Table 1). The deficiencies that cover the tamas locus could not rescue the phenotype, whereas a deficiency adjacent to the tamas locus fully rescued the tamas KO mutant (Supplementary Table 1). The different deficiencies could not complement each other (Supplementary Table 1). The homozygous tamas KO larvae (KO/KO) died at the third instar (L3) stage (Fig. 2c) with a severe reduction in body weight (Supplementary Fig. 3c) and a 70% decrease in mtDNA levels (Fig. 2d). The residual mtDNA levels in the tamas KO/KO larvae are most likely explained by maternal contribution of both mtDNA and DmPOLγA to the embryo, which allows the homozygous KOs to develop until the L3 stage. A similar maternal contribution is well-documented in mammals, where mouse embryos with severe mtDNA replication defects survive until after implantation9,11,49, and in Caenorhabditis elegans, where loss of POLγ leads to apparently normal development albeit with severely reduced gonadal function50.
Homozygous DmPOLγA exo− and pol− flies arrest in development
POLγA is highly conserved (Supplementary Fig. 1) and the human and fly orthologues have 56.1% amino acid identity (http://mobyle.pasteur.fr). The residues D274, Q1102 and H1134 of HsPOLγA correspond to residues D263, Q1009 and H1038 of DmPOLγA, respectively (Supplementary Fig. 1). We utilized site-specific integration and the attP site48 to introduce mutant alleles into the tamas locus (Supplementary Fig. 3a) and generated flies expressing the D263A, Q1009A or H1038A variants of DmPOLγA (Supplementary Fig. 4a–d). For simplicity, we hereafter refer to the corresponding alleles as the D263A, Q1009A and H1038A alleles, respectively. As a control, we also introduced WT DmPOLγA to rescue the KO allele. Correct re-integration of the introduced tamas alleles was confirmed by Southern blot and PCR analyses (Fig. 3a, Supplementary Fig. 4a). Reintroduction of WT DmPOLγA (rescue allele) resulted in apparently normal homozygous flies, which demonstrate that the lethality of tamas KO flies is caused by the absence of DmPOLγA (Fig. 3b). In addition, the rescue allele had no or very mild impact on the expression of neighbouring genes in 5-day-old rescue larvae (L3 stage), thus excluding positional effects in the targeted region (Supplementary Fig. 4c). Larvae homozygous for the D263A, Q1009A or H1038A alleles died mostly at the late L3 stage (Supplementary Fig. 4d and Supplementary Table 2) although some D263A larvae entered the pupal stage and died shortly thereafter (Supplementary Table 4). Body size and weight of homozygous rescue or D263A larvae were comparable to WT larvae, while H1038A and Q1009A mutants were significantly smaller (Fig. 3c and Supplementary Fig. 4d). Furthermore, excision of the mini-white marker (Supplementary Fig. 4b) did not affect the survival or visible phenotypes of the genomically engineered flies, which shows that the observed phenotypes are a direct consequence of the introduced mutant variants of DmPOLγA.
The oxygen consumption rates in permeabilized tissues were normal in 5-day-old homozygous rescue larvae (Fig. 3d). The homozygous D263A larvae did not display any detectable changes in state 3 or state 4 respiration (Fig. 3d), whereas the homozygous Q1009A or H1038A larvae showed a profound reduction in both state 3 and uncoupled respiration (Fig. 3d).
The rescue, D263A, Q1009A and H1038A alleles were crossed over the deficiencies described above as well as over the tam3 and tam4 hypomorphic POLγA alleles51. We only obtained complementation with the rescue allele and it complemented all of the deficiencies covering the tamas locus, as well as the tam3 and tam4 hypomorphic alleles (Supplementary Table 3). Developmental assays were performed with the exo− and pol− tamas alleles crossed over the tamas KO allele to detect any possible antimorphic effects (Supplementary Table 4). The results were strongly dependent on whether the mutant allele was transmitted maternally or paternally, and we therefore performed the crosses in both directions. In all studied combinations, the homozygous tamas KO allele had the most severe developmental lethality phenotype (Supplementary Table 4). The homozygous D263A exo− flies died in the early pupal stage, whereas hemizygous flies with paternal (KO/D263A) or maternal (D263A/KO) transmission of the D263A allele generated sick escapers that reached the adult stage. The homozygous pol− flies died before pupariation, whereas the hemizygous pol− flies with a paternally transmitted mutant allele (KO/H1038A and KO/Q1009A) reached the pupal stage. The larval body weight (Supplementary Fig. 5a) and the mtDNA levels (Supplementary Fig. 5b) correlated with the developmental phenotype. However, the H1038A allele showed a different pattern as these larvae had the same low body mass as the KO larvae, but less mtDNA than KO larvae (Supplementary Fig. 5a,b). The H1038A mutant thus had some dominant negative effects, which is consistent with the in vitro biochemistry results of the corresponding HsPOLγA mutant (H1134A; Supplementary Fig. 2d).
DmPOLγ exo− mainly introduces transition mutations of mtDNA
We performed extensive cloning and sequencing to quantify the mtDNA mutation loads in the three mutated fly lines, as well as in the rescue line. The mtDNA mutation levels were low in WT flies (∼10−5 mutations per bp), consistent with a previous report24. In contrast, the heterozygous D263A mutant flies had significantly increased mtDNA mutation levels with on an average 7 × 10−5 mutations per bp (Fig. 4). In 5-day-old larvae homozygous for the D263A mutant allele (mtDNA mutator larvae), a further increase of the mtDNA mutation load (∼2 × 10−4 mutations per bp) was observed (Fig. 4). The heterozygous D263A mutant flies carried more transition mutations (purine>purine or pyrimidine>pyrimidine) than transversions (purine>pyrimidine or pyrimidine>purine), and all possible transitions occurred at an equal frequency (Table 2). In contrast, the T>A transversions (relative to the reference sequence) were much more frequent than the sum of all other transversion mutations (Table 2). Heterozygous flies carrying the Q1009A or H1038A high-fidelity alleles had mtDNA point mutation loads similar to the controls (Fig. 4).
Linear mtDNA deletions in homozygous DmPOLγA exo− larvae
We performed quantitative PCR (qPCR) and Southern blot analyses of larvae heterozygous for the D263A, Q1009A and H1038A alleles and found no significant changes in mtDNA steady-state levels in comparison with WT larvae (Fig. 5a). Larvae homozygous for the D263A allele displayed a mild reduction in mtDNA levels (Fig. 5a), whereas larvae homozygous for the Q1009A and H1038A alleles showed severe mtDNA depletion (Fig. 5a), which is consistent with the in vitro biochemistry results (Fig. 1, Supplementary Fig. 2c,d).
Interestingly, Southern blot analysis revealed the presence of high levels of two species of linear mtDNA molecules with deletions in larvae homozygous for the D263A allele (Fig. 5b,c). These aberrant molecules were not observed in the heterozygous D263A larvae (Supplementary Fig. 6a). Detailed mapping of the linear mtDNAs with deletions revealed two species that differed by ∼1 kb in size (Fig. 5c). The ends of the linear mtDNAs with deletions reach the A+T-rich control region, which have been suggested to contain both the OH and OL for fly mtDNA (Fig. 5b)52. The linear mtDNA with deletions already appears in the second instar stage (3 days after egg laying (AEL)), and their levels reach ∼40% of total mtDNA at 5 days AEL (Fig. 5d, Supplementary Fig. 6b), meaning that the homozygous D263A mutant larvae have a deficiency of full-length mtDNA (Fig. 5d). Southern blot analysis of the polymerase domain mutants, Q1009A and H1038A revealed no deletions (Supplementary Fig. 6c), demonstrating that the exonuclease-deficient DmPOLγA is directly involved in generating the linear mtDNA deletions.
To determine whether the homozygous D263A larvae are dying because of depletion of full-length mtDNA molecules, we determined the amount of mtDNA needed to enter and go through the pupariation stage. To this end, we characterized, molecularly and phenotypically, two independent TFAM knockdown lines, as TFAM levels are known to control mtDNA copy number. Our results show that most TFAM RNAi flies enter the pharate stage despite having a lower mtDNA copy number than homozygous D263A larvae (Fig. 5e and Supplementary Table 5). This shows that the mtDNA depletion in the homozygous D263A larvae is not sufficient on its own to cause the observed lethality.
DmPOLγA exo− flies slowly accumulate mtDNA mutations
We first studied how mutation levels change during development in flies that have only somatic mutagenesis of mtDNA, that is, flies that are heterozygous for a paternally transmitted D263A allele (Fig. 6a). Interestingly, there was a burst in mtDNA mutation levels after morphogenesis (Fig. 6a). Next we proceeded to study how these mtDNA mutations are transmitted between generations. To this end, we first crossed heterozygous D263A male flies to WT females and measured the mtDNA mutation load in the offspring (Fig. 6b). As the analysed flies were born to mothers that only had transmitted WT mtDNA, maternally transmitted mtDNA mutations cannot influence the overall mtDNA mutation levels. This cross thus allowed us to selectively determine the somatic mtDNA mutation load generated by the heterozygous D263A allele (Fig. 6b). Next, we performed crosses with female flies that had inherited their mtDNA from a maternal lineage of flies heterozygous for the D263A allele for 1, 4, 6 or 13–15 generations (Fig. 6b). Surprisingly, we observed that the accumulation of mtDNA mutations between generations occurred very slowly in flies (Fig. 6b). In fact, the mtDNA mutation load in flies heterozygous for the D263A allele was very similar in strains with reintroduced WT mtDNA and in strains intercrossed for up to four generations (Fig. 6b). However, on further intercrossing, for six generations or more, increased mtDNA mutation levels were observed (Fig. 6b) and the total mutation levels were comparable to those of homozygous D263A larvae (Fig. 4). Altogether, these observations show that flies can maintain a wider mtDNA sequence variation between generations than mammals41. It is generally accepted that a small genetic bottleneck in the mammalian maternal germline cause rapid shifts in mtDNA genotypes between generations41. Therefore, the slow accumulation of mtDNA mutations between generations in heterozygous D263A flies suggests that there is a wider size of the genetic bottleneck for maternal transmission of mtDNA in flies than in mammals.
The DmPOLγA exo− and pol− variants can complement in trans
The finding that flies that are heterozygous for the D263A allele have about half of the mtDNA mutation load of larvae that are homozygous for the D263A allele suggest that the WT allele can complement in trans. We performed a series of crosses to obtain compound heterozygous flies to investigate the occurrence of genetic complementation (Supplementary Fig. 7a). The two pol− mutants Q1009A and H1038A could not complement each other to generate viable compound heterozygous flies (Supplementary Table 2). However, compound heterozygotes, expressing either of the pol− mutants from one allele and the exo− mutant from the other allele, were viable and apparently normal (Fig. 7a and Supplementary Fig. 7b–d and Supplementary Table 2). We observed no differences in body weight (Fig. 7a) or oxygen consumption rates (Supplementary Fig. 7b) of these compound heterozygous larvae in comparison with controls, irrespective of whether the D263A allele was paternally (Q1009A/D263A and H1038A/D263A) or maternally (D263A/Q1009A and D263A/H1038A) inherited. Furthermore, we found no differences in total mtDNA levels between compound heterozygous and WT larvae (Supplementary Fig. 7c) and no linear mtDNAs with deletions were present (Supplementary Fig. 7d). Based on these findings, we conclude that compound heterozygotes harbouring one exo− (D263A) and one pol− allele (Q1009A or H1038A) are phenotypically normal due to genetic complementation.
Complementing flies have clonally expanded mtDNA mutations
We proceeded to investigate the mtDNA mutation load in larvae to get insights into why compound heterozygous (D263A/H1038A) but not homozygous exo− (D263A/D263A) larvae can proceed normally through development. There is accumulation of mtDNA mutations after morphogenesis (Fig. 6a) and any meaningful comparison of the mutation load must therefore be performed in larvae at the same developmental stage. The D263A/H1038A larvae had a similar total mutation load as the D263A/D263A larvae at the L3 stage (Supplementary Fig. 7e), but the number of unique mtDNA mutations was significantly lower (Fig. 7b). The high unique mtDNA mutation load and the presence of linear mtDNA deletions in D263A/D263A larvae likely explain why they cannot proceed through development.
Next, we studied adult flies that were compound heterozygous or only heterozygous for the D263A allele and found similar mutation loads if the D263A allele was paternally transmitted (Fig. 7c). In contrast, compound heterozygous flies containing a D263A allele that had been maternally transmitted for one generation had a higher mtDNA mutation load (Fig. 7c). We maintained heterozygous D263A mutant flies by intercrosses for four generations and then crossed the obtained D263A females with H1038A males to generate compound heterozygotes (D263A/H1038A) (Supplementary Fig. 7a). Very unexpectedly, we observed a substantial increase in the total mtDNA mutation load in the compound heterozygous adult flies, which is mainly explained by high levels of clonally expanded mutations (Supplementary Fig. 7f), thus showing that the H1038A allele likely decreases the size of the bottleneck in the maternal germline. It should be noted that mtDNA mutations that have passed through the germline are subject to purifying selection29,31,39 and therefore are less deleterious than mtDNA mutations that are somatically generated, which likely explains why the compound heterozygous flies are viable despite having high total mtDNA mutation loads.
Maternal mtDNA mutations cause developmental delay
We investigated the timing of development in different types of compound heterozygous flies, where the females contained re-introduced WT mtDNA, and in all cases the majority of flies eclosed at ∼11 days AEL (Fig. 7d, left panel). However, the presence of the D263A allele in the mother led to a slight delay of eclosion in a subpopulation of flies (Fig. 7d, left panel), consistent with some germline mutagenesis of the re-introduced mtDNA. Next, we maintained heterozygous D263A mutant flies by intercrosses for four generations and then crossed them to obtain compound heterozygotes (Fig. 7d, right panel). Interestingly, significant developmental delay was observed in the compound heterozygous flies coming from maternal lineages where mtDNA mutations could accumulate (D263A/Rescue, D263A/H1038A and D263A/Q1009A; Fig. 7d, right panel). To exclude the possibility that acquired nuclear mutations could explain the observed developmental delays, we performed outcrosses to WT flies for two generations. Consistent with a maternal effect, we observed significant developmental delay only in the WT progeny with inherited mtDNA mutations (Fig. 7e). In this experiment, we also included heterozygous D263A flies that had been maintained by intercrosses for ∼2 years and outcrossed to WT flies for six generations (Fig. 7e, green and red lines). A very significant developmental delay was observed in the outcrossed flies that were maternally related to the original cross (Fig. 7e, green line), whereas paternally related flies had normal timing of development (Fig. 7e, red line).
HsPOLγA exo− and pol− proteins cooperatively replicate mtDNA
To investigate whether we could reconstitute the observed genetic complementation biochemically with recombinant mutant forms of HsPOLγA, we assessed elongation of a DNA primer containing a 3′ mismatch (Fig. 8a). The WT HsPOLγA could remove the 3′ mismatch by its exonucleolytic activity and then proceed to elongate in an efficient manner, whereas the D274A mutant could not efficiently remove the mismatch and switch to elongation (Fig. 8b). In contrast, both the Q1102A and H1134A mutants displayed increased exonuclease activity (Fig. 8b) in comparison with WT HsPOLγA (Fig. 8b). The Q1102A mutant was efficient in elongation, whereas the H1134A mutant was inefficient (Fig. 8b), which is in agreement with the severely reduced polymerase activity of the H1134A mutant (Fig. 1e). Finally, we performed in vitro complementation assays by mixing the D274A mutant with either Q1102A or H1134A mutants, using a replication primer that carried a 3′ mismatch nucleotide. On their own, neither the D274A nor the H1134A mutant was able to synthesize DNA efficiently (Fig. 8c, lanes 4 and 8). However, when we mixed the two mutant proteins, they complemented each other and supported efficient DNA synthesis (Fig. 8c, lane 14) suggesting cooperation at the mismatched primer end. The exonuclease and polymerase domains are located in separate regions of HsPOLγA and the observed complementation between D274A and H1134A mutants shows that defects in different functional domains of POLγA can complement each other (Fig. 8c, compare lane 4 and 8 with lane 14). To accomplish this, complementation POLγA must frequently go on and off the template during exonucleolytic proofreading and elongation.
Discussion
Faithful replication has long been assumed essential for mtDNA to prevent the accumulation of deleterious mutations in the absence of recombination. In addition, a yet not fully resolved mechanism during embryogenesis ensures that only a limited number of mtDNA molecules are transmitted through the female germline to the next generation. Flies seem to be more susceptible to impaired mtDNA maintenance than the mutator mice, because the majority of flies homozygous for the exo− DmPOLγA did not pass the L3 larval stage, despite carrying approximately threefold less mtDNA mutations than mtDNA mutator mice41,42,43,53. Similar to the situation in mtDNA mutator mice, the majority of mtDNA mutations accumulated during early developmental stages also in flies. The finding of arrested development, caused by high levels of mtDNA mutations or mtDNA depletion, show that mitochondrial function is important to allow larvae to proceed to the pupal stage. Interestingly, heterozygous exo− flies have lower mtDNA mutation levels than homozygous exo− larva and no obvious phenotype. These findings argue that mtDNA mutations will only impair development if the mtDNA mutation levels exceed a critical threshold. The mutational pattern observed in the exo− flies is analogous to the pattern in mtDNA mutator mice and consists mainly of transition mutations. The majority of mtDNA mutations are transitions also in wild animals and humans, which is consistent with the hypothesis that most of the mtDNA variation is created by replicative errors rather than by unrepaired base lesions caused by oxidation or other types of damage22,24.
In accordance with results from mtDNA mutator mice22,42, homozygous exo− larvae contained linear mtDNA molecules with deletions. In mice, the linear deleted mtDNA molecule spans the major arc between both origins of replication, and the levels of deleted mtDNA does not increase with time, which suggests they are formed by abortive replication of the full-length mtDNA molecule and are not themselves templates for mtDNA replication. We have recently demonstrated that the exonuclease activity of mammalian POLγ is required to create ligatable ends at the termination of replication54. Inactivation of the exonuclease activity causes the appearance of unligated nicks at the origins of replication, which leads to linear deletions during subsequent rounds of mtDNA synthesis. The linear deletion observed in mouse therefore defines the location of the strand-specific origins for mtDNA synthesis54. In flies, the origins of mtDNA replication have not yet been defined, although the noncoding A+T-rich control region has been proposed to contain both origins in arthropods52. In the homozygous exo− larvae, we mapped the ends of the linear deletions to the A+T-rich region. Our observation of linear deletions and the location of their ends therefore strongly suggests that also fly mtDNA, similar to mammalian mtDNA, has a dedicated origin of replication for each strand of mtDNA, and that these origins are located in the non-coding A+T-rich region of fly mtDNA.
Further, our results suggest that flies have a wider bottleneck during transmission of mtDNA through the maternal germline than mammals29. In mice, continuous breeding maternal lineages of heterozygous mtDNA mutator mice results in rapid accumulation of mtDNA mutations within a few generations29, whereas similar crosses of heterozygous exo− flies required six generations before an additional increase of the mtDNA mutation load could be observed. Interestingly, we observed that compound heterozygous flies showed a much more rapid clonal expansion of mtDNA mutations than exo− heterozygous flies. This is likely due to a post-fertilization bottleneck as the polymerase-deficient high-fidelity allele may reduce mtDNA copy number. Similar observations were made in the mouse, where mtDNA copy number during early development is reduced in heterozygous TFAM KO mice49. It is thus tempting to suggest that while the mammalian mitochondrial bottleneck results in low variation, flies transmit a larger number of mtDNA copies55 and thus tolerate more somatic mtDNA variation. The short lifespan of flies may thus not have led to the selection of a tight bottleneck during evolution.
Surprisingly, our results from the complementation studies suggest that the mtDNA polymerase can go on and off the template during replication and that, despite being incapable of replicating mtDNA in an efficient manner, the pol− variants may have been able to repair some of the replication errors introduced by the exo− mutant. This observation could very well explain the molecular nature behind disease-causing dominant versus recessive mutations in the POLγA gene in humans. Several autosomal recessive mutations have been described and one of the most common is the A467T mutation, which has been found alone or in trans with other mutations in the same gene56. In vitro studies suggest that only 4% of the polymerase activity remains in A467T mutant alleles57. Heterozygous carriers are healthy, showing that the WT allele can complement the defect. In contrast, autosomal dominant mutations in the POLγA such as the Y955C leading to progressive external ophthalmoplegia (adPEO) stalls mtDNA replication at specific sites in vitro58. Autosomal dominant mutations thus might compete with the WT allele preventing full replication, and thereby cause mtDNA deletions or depletion.
In conclusion, we show here that mtDNA mutations transmitted through the fly germline are clonally expanded and they will severely impact fly development when they are present above a certain threshold. Furthermore, we provide genetic evidence that two PolγA alleles, mutated in different domains, can functionally complement each other in vivo and in vitro, suggesting that mtDNA polymerase can re-initiate mtDNA replication after an aborted replicative cycle. Finally, our data suggest that the exonuclease activity of POLγA is required for mtDNA replication to proceed past the origins of replication.
Methods
Expression and purification of recombinant human proteins
Mutagenesis of the human POLγA variants was carried out using the QuickChange Lightning Site-directed mutagenesis kit according to the provided protocol (Agilent). The presence of HsPOLγA mutations was confirmed by sequencing (Eurofins MWG Operon). Protein expression and purification of the different POLγA variants, POLγB, TWINKLE and mtSSB were done as previously described8. The concentrations of the HsPOLγA mutants were determined by quantification from SDS–PAGE using WT HsPOLγA as reference.
EMSA and coupled exonuclease/polymerase assays
DNA affinity of POLγ to a primer template was assayed using EMSA59. The reactions contained 10 fmol DNA template and the indicated holoenzyme (POLγA/POLγB complex) concentrations in the presence of 300 μM ddGTP and 3 mM dCTP. The reactions were run on 6% native polyacrylamide gels in 0.5 × TBE for 35 min at 180 V and visualized by autoradiography. Each experiment was repeated three times. Band intensities representing unbound and bound DNA were quantified using Fujifilm Multi Gauge V3.1 software. The fraction of bound DNA was determined from the background-subtracted signal intensities using the expression: bound/(bound+unbound). The fraction of DNA bound in each reaction was plotted versus the concentration of POLγ. Data were fit with the binding equation (Fraction bound=(MaxB × [POLγ])/(MaxB+[POLγ]) using EXCELs Add-in ‘Solver’ to perform non-linear regression and obtain values for Kd (as the value corresponding to the midpoint of MaxB) and using MaxB set to 1 (the fraction bound at which the data plateaus). The EMSA substrate was also utilized to examine the polymerization and the 3′ to 5′ exonuclease activities of POLγA as previously described60 but with 150 fmol of the indicated POLγA variant and 600 fmol of POLγB. The reactions were analysed on a 15% denaturing polyacrylamide gel electrophoresis in 1 × TBE and visualized by autoradiography.
Second strand DNA synthesis
A 32P-labelled 32-mer (5′- CTATCTCAGCGATCTGTCTATTTCGTTCATCC -3′) was annealed to SS pBluescript SK(+). DNA synthesis reactions were performed as described previously and were incubated at 37 °C for the times indicated60. The products were analysed by electrophoresis in a 0.9% agarose gel and visualized by autoradiography.
In vitro rolling circle DNA replication
An oligonucleotide consisting of 70 nucleotides (5′-42[T]- ATCTCAGCGATCTGTCTATTTCGTTCAT -3′) was hybridized to a SS pBluescript SK(+) followed by one cycle of polymerization with KOD polymerase (Novagen) to produce an ∼3-kb double-stranded template with a preformed replication fork. The reactions were performed as described61, and were incubated at 37 °C for times indicated (0, 5, 15, 30 and 60 min). The products were analysed by electrophoresis in a 0.8% denaturing agarose gel and visualized by autoradiography.
3′–5′ exonuclease activity
A 5′ 32P-labelled 32-mer (5′- CTATCTCAGCGATCTGTCTATTTCGTTCATCG -3′) with a one-nucleotide mismatch at the 3′-end was annealed to SS pBluescript SK(+). The reactions were performed as in the second strand DNA synthesis assay but in the absence or presence of dNTPs and with indicated POLγA variant. The reactions were incubated at 37 °C for the times indicated. The samples were analysed by electrophoresis in a 20% denaturing PAGE and visualized by autoradiography.
Processivity assays
Assays were performed by mixing 10 μl of reaction mixture A with 10 μl of reaction mixture B followed by incubation at 37 °C for 10 min. Reaction mixture A contained 25 fmol template as described in Fig. 1d for second strand synthesis, 50 fmol of the indicated POLγA versions and 200 fmol of POLγB, 1 mM DTT, 25 mM TrisHCl pH 7.8 and 0.1 mg ml−1 BSA. Reaction mixture B contained 10 mM MgCl2, 100 μM dNTP and 0,001 mg ml−1 heparin (heparin was omitted in reactions that allowed for multiple binding events to occur). Reactions were stopped by the addition of 20 μl of 95% formamide, 20 mM EDTA and 0.1% bromophenol blue. The samples were analysed by electrophoresis on 12% denaturing PAGE.
Drosophila stocks and maintenance
Deficiency lines (Df(2L)Exel7059, Df(2L)BSC252, Df(2L)BSC694) and hypomorphic tamas alleles tam3 and tam4 were obtained from Bloomington stock center. TFAM knockdown lines (#1: ID107191 and #2: ID37819) were purchased from the Vienna Drosophila RNAi center (VDRC, Austria). All genomically engineered fly strains were constantly backcrossed into a white Dahomey Wolbachia-free (wDahT) WT strain to avoid accumulation of mtDNA mutations unless stated otherwise. All fly stocks were maintained at 25 °C on a 12:12 h light/dark cycle with 65% humidity and fed on a sugar/yeast/agar (SYA) diet62.
Generation of genomically engineered DmPOLγA flies
Experimental flies were generated by genomic engineering in a two-step process48. In the first step, we generated a DmPOLγA KO founder line by replacing the endogenous DmPOLγA gene (tamas) with an attP site by ends-out homologous recombination. The attP site was then used in the second step to reintroduce wild-type and mutated versions of the tamas gene by Φ31-mediated recombination.
For the ends-out homologous recombination donor construct ∼4 kb of 5′ and 3′ flanking sequences of the tamas gene were cloned into the pBlueScript II SK(+) vector (Stratagene) by ET recombination using gene-specific primers (Supplementary Table 6) and a tamas BAC clone (RP98–30I21, BACPAC Resource Center, Oakland, California). 5′ and 3′ homologous arms were sequence verified and subsequently cloned into the pGXattP targeting vector48. Transgenic flies carrying the tamas pGXattP targeting vector were generated by P-element-mediated germ line transformation using the BestGene Drosophila embryo injection service. Crosses for ends-out homologous recombination were carried out according to the rapid targeting scheme63. Subsequently, the whitehs marker gene was genetically mapped and homologous recombination events were identified by PCR using primers PCR3 and PCR4 (Supplementary Table 6). Tamas KO flies were crossed to flies expressing a cre-recombinase to remove the whitehs marker gene48. Absence of the tamas gene was confirmed by PCR using primers PCR1 (Supplementary Table 6). The corresponding flies are referred to as tamas KO flies.
Rescue construct (Supplementary Fig. 3a) was amplified by PCR using primers PCR8 (Supplementary Table 6). Rescue construct was sequence verified and subsequently cloned using XhoI and AscI sites into the pGEattBGMR vector48. Mutagenesis of the WT tamas allele was carried out using the ‘QuickChange Lightning Site-directed mutagenesis kit’ according to the provided protocol and pGEattBGMR-Rescue construct was used as a template. Primers used for site-directed mutagenesis are indicated in Supplementary Table 6. All mutant tamas allelic variants were sequenced to ensure the absence of base substitutions. The presence of D263A, H1038A and/or Q1009A mutations was confirmed by sequencing. Mutant variants of the tamas gene were then injected into the embryos of tamas KO flies expressing Φ31 integrase by the in-house Drosophila transgenic core facility. Primers used to verify the precise re-introduction of tamas allelic variants into the native tamas locus were PCR5 and PCR6 (Supplementary Table 6). The absence of genomic rearrangements on re-introduction of tamas mutant alleles was confirmed by Southern blot analyses. Total DNA was isolated from the corresponding genotypes and digested with XhoI. A full-length complementary DNA (cDNA) of DmPOLγA was used as a probe and the signal was visualized by autoradiography.
To verify that the whitehs marker gene did not interfere with DmPOLγA function and induced lethality, all tamas mutant lines were crossed to flies expressing the cre-recombinase. Precise removal of the whitehs marker gene was confirmed by PCR using primers PCR5 and PCR7 (Supplementary Table 6). Tamas mutant flies with or without the whitehs marker gene showed similar survival, thus for all experiments tamas mutant flies carrying the whitehs marker gene were used.
Fly developmental time
To assess developmental time, flies were allowed to lay eggs on grape juice agar plates for 3 h. For each genotype, 100 eggs were individually picked and placed into vials with SYA food. The number of eclosed flies was scored every 12 h. At least five biological replicates were done for each genotype.
Developmental analysis of DmPOLγA mutant flies
For assessing the percentage of DmPOLγA mutant flies entering L3 stage, flies were allowed to lay eggs on grape juice agar plates for 2 h. For each genotype, 100 eggs were individually picked and placed into vials with SYA food. The number of L3 larvae of each genotype was scored 6 days AEL. At least six biological replicates were done for each genotype.
To assess the percentage of DmPOLγA mutant flies entering the pupal stage, 50 L3 larvae were collected and transferred into vial with SYA food. The number of pupae was scored every 12 h. At least three biological replicates were done for each genotype.
To assess the percentage of DmPOLγA mutant flies entering the adult stage, 50 L3 larvae were collected and transferred into vial with SYA food. The number of adult flies was scored every 12 h. At least three biological replicates were done for each genotype.
DNA isolation and qRT–PCR and Southern blot analyses
For relative mtDNA copy number determination, total DNA extractions were prepared from L3 larvae using DNeasy Blood and Tissue Kit (Qiagen). Five biological replicates, each with 10 larvae, were prepared for each genotype. Quantification of mtDNA levels was done using SYBR-Green qPCR analyses and primers targeting cytB and rpL32 (Supplementary Table 6). All data were normalized against wild type levels.
For Southern blot analysis, total DNA was extracted from 20–30 L3 larvae. Samples were homogenized with a tissue grinder in 400 μl of buffer A (100 mM Tris-HCl, pH 7.5; 100 Mm EDTA; 100 mM NaCl and 0.5% SDS). After incubation at 65 °C for 30 min, 800 μl of Buffer B (4 ml of 5 M KOAc and 10 ml of 6 M lithium chloride) was added and samples were left on ice for 60 min. After incubation, samples were centrifuged at 12,000g for 15 min and supernatant was transferred into a new tube. About 540 μl of isopropanol was added to the supernatant and samples were further centrifuged at 12000g for 15 min. Pellet was washed with 70% ethanol, dried and resuspended in 100 μl nuclease-free water containing 20 μg ml−1 RNase A. After incubation at 37 °C for 1 h, samples were stored at +4 °C.
Approximately, 1–3 μg of total DNA was cut using either EcoRV, PstI, NdeI, NsiI or StyI restriction endonuclease. Digestions were run on 0.8% agarose gels, and blotted to Hybond-N+ membrane (Amersham Bioscience). ND2, COXI or 12S rRNA were used as probes and signals were visualized by autoradiography. 32P-labelling of Southern probes was done according to manufacturer’s instructions (Prime-IT II Random Prime Labeling Kit, Agilent). Primers used to prepare the mtDNA probes can be found in the Supplementary Table 6.
RNA isolation and quantitative RT–PCR
Total RNA was extracted from 5-day-old larvae using ToTALLY RNA isolation kit (Ambion). For expression analyses, RNA was DNase treated using Turbo DNA-free kit (Ambion) and reverse transcribed using High capacity cDNA Reverse Transcription kit (Applied Biosystems). The expression profiles were determined by quantitative reverse transcription–PCR (qRT–PCR) analyses with a 7900HT Fast Real Time PCR System (Applied Biosystems). Rpl32 was used as a normalization control64. Taqman probes were provided by Applied Biosystems under following assay numbers: tamas (Dm01841857_g1); CG8978 (Dm01807408_g1); CG7833 (Dm01842615_g1); CG7811 (Dm01841741_g1); CG33650 (assay is not available anymore).
MtDNA mutation load analysis
Total DNA was extracted from whole larvae or from the thorax of adult male flies using the DNeasy Blood and Tissue Kit. The mtDNA mutation load was determined by PCR, cloning and sequencing as described elsewhere22,42,65. Fly mtDNA-specific primers were used to amplify a 1.2-kb region encompassing Leu-transfer RNA and parts of COXI and COXII (nucleotide pair 2,194–3,382). An average number of 90 colonies were analysed per animal.
Biochemical evaluation of respiratory chain function
Five-day-old larvae were collected and the respiratory rates were measured as described by ref. 66. Briefly, 5 L3 larvae were dissected in 100 μl of respiration buffer (120 mM sucrose, 50 mM KCl, 20 mM Tris-HCl, 4 mM KH2PO4, 2 mM MgCl2, 1 mM EGTA, 0,01% digitonin, pH 7.2) and oxygen consumption was monitored at 27 °C using oxygraph (OROBOROS). State 3 respiration was assessed by adding the following substrates: proline (10 mM), pyruvate (10 mM), malate (5 mM), glutamate (5 mM) and ADP (1 mM). State 4 respiration was assessed by adding oligomycin (250 ng ml−1) and uncoupled state was obtained by adding 1 μM CCCP. Oxygen consumption rates were normalized to total protein content quantified by the Bradford method (Sigma).
Statistical analysis
Statistical analyses were performed using GraphPad Prism 5.03 (GraphPad Prism Software, Inc). For statistical analyses of qPCR analyses, qRT–PCR analyses and mtDNA mutation loads one-way ANOVA with Dunnett's test post hoc was used unless stated otherwise. For statistical analyses of OXPHOS function Mann–Whitney two-tailed test was used. For statistical analyses of body weight, Tukey’s multiple comparison test was used. All data are presented as mean±s.d.
Additional information
How to cite this article: Bratic, A. et al. Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies. Nat. Commun. 6:8808 doi: 10.1038/ncomms9808 (2015).
References
Kukat, C. & Larsson, N.-G. mtDNA makes a U-turn for the mitochondrial nucleoid. Trends Cell Biol. 23, 457–463 (2013).
Kukat, C. et al. Cross-strand binding of TFAM to a single mtDNA molecule forms the mitochondrial nucleoid. Proc. Natl Acad. Sci. USA 112, 11288–11293 (2015).
Farge, G. et al. In vitro-reconstituted nucleoids can block mitochondrial DNA replication and transcription. Cell Rep. 8, 66–74 (2014).
Ropp, P. A. & Copeland, W. C. Cloning and characterization of the human mitochondrial DNA polymerase, DNA polymerase gamma. Genomics 36, 449–458 (1996).
Kaguni, L. S. DNA polymerase γ, the mitochondrial replicase 1. Annu. Rev. Biochem. 73, 293–320 (2004).
Wang, Y. X., Farr, C. L. & Kaguni, L. S. Accessory subunit of mitochondrial DNA polymerase from Drosophila embryos—Cloning, molecular analysis, and association in the native enzyme. J. Biol. Chem. 272, 13640–13646 (1997).
Carrodeguas, J. A., Theis, K., Bogenhagen, D. F. & Kisker, C. Crystal structure and deletion analysis show that the accessory subunit of mammalian DNA polymerase gamma, Pol gamma B, functions as a homodimer. Mol. Cell 7, 43–54 (2001).
Korhonen, J. A., Pham, X. H., Pellegrini, M. & Falkenberg, M. Reconstitution of a minimal mtDNA replisome in vitro. EMBO J. 23, 2423–2429 (2004).
Hance, N., Ekstrand, M. I. & Trifunovic, A. Mitochondrial DNA polymerase gamma is essential for mammalian embryogenesis. Hum. Mol. Genet. 14, 1775–1783 (2005).
Humble, M. M. et al. Polg2 is essential for mammalian embryogenesis and is required for mtDNA maintenance. Hum. Mol. Genet. 22, 1017–1025 (2013).
Milenkovic, D. et al. TWINKLE is an essential mitochondrial helicase required for synthesis of nascent D-loop strands and complete mtDNA replication. Hum. Mol. Genet. 22, 1983–1993 (2013).
Lightowlers, R. N. & Chrzanowska-Lightowlers, Z. M. A. Exploring our origins—the importance of OriL in mtDNA maintenance and replication. EMBO Rep. 13, 1038–1039 (2012).
Clayton, D. A. Replication of animal mitochondrial DNA. Cell 28, 693–705 (1982).
Wanrooij, S. et al. In vivo mutagenesis reveals that OriL is essential for mitochondrial DNA replication. EMBO Rep. 13, 1130–1137 (2012).
Wanrooij, S. et al. Human mitochondrial RNA polymerase primes lagging-strand DNA synthesis in vitro. Proc. Natl Acad. Sci. USA 105, 11122–11127 (2008).
Kühl, I. et al. POLRMT does not transcribe nuclear genes. Nature 514, E7–11 (2014).
Mita, S. et al. Recombination via flanking direct repeats is a major cause of large-scale deletions of human mitochondrial-DNA. Nucleic Acids Res. 18, 561–567 (1990).
Moraes, C. T. et al. Replication-competent human mitochondrial-DNA lacking the heavy-strand promoter region. Mol. Cell. Biol. 11, 1631–1637 (1991).
Fusté, J. M. et al. In vivo occupancy of mitochondrial single-stranded DNA binding protein supports the strand displacement mode of DNA replication. PLoS Genet. 10, e1004832 (2014).
Wallace, D. C. Mitochondrial diseases in man and mouse. Science 283, 1482–1488 (1999).
Stewart, J. B. et al. Strong purifying selection in transmission of mammalian mitochondrial DNA. PLoS Biol. 6, e10 (2008).
Ameur, A. et al. Ultra-deep sequencing of mouse mitochondrial DNA: Mutational patterns and their origins. PLoS Genet. 7, e1002028 (2011).
Kennedy, S. R., Salk, J. J., Schmitt, M. W. & Loeb, L. A. Ultra-sensitive sequencing reveals an age-related increase in somatic mitochondrial mutations that are inconsistent with oxidative damage. PLoS Genet. 9, e1003794 (2013).
Itsara, L. S. et al. Oxidative stress is not a major contributor to somatic mitochondrial DNA mutations. PLoS Genet. 10, e1003974 (2014).
Copeland, W. C. Defects of mitochondrial DNA replication. J. Child Neurol. 29, 1216–1224 (2014).
Bogenhagen, D. & Clayton, D. A. Mouse L cell mitochondrial DNA molecules are selected randomly for replication throughout the cell cycle. Cell 11, 719–727 (1977).
Larsson, N.-G. Somatic mitochondrial DNA mutations in mammalian aging. Annu. Rev. Biochem. 79, 683–706 (2010).
Hagström, E., Freyer, C., Battersby, B. J., Stewart, J. B. & Larsson, N.-G. No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline. Nucleic Acids Res. 42, 1111–1116 (2014).
Stewart, J. B. & Larsson, N.-G. Keeping mtDNA in shape between generations. PLoS Genet. 10, e1004670 (2014).
Freyer, C. et al. Variation in germline mtDNA heteroplasmy is determined prenatally but modified during subsequent transmission. Nat. Genet. 44, 1282–1285 (2012).
Hill, J. H., Chen, Z. & Xu, H. Selective propagation of functional mitochondrial DNA during oogenesis restricts the transmission of a deleterious mitochondrial variant. Nat. Genet. 46, 389–392 (2014).
Fan, W. et al. A mouse model of mitochondrial disease reveals germline selection against severe mtDNA mutations. Science 319, 958–962 (2008).
Elson, J. L., Turnbull, D. M. & Howell, N. Comparative genomics and the evolution of human mitochondrial DNA: assessing the effects of selection. Am. J. Hum. Genet. 74, 229–238 (2004).
Soares, P., Abrantes, D., Rito, T., Thomson, N. & Radivojac, P. Evaluating purifying selection in the mitochondrial DNA of various mammalian species. PLoS ONE 8, e58993 (2013).
Hauswirth, W. W. & Laipis, P. J. Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows. Proc. Natl Acad. Sci. USA 79, 4686–4690 (1982).
Jenuth, J. P., Peterson, A. C., Fu, K. & Shoubridge, E. A. Random genetic drift in the female germline explains the rapid segregation of mammalian mitochondrial DNA. Nat. Genet. 14, 146–151 (1996).
Cree, L. M. et al. A reduction of mitochondrial DNA molecules during embryogenesis explains the rapid segregation of genotypes. Nature 40, 249–254 (2008).
Wai, T., Teoli, D. & Shoubridge, E. A. The mitochondrial DNA genetic bottleneck results from replication of a subpopulation of genomes. Nat. Genet. 40, 1484–1488 (2008).
Ma, H., Xu, H. & O'Farrell, P. H. Transmission of mitochondrial mutations and action of purifying selection in Drosophila melanogaster. Nat. Genet. 46, 393–397 (2014).
Stewart, J. B., Freyer, C., Elson, J. L. & Larsson, N.-G. Purifying selection of mtDNA and its implications for understanding evolution and mitochondrial disease. Nat. Rev. Genet. 9, 657–662 (2008).
Ross, J. M. et al. Germline mitochondrial DNA mutations aggravate ageing and can impair brain development. Nature 501, 412–415 (2013).
Trifunovic, A. et al. Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature 429, 417–423 (2004).
Kujoth, G. C. Mitochondrial DNA mutations, oxidative stress, and apoptosis in mammalian aging. Science 309, 481–484 (2005).
Minnick, D. T. D. et al. Side chains that influence fidelity at the polymerase active site of Escherichia coli DNA polymerase I (Klenow fragment). J. Biol. Chem. 274, 3067–3075 (1999).
Foury, F. & Szczepanowska, K. Antimutator alleles of yeast DNA polymerase gamma modulate the balance between DNA synthesis and excision. PLoS ONE 6, e27847 (2011).
Vanderstraeten, S., Van den Brule, S., Hu, J. P. & Foury, F. The role of 3 ‘-5 ’ exonucleolytic proofreading and mismatch repair in yeast mitochondrial DNA error avoidance. J. Biol. Chem. 273, 23690–23697 (1998).
Lefai, E. et al. Overexpression of the catalytic subunit of DNA polymerase gamma results in depletion of mitochondrial DNA in Drosophila melanogaster. Mol. Gen. Genet. 264, 37–46 (2000).
Huang, J., Zhou, W., Dong, W., Watson, A. M. & Hong, Y. From the Cover: Directed, efficient, and versatile modifications of the Drosophila genome by genomic engineering. Proc. Natl Acad. Sci. USA 106, 8284–8289 (2009).
Larsson, N. G. et al. Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat. Genet. 18, 231–236 (1998).
Bratic, I. et al. Mitochondrial DNA level, but not active replicase, is essential for Caenorhabditis elegans development. Nucleic Acids Res. 37, 1817–1828 (2009).
Iyengar, B., Roote, J. & Campos, A. R. The tamas gene, identified as a mutation that disrupts larval behavior in Drosophila melanogaster, codes for the mitochondrial DNA polymerase catalytic subunit (DNApol−gamma125). Genetics 153, 1809–1824 (1999).
Saito, S., Tamura, K. & Aotsuka, T. Replication origin of mitochondrial DNA in insects. Genetics 171, 1695–1705 (2005).
Trifunovic, A. et al. Somatic mtDNA mutations cause aging phenotypes without affecting reactive oxygen species production. Proc. Natl Acad. Sci. USA 102, 17993–17998 (2005).
Macao, B. et al. The exonuclease activity of DNA polymerase γ is required for ligation during mitochondrial DNA replication. Nat. Commun. 6, 7303 (2015).
Wolff, J. N. & Gemmell, N. J. Mitochondria, maternal inheritance, and asymmetric fitness: why males die younger. Bioessays 35, 93–99 (2013).
Tzoulis, C. et al. The spectrum of clinical disease caused by the A467T and W748SPOLG mutations: a study of 26 cases. Brain 129, 1685–1692 (2006).
Chan, S. S. L., Longley, M. J. & Copeland, W. C. The common A467T mutation in the human mitochondrial DNA polymerase (POLG) compromises catalytic efficiency and interaction with the accessory subunit. J. Biol. Chem. 280, 31341–31346 (2005).
Atanassova, N. et al. Sequence-specific stalling of DNA polymerase γ and the effects of mutations causing progressive ophthalmoplegia. Hum. Mol. Genet. 20, 1212–1223 (2011).
Farge, G., Pham, X. H., Holmlund, T., Khorostov, I. & Falkenberg, M. The accessory subunit B of DNA polymerase is required for mitochondrial replisome function. Nucleic Acids Res. 35, 902–911 (2007).
Roos, S. et al. Subnormal levels of POLA cause inefficient initiation of light-strand DNA synthesis and lead to mitochondrial DNA deletions and autosomal dominant progressive external ophthalmoplegia. Hum. Mol. Genet. 22, 2411–2422 (2013).
Fusté, J. M. et al. Mitochondrial RNA polymerase is needed for activation of the origin of light-strand DNA replication. Mol. Cell 37, 67–78 (2010).
Bass, T. M. et al. Optimization of dietary restriction protocols in Drosophila. J. Gerontol. A Biol. Sci. Med. Sci. 62, 1071–1081 (2007).
Rong, Y. S. & Golic, K. G. A targeted gene knockout in Drosophila. Genetics 157, 1307–1312 (2001).
Wredenberg, A. et al. MTERF3 regulates mitochondrial ribosome biogenesis in invertebrates and mammals. PLoS Genet. 9, e1003178 (2013).
Wanrooij, P. H. et al. A hybrid G-quadruplex structure formed between RNA and DNA explains the extraordinary stability of the mitochondrial R-loop. Nucleic Acids Res. 40, 10334–10344 (2012).
Wredenberg, A. et al. Increased mitochondrial mass in mitochondrial myopathy mice. Proc. Natl Acad. Sci. USA 99, 15066–15071 (2002).
Acknowledgements
This study was supported by a grant from the Swedish Research Council (2013–2859) to N.-G.L. A.W. is supported by the Swedish foundation for strategic research (ICA12-0017), the Swedish research council (2012–2571) and is a Ragnar Söderberg fellow (K0176–2012). T.E.S.K. was supported by Finnish Cultural Foundation (00140383). We thank to Bloomington Stock Center for providing flies.
Author information
Authors and Affiliations
Contributions
A.B., T.E.S.K., S.G., L.P, M.F., A.W. and N-G.L. conceived and designed the study. A.B., T.E.S.K., B.M., S.G., T.S., J.B.S, F.B. and A.W. performed the experiments. A.B., T.E.S.K., B.M., S.G., T.S., J.B.S., M.F. and A.W. analysed the data. J.D. performed embryo injections. A.B., T.E.S.K., B.M., M.F., A.W. and N.-G.L. wrote the manuscript.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Supplementary information
Supplementary Information
Supplementary Figures 1-7 and Supplementary Tables 1-6. (PDF 1769 kb)
Rights and permissions
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
About this article
Cite this article
Bratic, A., Kauppila, T., Macao, B. et al. Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies. Nat Commun 6, 8808 (2015). https://doi.org/10.1038/ncomms9808
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/ncomms9808
This article is cited by
-
Structural basis for DNA proofreading
Nature Communications (2023)
-
The PPR domain of mitochondrial RNA polymerase is an exoribonuclease required for mtDNA replication in Drosophila melanogaster
Nature Cell Biology (2022)
-
Organization and expression of the mammalian mitochondrial genome
Nature Reviews Genetics (2022)
-
Mitochondrially-targeted APOBEC1 is a potent mtDNA mutator affecting mitochondrial function and organismal fitness in Drosophila
Nature Communications (2019)
-
Developmental arrest in Drosophila melanogaster caused by mitochondrial DNA replication defects cannot be rescued by the alternative oxidase
Scientific Reports (2018)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.