A leak pathway for luminal protons in endosomes drives oncogenic signalling in glioblastoma

Kondapalli, Kalyan C.; Llongueras, Jose P.; Capilla-González, Vivian; Prasad, Hari; Hack, Anniesha; Smith, Christopher; Guerrero-Cázares, Hugo; Quiñones-Hinojosa, Alfredo; Rao, Rajini

doi:10.1038/ncomms7289

Article
Published: 09 February 2015

A leak pathway for luminal protons in endosomes drives oncogenic signalling in glioblastoma

Kalyan C. Kondapalli¹^na1^nAff4,
Jose P. Llongueras¹^na1,
Vivian Capilla-González²^nAff5,
Hari Prasad¹,
Anniesha Hack¹,
Christopher Smith²,
Hugo Guerrero-Cázares²,
Alfredo Quiñones-Hinojosa² &
…
Rajini Rao¹

Nature Communications volume 6, Article number: 6289 (2015) Cite this article

6056 Accesses
66 Citations
75 Altmetric
Metrics details

Subjects

Abstract

Epidermal growth factor receptor (EGFR) signalling is a potent driver of glioblastoma, a malignant and lethal form of brain cancer. Disappointingly, inhibitors targeting receptor tyrosine kinase activity are not clinically effective and EGFR persists on the plasma membrane to maintain tumour growth and invasiveness. Here we show that endolysosomal pH is critical for receptor sorting and turnover. By functioning as a leak pathway for protons, the Na⁺/H⁺ exchanger NHE9 limits luminal acidification to circumvent EGFR turnover and prolong downstream signalling pathways that drive tumour growth and migration. In glioblastoma, NHE9 expression is associated with stem/progenitor characteristics, radiochemoresistance, poor prognosis and invasive growth in vitro and in vivo. Silencing or inhibition of NHE9 in brain tumour-initiating cells attenuates tumoursphere formation and improves efficacy of EGFR inhibitor. Thus, NHE9 mediates inside–out control of oncogenic signalling and is a highly druggable target for pan-specific receptor clearance in cancer therapy.

You have full access to this article via your institution.

Download PDF

Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities

Article Open access 03 January 2022

Jiaqi Liu, Qing Xiao, … Gang Yin

Spatial transcriptomics reveals discrete tumour microenvironments and autocrine loops within ovarian cancer subclones

Article Open access 03 April 2024

Elena Denisenko, Leanne de Kock, … Alistair R. R. Forrest

KRAS mutation: from undruggable to druggable in cancer

Article Open access 15 November 2021

Lamei Huang, Zhixing Guo, … Liwu Fu

Introduction

Glioblastoma multiforme (GBM) is the most common and aggressive form of adult primary brain tumour with extremely poor prognosis^1,2. Diffuse invasion of tumour cells into the surrounding brain parenchyma makes surgical resection largely ineffective and the pluripotent behaviour of a small group of brain tumour-initiating cells (BTICs) in GBM confers drug resistance and recurrence even after aggressive treatment^3,4,5. As a result, clinical outcomes of patients have failed to show substantive improvement over median survival times of 12 months and innovative approaches to therapy are urgently needed⁵. The key step in moving towards personalized medicine involves identifying specific genes and pathways to be targeted in individual patients. This has been the driving force for compiling databases of genome and proteome changes in GBM patients that are now being successfully mined to uncover novel risk factors and potential therapeutic targets. Using this approach, we made the unexpected discovery that in a subset of glioblastomas, the autism-associated gene SLC9A9 (refs 6, 7, 8) was a potent driver of tumour growth and migration, associated with decreased patient survival and increased aggressiveness in vivo.

Previously, we showed that loss-of-function mutations in SLC9A9 encoding the endosomal Na⁺/H⁺ exchanger NHE9 result in hyperacidification of sorting endosomes and cellular trafficking defects associated with autism^6,7. In contrast, we now report that gain of function in NHE9 results in excessive luminal alkalization in BITCs from patient glioblastomas. Although studies of pH, ionic and volume modulation in tumour cells have thus far been restricted to plasma membrane ion transporters, there have been intriguing hints of a link between organellar pH and oncogenic signalling by growth factor receptors. The human papillomavirus type 16 E5 oncoprotein activates growth factor receptors Epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor with concomitant alkalization of Golgi and endosomes, following binding to H⁺-pumping V-ATPase 16 kDa c subunit⁹. Furthermore, pharmacological disruption of V-ATPase activity by bafilomycin A₁ was found to augment the extent and duration of EGFR activation¹⁰. However, a causal link between luminal pH and oncogenic signalling remains to be established, and the prevailing model of the luminal pH set point overwhelmingly focuses on the proton pumping V-ATPase, with the role of proton leak pathways, mediated by endosomal Na⁺/H⁺ exchange, being largely understudied.

In this study we demonstrate that NHE9 levels in patient-derived BTICs drive proliferation rates, cell adhesion, migration directionality and speed in vitro and in vivo mouse xenograft models. Mechanistically, these events are mediated by the luminal pH of sorting endosomes with distinct effects on endocytosis and exocytosis of cargo. EGFR is mutated, amplified or transcriptionally upregulated in 50% of human GBM¹¹ and its downstream signalling network includes highly deregulated and oncogenic components responsible for uncontrolled cell proliferation in most cancers. By drastically attenuating receptor turnover, NHE9 exerts posttranslational control on membrane persistence of EGFR, confers increased resistance to receptor tyrosine kinase inhibitors and drives oncogenic signalling pathways that regulate cell division and migration. Importantly, posttranslational control by NHE9 overrides differences in EGFR transcript levels in GBM tumour cells. Finally, we demonstrate that a pharmacological inhibitor of NHE transporters works together with a known EGFR inhibitor to impair GBM tumour growth. Given the dismal prognosis of glioblastoma, these observations highlight the potential of developing selective anti-NHE9 therapeutics. Taken together, our findings reveal a crucial, hitherto unrecognized role for luminal pH in GBM progression and allow us to propose NHE9 as a promising chemotherapeutic target.

Results

NHE9 affects patient survival and GBM proliferation

Gene expression profiles for NHE9 (SLC9A9) were extracted from human glioblastoma arrays on Oncomine and The Cancer Genome Atlas (TCGA) databases^{12,13,14,15,16}. NHE9 expression varied widely among human glioblastoma subtypes, with 36% of mesenchymal tumours showing significant NHE9 upregulation (Supplementary Fig. 1A). Notably, SLC9A9 was in the top 12% of overexpressed genes in a human gene chip array of 101 samples, with messenger RNA levels averaging 5.7-fold higher (P=0.012; Student’s t-test) in glioblastomas relative to control neural stem cells (Fig. 1a). Interrogation of the TCGA database revealed that patients with unaltered expression of NHE9 (71.4% of 91 GBM cases) survived longer with the difference in maximal survival between these patients of 65 months (Fig. 1b; P=0.032; log-rank test). In addition, patients with unaltered expression of NHE9 remained disease free for a median period of 8.4 months after tumour resection. In contrast, NHE9 upregulation (28.6% of 91 GBM cases) correlated with significantly shorter disease-free periods with a median of only 4.8 months (Supplementary Fig. 1B; P=0.012; log-rank test). A more thorough examination of the TCGA data set including a subset of patients who received neoadjuvant chemotherapy, which included temozolomide (>50% cases), PCV (procarbazine, CCNU and vincristine) and others, revealed that patients with unaltered expression of NHE9 showed strikingly better response and survived longer with a median survival of 58.68 months, in contrast to 15.98 months in patients with NHE9 upregulation (Fig. 1c; P=0.000002; log-rank test). Furthermore, patients with unaltered expression of NHE9 with neoadjuvant chemotherapy remained disease free after resection for a median period of 33.67 months, in comparison with 11.28 months in patients with NHE9 upregulation (Supplementary Fig. 1C; P=0.00295; log-rank test). The finding that NHE9 confers resistance to treatment is strengthened by a recent study demonstrating that patients with oesophageal squamous cell carcinomas (ESCCs) with NHE9 upregulation showed poor response to neoadjuvant chemoradiotherapy¹⁷. Taken together, the observations suggest that NHE9 expression levels may have a role in GBM prognosis.

**Figure 1: NHE9 expression in glioblastoma affects patient survival, chemoradiation resistance and tumour stem cell proliferation.**

Based on these initial observations, we evaluated NHE9 transcript levels in three clinical GBM specimens (GBM 612, GBM 253 and GBM 276; Supplementary Table 1), cultured in serum-free conditions to enrich for BTIC that maintain phenotype and genotype characteristics of the original tumour. NHE9 expression, similar to that of CD133 (ref. 15), was associated with stem/progenitor characteristics, as seen by a significant decrease in transcript on culturing GBM 612 in serum (Fig. 1d. No transcriptional change was observed for the closely related isoform NHE6 after transfer to serum. Comparative analysis of three early-passage BTIC lines derived from patient tumours showed a 19.4-fold variation in NHE9 transcript levels (GBM 276<GBM 253<GBM 612; Fig. 1e), consistent with the variation observed in database surveys. The correlation of NHE9 levels with higher growth rates in GBM 612 relative to GBM 276 was suggestive of a role in tumour cell proliferation (Fig. 1f). To test this hypothesis, we engineered lentiviral-mediated elevation of NHE9 in GBM 276 and, conversely, attenuated NHE9 transcripts in GBM 612 as shown Fig. 1g. No compensatory changes in mRNA levels were observed in the related endosomal isoform NHE6 or V-ATPase subunit V_OA₁ in these cells (Fig. 1g). Consistent with a role for NHE9 in tumour cell proliferation, growth rates in GBM 276 cells overexpressing NHE9 were significantly higher than vector-transfected control cells (Fig. 1h). Conversely, knocking down NHE9 expression decreased cell proliferation in GBM 612 cells (Fig. 1i). These findings were replicated under both normoxia and hypoxia conditions (Supplementary Fig. 2A–D). We note that cell viability remained unaltered by introduction or knockdown of NHE9 (Supplementary Fig. 2E). Therefore, we conclude that NHE9 levels regulate proliferation of BTIC in vitro.

NHE9 promotes GBM tumorigenesis and invasion

Next, we evaluated in vivo effects of widely differing NHE9 expression in two human glioblastomas, GBM 276 (Fig. 2a,b) and GBM 612 (Fig. 2c,d), using intracranial xenograft transplants in a nude mouse model (Fig. 2e). Following silencing of NHE9 in GBM 612 (GBM 612 NHE9-), tumour area in implants was visibly reduced relative to vector-transfected control (Fig. 2f,g). These differences were quantitatively significant by an average of ~2.2-fold (Fig. 2h; P=5.3 × 10⁻⁶; two-tailed Welch’s t-test). Overexpression of NHE9 in GBM 276 (GBM 276 NHE9+) resulted in a significant increase in tumour size (~2-fold on average; P=6.1 × 10⁻⁵; two-tailed Welch’s t-test) relative to the vector-transfected control (Fig. 2i and Supplementary Fig. 3). Invasive capacity was assessed from the number of cells migrating into the contralateral hemisphere, as described previously². Similar to the observations with tumour size, there was a significant reduction of tumour cell invasion following NHE9 silencing in GBM 612 (P=0.0025; two-tailed Welch’s t-test) and increased invasion with NHE9 overexpression in GBM 276 (P=0.0003; two-tailed Welch’s t-test; Fig. 2j,k) when we analysed cell migration in vivo. Together, both in vitro and in vivo findings confirm a critical role for NHE9 in tumour progression.

**Figure 2: Altering NHE9 expression in GBM BTICs affects tumour proliferation and invasion *in vivo*.**

NHE9 drives GBM BTIC migration

The diffuse and aggressive infiltration of tumour cells along vascular and white matter tracts is directly responsible for the inefficacy of tumour resection, resulting in mean survival times of only 12–15 months. Central to the invasiveness associated with glioblastomas, as observed in Fig. 2, are tumour cell–substratum interactions and subsequent modification of matrix barriers. In vivo, tumour cells interact with the extracellular matrix in the nanometre scale¹⁸ and respond to topographical cues that affect cell adhesion and gene expression. To study BTIC migration in vitro under conditions of GBM dissemination^2,18,19,20, we conducted directional migration assays on nano-ridges constructed of transparent polyurethane acrylate coated with laminin (Fig. 3a) as previously reported by our group². These longitudinal tracts closely mimic mechanical cues found in extracellular matrix such as capillaries and nerve fibre tracts along which tumour cells migrate. Biased migration along the grooves was quantified using time-lapse microscopy for a period of 15 h at regular intervals of 15 min in GBM pairs 276 and 612, with NHE9 overexpressed or silenced, respectively. Phase-contrast images of a representative 2-h period for GBM 276 and GBM 276 NHE9+ is shown in Fig. 3b. Quantification of cell speed over time for each population (Fig. 3c,d) and the total average cell speed (Fig. 3e–g) revealed that elevation of NHE9 expression in GBM 276 increased migration speed and consequently distance travelled, whereas attenuation of the high expression of NHE9 in GBM 612 had the converse effect, consistent with the invasion trends observed in mouse xenografts. Next, we evaluated specific parameters of migratory behaviour likely to contribute to invasive ability. Migration alignment, which is the ratio of cell movement parallel to the patterned ridges to that perpendicular to the pattern (Fig. 3h), correlated with migration speed and a significant change in alignment was observed on attenuation of NHE9 in GBM 612 cells (Fig. 3i,j). Migration persistence, ratio of the actual distance travelled by the cell to the shortest distance between the initial and final points (Fig. 3k), was also significantly affected by changes in NHE9 expression in both the GBM lines (Fig. 3l,m). Thus, multiple parameters confirm that NHE9 regulates tumour cell migration in brain cancer.

**Figure 3: GBM BTIC migration on a nanopatterned substrate is affected by NHE9.**

NHE9 modulates endosomal pH and trafficking

As a starting point to decipher the mechanistic basis for tumour promotion, we focused on GBM 253, in which NHE9 expression was intermediate between GBM 276 and GBM 612 BTIC (Fig. 1e). Ectopic expression of NHE9 in GBM 253 significantly increased cell proliferation (Supplementary Fig. 4A), consistent with results from Fig. 1. We showed that NHE9-GFP partly co-localized with EEA1 (Supplementary Fig. 5A,B) and Rab 11 (Fig. 4a,b), markers for early and recycling endosomes, respectively, in GBM 253. We did not observe co-localization of NHE9-GFP with lysobisphosphatidic acid, a marker for late endosomes (Supplementary Fig. 5C,D). Lack of co-localization with endoplasmic reticulum marker and protein-folding chaperone BiP suggested that NHE9 protein processing was not defective in GBM (Supplementary Fig. 5E,F). Therefore, we concluded that NHE9 localization in tumour cells was similar to that observed in normal, primary murine astrocytes⁶. Furthermore, NHE9-GFP co-localized with endocytosed transferrin tagged to Alexa Fluor-633, both in the perinuclear region and in the periphery of the cell (Fig. 4c), also seen in orthogonal section (Fig. 4d). We monitored steady-state accumulation of transferrin (Fig. 4e) and noted that NHE9-GFP expression in GBM 253 cells was accompanied by increased accumulation of Tfn-Alexa Fluor 633, relative to green fluorescent protein (GFP)-transfected controls, as measured by flow cytometry (Fig. 4f,g) and confocal microscopy (Fig. 4h,i). To determine whether increased transferrin accumulation (Fig. 4j) was dependent on Na⁺/H⁺ exchange activity and not a nonspecific effect of gene overexpression, we evaluated the effect of previously described autism-associated loss-of-function mutations in NHE9 (refs 6, 8). Single amino-acid substitutions in conserved regions of mammalian NHE9, L236S and S438P (Fig. 4l) were generated and introduced into GBM 253 cells. Mutant NHE9 (S438P) failed to increase cell proliferation, in contrast to wild-type control (Supplementary Fig. 4B). Similar to the wild-type control, loss-of-function NHE9 mutants also co-localized with Tfn-Alexa Fluor 633 (Supplementary Fig. 5G,H), but failed to elevate Tfn-Alexa Fluor 633 accumulation (Fig. 4k). Therefore, we concluded that ion transport activity by NHE9 alters transferrin trafficking in GBM cells.

**Figure 4: NHE9 localizes to recycling endosomes and alters transferrin uptake.**

NHE9 is proposed to function as a leak pathway for protons, limiting the acidification of the endosomal lumen by the proton pumping V-ATPase⁶. Therefore, high levels of NHE9 should make the endosomal lumen more alkaline, via cation/proton exchange activity. To measure endosomal pH (pH_e), we took advantage of co-localization of NHE9 with transferrin, as shown in Fig. 4c,d. Luminal pH was quantified by a ratiometric method using pH-sensitive fluorescence of fluorescein isothiocyanate (FITC)-tagged transferrin, normalized for differences in endosomal uptake with pH-insensitive fluorescence of Alexa Fluor-633 linked to transferrin (Fig. 5a) and calibrated using buffers of known pH (Fig. 5b). Expression of NHE9 in GBM 253 cells resulted in >1 pH unit elevation of pH_e from 5.71±0.23 to 6.90±0.47 (Fig. 5c). In contrast, there was no significant change in cytoplasmic pH (Supplementary Fig. 4C,D), as has been previously reported for the closely related endosomal isoform NHE6 (ref. 21). To establish a causal link between compartmental pH and trafficking of transferrin, we evaluated a known alkalinizing agent, monensin, which also mediates Na⁺/H⁺ exchange activity. Luminal pH_e in GBM 253 cells treated with monensin (500 μM) was also elevated (to 7.02±0.20), similar to cells expressing NHE9 (Fig. 5c). We observed dose-dependent increase in steady state Tfn-Alexa Fluor 633 accumulation with monensin (Fig. 5d). Next, we compared the effect of monensin and NHE9 overexpression on the kinetics of transferrin uptake and efflux. NHE9 overexpression increased the rate and steady-state levels of transferrin accumulation, whereas it had no effect on the rate of efflux (Fig. 5e–h). In contrast, the increase in transferrin accumulation observed with monensin treatment was largely due to a decrease in the rate of efflux (Fig. 5e–h). Thus, although both NHE9 and monensin alkalinized endosomal compartments to similar extent, they had distinct effects on transferrin uptake and efflux. It was possible that enhanced transferrin uptake resulting from ectopic expression of NHE9 was the result of elevated surface expression of the transferrin receptor on GBM 253 tumour cells. To test this hypothesis, we observed transferrin-Alexa Fluor 633 bound to GBM 253 cells on ice. Under these conditions, endocytosis was greatly reduced, allowing transferrin receptors present on the cell surface to be visualized. More surface-bound fluorescence was observed in GBM 253 cells transfected with NHE9 (Fig. 5i), consistent with elevated levels of transferrin receptor, which was confirmed by surface biotinylation (Fig. 5j). These findings suggest that NHE9 elevates surface levels of membrane receptors on GBM cells. In summary, we used a variety of experimental approaches, including flow cytometry, confocal microscopy, surface labelling and biotinylation in NHE9-overexpressing or monensin-treated cells, to demonstrate that endosomal Na⁺/H⁺ exchange activity can strongly affect binding and uptake of transferrin at the cell membrane of GBM BTIC. These observations, if extended to other cell surface proteins and growth factor receptors, have the potential to impact oncogenic signalling.

**Figure 5: NHE9 regulates endosomal pH in GBM BTICs and controls transferrin receptor trafficking.**

NHE9 promotes EGFR signalling

A striking and signature feature of GBM is dysregulated EGFR activity, with gene amplification, mutation and alteration in receptor tyrosine kinase pathways driving tumour growth in over 80% of gliomas²². Although EGFR signalling pathways are compelling targets for therapeutic intervention, clinical outcomes for the first generation of anti-EGFR therapeutics have been disappointing in patients with GBM. This lack of efficacy of tyrosine kinase domain inhibitors has been attributed to redundancy in signalling pathways, tumour heterogeneity and mutation-specific differences in inhibitor sensitivity²³. An independent and alternative strategy to inhibiting receptor tyrosine kinase phosphorylation is to downregulate cell surface availability of the receptor by exploiting negative feedback mechanisms known to control the duration and intensity of EGFR signalling. Based on our finding that NHE9 modulated transferrin receptor levels to regulate ligand uptake, we next investigated the effect of NHE9 on EGFR signalling in GBM BTIC. Growth rates of both GBM 276 and GBM 612 were responsive to EGF and were further increased or decreased, respectively, by NHE9 expression or knockdown (Supplementary Fig. 6A,B). Significantly, proliferation was lowest in the absence of EGF and NHE9 expression, suggesting that NHE9 may synergize with EGFR signalling to promote tumour cell growth (Supplementary Fig. 6A,B). EGFR transcript levels were the same in GBM 612 and GBM 276 (Supplementary Fig. 6C). Strikingly, however, plasma membrane expression of EGFR, as determined by surface biotinylation, was nearly threefold higher in the faster growing and more aggressive GBM 612 BTIC, relative to GBM 276 (Supplementary Fig. 6D). These findings suggested that differences in NHE9 expression between the two GBM cell lines were critical in determining surface expression of EGFR. Confirming this hypothesis, pair-wise experiments indicated that elevation of NHE9 expression in GBM 276 significantly increased plasma membrane persistence of EGFR relative to vector-transfected control (Fig. 6a,c). Conversely, transcriptional attenuation of NHE9 in GBM 612 cells significantly decreased surface expression of EGFR (Fig. 6b,d). Consistent with our findings, there was no correlation in gene expression between NHE9 and EGFR in the TCGA data set¹⁴ (Pearson correlation: −0.157, P-value: 0.141, n=91), and the subset of patients with mutations in EGFR (15 of 90 patients) was not associated with changes in survival or in NHE9 expression. Thus, we concluded that NHE9 functions posttranscriptionally to regulate EGFR signalling.

**Figure 6: NHE9 drives EGFR membrane persistence and downstream oncogenic signalling in GBM BTICs.**

Stimulation with EGF triggers receptor endocytosis and lysosomal degradation, resulting in disappearance of ~70% EGFR in GBM 276 cells and ~36.4% in GBM 612 cells within 3 h, in the absence of new protein synthesis (Fig. 6e,g, respectively). These differences in EGFR turnover could be directly linked to NHE9 levels. Thus, elevated expression of NHE9 in GBM 276 limited EGFR degradation to ~15%, whereas attenuation of NHE9 expression in GBM 612 tumour cells greatly enhanced EGFR turnover by ~96.4% of initial levels, within 3 h (Fig. 6f,i and h,j, respectively). Next, we investigated the impact of altered NHE9 expression on EGFR signalling in GBM BTIC. NHE9 knockdown in GBM 612 decreases phosphorylation of EGFR (Fig. 6k,l) and key downstream signalling components that mediate tumour proliferation and invasion, including ERK, Cyclin D and AKT (Fig. 6m). Consistent with these findings, increased NHE9 expression in GBM 276 cells resulted in increased activation of the EGFR signalling pathway (Supplementary Fig. 6E).

Receptor sorting and degradation are dependent on acidic luminal pH in the endo-lysosomal system. We measured endosomal pH, as described for GBM 253 in Fig. 5, in GBM 276 and GBM 612. As predicted, pH_e correlated with NHE9 expression in the three GBM cell lines. GBM 276, showing lowest NHE9 levels, also had lowest endosomal pH (5.57±0.13), whereas GBM 612, which had the highest NHE9 levels, had the highest pH_e (6.88±0.13). Furthermore, ectopic expression of NHE9 in GBM 276 significantly alkalinized pH_e (6.61±0.21; P=0.023) and knockdown of NHE9 in GBM 612 resulted in corresponding acidification (to 6.63±0.095; P=0.049). Together, these data indicate that dysregulation of EGFR signalling by NHE9-mediated endosomal pH regulation could be one of the critical mechanisms leading to tumour progression.

Therapeutic potential of NHE9 inhibition

To explore the potential of NHE9 as a therapeutic target in a subset of GBMs, we first tested the effect of NHE inhibitors on GBM BTIC proliferation. The amiloride analogue 5-(N-ethyl-N-isopropyl) amiloride (EIPA) is a general NHE inhibitor²⁴. The IC₅₀ for EIPA was 100 μg ml⁻¹ for GBM 276 tumour cells and increased by 20% following overexpression of NHE9 (Fig. 7a), consistent with NHE9 being a target for EIPA. We also observed dose-dependent reversal of the NHE9-mediated increase in transferrin uptake in GBM 253 cells by EIPA (Supplementary Fig. 7A). Lower doses of EIPA, sufficient to inhibit NHE1, failed to inhibit growth of GBM 276 or reverse NHE9-mediated increase in cell proliferation (Supplementary Fig. 7B). Overexpression of NHE9 greatly decreased the efficacy of Erlotinib, a known tyrosine kinase inhibitor of EGFR. Addition of EIPA (100 μg ml⁻¹) effectively reversed the drug resistance conferred by NHE9, decreasing IC₅₀ for erlotinib from 52 to 31 μg ml⁻¹ relative to that of the control GBM 276 cells, 17 μg ml⁻¹ (Fig. 7b). Similarly, treatment with EIPA improved inhibition of GBM 612 cells by Erlotinib (Supplementary Fig. 7C). We show that EIPA reduces EGFR expression in GBM 612 BTIC on addition of EGF (Fig. 7c,d), consistent with the increased efficacy of Erlotinib following EIPA treatment. U0126, a known mitogen-activated protein kinase (ERK1/2) inhibitor, also decreased the cell proliferation in GBM 276 cells overexpressing NHE9 (Supplementary Fig. 7D), suggesting that the proliferation effects of NHE9 in these GBM cells were partly mediated by mitogen-activated protein kinase signalling, a major effector pathway in the EGFR network.

**Figure 7: NHE inhibitor EIPA mitigates resistance to Erlotinib, EGFR persistence and tumoursphere formation in GBM BTICs.**

Renewable tumoursphere formation (Fig. 7e) is associated with tumorigenic capacity and rapid tumour progression, and is a significant predictor of clinical outcome²⁵. Knockdown of NHE9 in GBM 612 cells reduced the number of tumourspheres by ~1.6-fold compared with control cells (Fig. 7f,h,i). The diameter of the tumourspheres was also reduced by ~3.3-fold (Fig. 7g–i). Treating GBM 612 cells with 100 μg ml⁻¹ of EIPA drastically reduced both the number and diameter of tumourspheres by ~7-fold (Fig. 7f–h,j). Although the EIPA effects could include non-selective inhibition of other NHE isoforms besides NHE9, our results support the therapeutic potential of NHE9 as a drug target for a subset of GBM expressing elevated NHE9 levels. In such cases, bimodal therapy with known EGFR inhibitors could be an effective therapy.

Discussion

A common pathophysiological hallmark of tumours is a perturbation in pH dynamics²⁶. Oncogene-mediated elevation of cytoplasmic pH by constitutive activation of NHE1 and ensuing extracellular acidification have long been recognized as an early step in neoplastic transformation driven by ras and c-mos^27,28. In contrast, the role of endosomal pH modulation in oncogenesis has not been studied, although there is emerging evidence implicating organellar Na⁺/H⁺ exchangers in various cancers. In hypermutated colorectal tumours, SLC9A9, the gene encoding NHE9, was found to be among the most frequently mutated targets along with ACVR2A, APC, TGFBR2, MSH3, MSH6 and TCF7L2 (ref. 29). Consistent with this finding, a genome-wide scan for colorectal cancer susceptibility identified linkage to chromosome 3q, with SLC9A9 being one of the candidate genes³⁰. Furthermore, a genome-wide case–control study of ESCC including 300 ESCC cases and 300 matched controls discovered significant associations of single-nucleotide polymorphisms in SLC9A9 with ESCC risk³¹. The link between NHE9 and ESCC is strengthened by a recent study demonstrating that patients with ESCC with NHE9 downregulation (>2-fold) showed complete response to neoadjuvant chemo-radiotherapy¹⁷. Despite these clinical and genetic links, the molecular role of NHE9 in carcinogenesis was previously unknown. There has been one report showing that ectopic expression of NHE7, a closely related isoform of NHE9 that localizes to the trans-Golgi network, increased tumorigenicity in a breast cancer cell line³². Although the underlying mechanisms were not investigated, the study showed that whereas tumour invasion was enhanced by both NHE1 and NHE7, only NHE7 could promote anchorage-independent growth and cell adhesion.

There is new evidence from model organisms as well as mammalian cells that luminal pH in the secretory-endosomal pathway is set by a balance of proton pump and leak, and is critical for normal vesicle trafficking (Fig. 8a)^33,34,35. Although the importance of the H⁺ pumping V-ATPase is firmly established, we are only beginning to appreciate the complementary role of eNHE as a H⁺ leak pathway for the precise tuning of luminal pH. Pathophysiological elevation or loss of NHE9 activity is associated with glioblastoma (this study) or autism^6,7, as a consequence of excessive luminal alkalization and acidification, respectively (Fig. 8a). Early endosomes transit through a series of increasingly acidic compartments, culminating with delivery and degradation of cargo at the lysosome (Fig. 8b, left panel). Luminal pH affects the fate of cargo, both by modulating acid-activated hydrolases and by directing vesicle traffic through one of the several routes. Thus, premature activation of vacuolar acid hydrolases in the yeast mutant lacking the eNHE orthologue, NHX1, results in degradation of chaperone protein VPS10 in the prevacuolar compartment and missorting of cargo to the extracellular medium³⁶. Similarly, enhanced turnover of EGFR resulting from silencing or inhibition of NHE9 may be due to acidification of the endolysosomal system and activation of acid hydrolases. On the other hand, receptors may escape degradation by recycling back to the plasma membrane instead of being sorted to the late endosome/lysosome (Fig. 8b; right panel). We show that elevated levels of plasma membrane receptors seen in NHE9-overexpressing GBM cells greatly enhance Alexa Fluor-labelled transferrin uptake by TfnR-mediated endocytosis and downstream signalling from EGFR.

**Figure 8: Model for endosomal pH regulation by NHE9 and its affect on the downstream EGFR network.**

The EGFR signalling network is a powerful driver of glioblastoma³⁷. Ligand-bound EGFR not only activates intracellular tyrosine kinases directly but synergistically transactivates other cell surface receptors to ignite signalling cascades that control cell proliferation, invasion and apoptosis. Yet, despite the importance of EGFR signalling, multiple clinical trials using EGFR kinase inhibitors have had disappointing clinical outcomes due to their lack of tumour cytotoxicity. Although kinase inhibition of EGFR results in decreased cell proliferation, cell death appears to require the loss of EGFR protein, consistent with vastly different in vivo phenotypes of EGFR knockout and mutants with greatly attenuated kinase activity^38,39. The resistance of GBM to EGFR kinase inhibitors has been attributed to a host of confounding factors, including activation of compensatory pathways, constitutively active mutations and kinase-independent prosurvival roles of EGFR. For example, EGFR protects cancer cells from autophagic death by stabilizing the active glucose transporter SGLT1, independent of its kinase function⁴⁰. There is growing realization that targeting EGFR for degradation could be a more effective strategy than inhibiting kinase activity. Recently, it was shown that depletion or inhibition of a dual specificity tyrosine phosphorylation-regulated kinase, DYRK1A, targets EGFR for lysosomal degradation, severely compromising self-renewal ability of GBM BTIC⁴¹. Similarly, the tumour suppressor Mig-6 protein recruits internalized EGFR to the late endosome for eventual lysosomal degradation, by association with the SNARE protein STX8 (ref. 42). Another example is that of LRIG, a transmembrane protein that controls CBL recruitment and EGFR downregulation, found to be attenuated in many glioblastomas^43,44. Taken together, several independent studies have borne out that EGFR membrane persistence is key to oncogenic activity.

Resveratrol, a potent SIRT1 activator, has anti-tumour property⁴⁵. Treatment of GBM BTIC with resveratrol showed significant downregulation of NHE9 that is associated with reduced tumorigenicity and enhanced radiosensitivity⁴⁶. In this context, it is worth noting that NHE9 is a known SIRT1 (sirtuin 1)-associated gene and is repressed with SIRT1 activation⁴⁷. We show that increased NHE9 expression in a subset of GBM patients decreases survival and promotes membrane persistence of multiple glial receptors and transport proteins, including EGFR, TfR (this study) and glutamate transporter⁶. As multiple receptor tyrosine kinases are co-activated in GBM⁴⁸, we propose that endosomal NHE9 exerts pan-specific control over plasma membrane receptor density. Previous studies using three-dimensional multi-scale brain tumour models suggest that a high EGFR density triggers the phenotypic switch between proliferation and migration early in the development of aggressive gliomas^49,50. Further, the simulations indicate that spatio-temporal expansion of glioblastoma depends largely on posttranslational events, and that malignancy cannot be determined by monitoring gene expression data alone. Our findings validate these predictions: although EGFR transcript levels were the same, the more aggressive GBM 612 tumour had much higher plasma membrane levels of EGFR protein relative to the slower growing and less invasive GBM 276 cells. We show that high levels of NHE9 correlate with increased receptor density by ensuring membrane persistence of EGFR irrespective of transcript levels, and that manipulating NHE9 expression or activity has profound effect on brain tumour stem cell renewal, proliferation and invasion. We note that membrane transport proteins are eminently ‘druggable’ and have been successfully targeted by blockbuster drugs (Prozac, Prilosec and Lasix, to name a few). Pharmaceutical companies have already developed cardioprotective drugs against NHE1, another isoform in the NHE family. Our findings highlight an urgent need to screen for high affinity, selective NHE9 inhibitors that could be used in conjunction with receptor tyrosine kinase inhibitors to enhance receptor clearance as an effective treatment for glioblastoma.

Methods

GBM cell cultures

All glioblastoma tumour samples were obtained with written informed consent from patients through the Department of Neurosurgery, Johns Hopkins Hospital (Baltimore, MD), following Institutional Review Board guidelines and as previously described^2,51,52. Patient tumour grade and type was determined by a neuropathologist (Supplementary Table 1). Culture conditions were in a 5% CO₂ incubator at 37 °C as follows: GBM 253 primary glioblastoma cells were subcultured in DMEM/F12 (1:1) Nutrient Mixture, 10% fetal bovine serum (Invitrogen) and 1% HyClone Antibiotic Antimycotic Solution (Thermo Scientific). GBM 276 and GBM 612 glioblastoma stem cells were cultured in one of two ways: (1) as serum-free cultures on laminin and poly-L-ornithine-coated plates⁵³ using StemPro NSC SFM (Invitrogen) without EGF, or (2) as tumoursphere cultures with EGF (20 ng ml⁻¹). EGF was only added to adherent cell cultures during experimental procedures.

Plasmids

Full-length mNHE9-EGFP was cloned into FuGW lentiviral vector as previously described⁶. Quik-Change-Site-Directed Mutagenesis Kit was used to make all point mutations (Stratagene). HsNHE9 short hairpin RNA (shRNA) sequence (5′- CCGGCCCTCCATTAAGGAGAGTTTTTCAAGAGAAAACTCTCCTTAATGGAGGTTTTTC -3′) and control shRNA sequence (Sigma-Aldrich) (5′- CAACAAGATGAAGAGCACCAA -3′) were cloned into pLKO.1 lentiviral vector with a puromycin-selectable marker.

Construction of lentiviruses and cell transduction

pCMV-dR8.9 and pMD2.G packaging plasmids were co-transfected with pLKO.1-NHE9 shRNA in HEK293 cells for 48 h. FuGW mNHE9-EGFP was co-transfected 1:1 with 2nd Generation Packaging Mix (ABM) into HEK293 cells according to manufacturer’s instructions. Virus was collected 48 and 72 h after transfection and Lenti-X Concentrator (Clontech) was added to concentrate lentiviral stocks. Glioblastoma cells infected with shRNA constructs were incubated with virus for 48 h and selected with puromycin (0.75 μg ml⁻¹). GBM cells infected with mNHE9-EGFP virus were assayed 72 h after infection.

Quantitative PCR analysis

mRNA was isolated from cell cultures using the RNeasy Mini kit (Qiagen), following the manufacturer’s instructions, and optional RNA treatment with DNase I (Roche) was done. Complementary DNA was synthesized using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems, 4387406), following the manufacturer’s instructions. Quantitative real-time PCR analysis was performed using the 7500 Real-Time PCR System (Applied Biosystems) using Taqman Fast universal PCR Master Mix (Applied Biosystems, 4352042). Taqman gene expression assay probes used were Hs00234723_m1 (SLC9A6/NHE6), Hs00543518_m1 (SLC9A9/NHE9), Hs00184593_m1 (ATP6AP1/V-ATPase subunit), Hs01076078_m1 (EGFR), Hs01009250_m1 (PROM1/CD133), Hs99999901_s1 (18S RNA) and Hs02758991_g1 (GAPDH). Each experiment was performed with following quantitative PCR cycling conditions: 2 min at 50 °C, 10 min at 95 °C, then 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Ct values were used for all manipulations and were first normalized to endogenous control levels by calculating the ΔCt for each sample. Values were then calculated relative to control, to generate a ΔΔCt value. Fold change was calculated using the equation: expression fold change=2^−ΔΔCt. Three technical replicates of three independent (biological) replicates were run to account for assay variance.

Cell proliferation assay

Cell growth was monitored using the Celltiter 96 Aqueous One Solution Cell Proliferation Assay (MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium), Promega), which is based on metabolic activity as a proxy for cell number⁵⁴. Briefly, 0.5 × 10⁴ cells were seeded, in triplicate, into a 96-well plate. At each time point, 20 μl of Celltiter 96 Aqueous One Solution reagent was added to each well and incubated for 2 h at 37 °C. The absorbance was measured at 490 nM using a 96-well plate reader and normalized to D1.

Intracranial GBM injections and immunohistochemistry

All animal protocols were approved by the Johns Hopkins Animal Care and Use Committee. In vivo tumorigenesis and invasion of cells expressing either NHE9-GFP or NHE9 shRNA were assayed in 4- to 6-week-old nude/athymic, male mice (NCr-nu/nu, NCI) using a previously described brain tumour model⁵⁵. Briefly, a total of 150,000 cells were injected into the right hemisphere of the mouse brains (coordinates X1.5, Y1.34, Z3.5 relative to bregma). Each experimental group had eight animals each. Animals dying before the termination of the experiment were excluded from the analysis. Mice were killed 8 weeks after injection, and fixed and stained as previously described². Briefly, mice were subjected to a transcardiac perfusion using 4% paraformaldehyde as fixative. Dissected brain were postfixed overnight at 4 °C in the same fixative, embedded in OCT compound (Tissue-Tek), frozen at −80 °C and sectioned. Then, cryosections were stained with an antibody against human nuclei (mouse monoclonal IgG1, 1:250, Millipore) and were imaged to calculate tumour size and invasiveness by morphometric analysis using Image J (NIH). The slides were randomized, coded in a blinded manner and counted to prevent observer bias.

Nanopatterned cell migration and quantitative analysis

GBM cell migration was assessed and analysed using a previously described directional migration assay². Briefly, nanogrooved substrates made of transparent polyurethane acrylate were constructed using ultraviolet-assisted capillary lithography. The nanopatterned surface was coated with laminin and cell migration was quantified using time-lapse microscopy. Observation was done using a Cascade 512B II CCD camera equipped to an Olympus IX81 inverted microscope in a chamber controlled for temperature and environmental factors. Phase-contrast cell images were recorded automatically under × 10 objective for 15 h at 15-min intervals using Slidebook 4.1 (Intelligent Imaging Innovations).

A previously designed custom MATLAB script was used to allow manual tracking of cells frame-by-frame. Beginning from the centre of the cell body, average individual cell speed was calculated from a cell trajectory tracing the centroid position between intervallic images recorded within the 15-h duration. Cell persistence was calculated by fractioning the shortest distance between the start and end point of a given cell’s centroid position over the total distance travelled. Cell alignment to the nanopatterned substratum was calculated by fractioning the distance moved parallel over the distance moved perpendicularly to the ridges. All analysis were stopped in the case of an abnormal event (cell death, division and so on) and not used in the final average calculations. All averages were calculated using a minimum of 75 cell trajectories.

Immunofluorescence

Cultured GBM cells on coverslips were pre-extracted with PHEM buffer (60 mM PIPES, 25 mM HEPES, 10 mM EGTA and 2 mM MgCl₂, pH 6.8) containing 0.025% saponin for 2 min, then washed twice for 2 min with PHEM buffer containing 0.025% saponin and 8% sucrose. The cells were fixed with a solution of 4% paraformaldehyde and 8% sucrose in PBS for 30 min at room temperature, and blocked with a solution of 1% BSA and 0.025% saponin in PBS for 1 h. Primary antibodies were diluted 1:100 in 1% BSA and incubated with cells 1 h or overnight. Alexa Fluor 568 goat anti-rabbit IgG and Alexa Fluor 568 goat anti-mouse IgG (both Invitrogen) were used at 1:1,000 dilution for 30 min. Cells were mounted onto slides using Dako Fluorescent Mounting Medium and were imaged using a Zeiss LSM510-Meta confocal microscope.

pH measurement and transferrin uptake

Cells were rinsed and incubated in serum-free medium for 30 min, to remove any residual transferrin. Later on, cells were exposed to 100 μg ml⁻¹ transferrin conjugated to Alexa Fluor 633 (Invitrogen) for imaging or flow cytometry, or to 100 μg ml⁻¹ transferrin conjugated to pH-sensitive FITC (75 μg ml⁻¹) and pH non-sensitive Alexa Fluor 633 (25 μg ml⁻¹) (Invitrogen) for pH measurement at 37 °C for 55 min. Transferrin uptake was stopped by chilling the cells on ice. External transferrin was removed by washing with ice-cold serum-free DMEM and PBS, whereas bound transferrin was removed by an acid wash in PBS at pH 5.0 followed by a wash with PBS at pH 7.0. Surface-bound transferrin (<5% to total) was determined with a parallel sample incubated on ice and was used for background subtraction. The fluorescence intensity of internalized transferrin was measured for at least 5,000 cells by flow cytometry using the FACSAria (BD Biosciences) instrument and the average intensity of the cell population was recorded⁶.

For transferrin endocytosis and exocytosis measurements, cells on coverslips were rinsed and incubated in serum-free medium for 30 min and then exposed to 100 μg ml⁻¹ transferrin conjugated with Alexa Fluor 633 for varying amounts of time. Washes were done accordingly (as described) and cells were mounted onto slides using Dako Fluorescent Mounting Medium. Fluorescence microscopy images were acquired with a Photometrics CoolSNAP FX digital camera and processed using Scanalytics IPLab software and Adobe Photoshop CS2 software. Internal fluorescence was quantified using ImageJ software, n=100, for each time point for each experiment. Exocytosis was measured as a loss of fluorescence at various time points similarly.

The surface-binding assay was carried out similarly. Cells on coverslips were rinsed and incubated in serum-free medium for 30 min and then exposed to 100 μg ml⁻¹ transferrin conjugated with Alexa Fluor 633 in 1% BSA solution on ice for 2 min, followed by subsequent washes with PBS at pH 7.0. Cells were mounted on slides and imaged on a Zeiss LSM510-Meta confocal microscope.

Cytoplasmic pH was measured using flow cytometry as previously described⁵⁶. Briefly, cells were incubated with 1 μM BCECF-AM (Life Technologies) for 30 min at 37 °C, and pH was determined by excitation at 488 nm and emissions filtered through 530 (±15) nm (pH-sensitive green fluorescence) and 616 (±12) nm (pH non-sensitive red fluorescence) filters. A pH calibration curve was generated by preloading cells with 1 μM BCECF-AM for 30 min followed by incubation in a ‘high K⁺’ HEPES buffer (25 mM HEPES, 145 mM KCl, 0.8 mM MgCl₂, 1.8 mM CaCl₂, 5.5 mM glucose), whose pH was adjusted to different values (6.6, 7.0, 7.4 and 7.8) and used to prepare a four-point calibration curve in the presence of K⁺/H⁺ ionophore nigericin (10 μM).

Protein turnover and western blotting

Cells were lysed with Nonidet P-40 (1%, Sigma) that included protease inhibitor cocktail (Roche) and then centrifuged for 15 min at 14,000 r.p.m. at 4 °C. Cell protein lysates (50–100 μg) were dissolved in loading buffer (62.5 mM Tris-HCl pH 6.8, 10% glycerol, 2% SDS, 0.01% Bromophenol Blue, 100 mM dithiothreitol) and separated by SDS–PAGE. Antibodies used for western blotting were as follows: Tf Receptor (Abcam ab38171, 1:250); EGFR (Millipore 06-847, 1:250); p-EGFR, Tyr1068 (Cell Signaling 2234, 1:1,000); ERK1/2 (Sigma M 5670, 1:2,000); pERK1/2, Thr183 (Sigma M 7802, 1:500); Cyclin D1 (Sigma C 7464, 1:200); AKT (Cell Signaling 9272, 1:1,000); and pAKT, Ser 473 (Cell Signaling 4056, 1:1,000). Loading controls used were Tubulin (Sigma T 9026, 1:1,000) and GAPDH (Sigma G 9295, 1:20,000).

Cells used for degradation assays were plated at 2.5 × 10⁵ cells per well in a six-well tissue culture dish and allowed to adhere overnight. The following day, cells were growth factor starved for 2 h in the presence of 50 μM cycloheximide (Sigma). These conditions were maintained for the duration of the experiment. Following, 20 ng ml⁻¹ EGF (PeproTech) was added to the media for the indicated amounts of time. Cells were then chilled on ice, washed with PBS and protein lysates were collected for immunoblotting. Blots were cropped to show relevant bands.

Cell surface biotinylation

For surface biotinylation, cell surface proteins were labelled with biotin as previously described⁵⁷. Briefly, cells were washed three times with ice-cold PBS and incubated with 1 mg ml⁻¹ Sulpho-NHS-LC biotin in PBS at 4 °C for 20 min. Excess NHS groups were quenched using 100 mM glycine followed by three washes with PBS. Protein supernatants were mixed with 120 μl of immobilized Neutravidin beads and incubated at 4 °C overnight, with gentle rotation. Beads collected by centrifugation were washed three times with lysis buffer and surface proteins labelled with biotin were separated by SDS–PAGE and analysed by immunoblotting. All blots were cropped to show relevant bands.

Oncomine and CBioPortal data

Primary source for the GBM expression data on NHE9 obtained from Oncomine was from Lee et al.¹⁵ Survival data obtained on the 91 ‘complete’ sequenced tumours through the cBioPortal⁵⁸ were from the Glioblastoma project TCGA data set¹³.

Additional information

How to cite this article: Kondapalli, K. C. et al. A leak pathway for luminal protons in endosomes drives oncogenic signalling in glioblastoma. Nat. Commun. 6:6289 doi: 10.1038/ncomms7289 (2015).

References

Chaichana, K. L. et al. Factors involved in maintaining prolonged functional independence following supratentorial glioblastoma resection. Clinical article. J. Neurosurg. 114, 604–612 (2011).
Article PubMed Google Scholar
Garzon-Muvdi, T. et al. Regulation of brain tumor dispersal by NKCC1 through a novel role in focal adhesion regulation. PLoS Biol. 10, e1001320 (2012).
Article CAS PubMed PubMed Central Google Scholar
Agudelo-Garcia, P. A. et al. Glioma cell migration on three-dimensional nanofiber scaffolds is regulated by substrate topography and abolished by inhibition of STAT3 signaling. Neoplasia 13, 831–840 (2011).
Article CAS PubMed PubMed Central Google Scholar
Stupp, R. et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N. Engl. J. Med. 352, 987–996 (2005).
Article CAS PubMed Google Scholar
Watkins, S. & Sontheimer, H. Unique biology of gliomas: challenges and opportunities. Trends Neurosci. 35, 546–556 (2012).
Article CAS PubMed PubMed Central Google Scholar
Kondapalli, K. C. et al. Functional evaluation of autism-associated mutations in NHE9. Nat. Commun. 4, 2510 (2013).
Article PubMed Google Scholar
Kondapalli, K. C., Prasad, H. & Rao, R. An inside job: how endosomal Na+/H+ exchangers link to autism and neurological disease. Front. Cell. Neurosci. 8, 172 (2014).
Article PubMed PubMed Central Google Scholar
Morrow, E. M. et al. Identifying autism loci and genes by tracing recent shared ancestry. Science 321, 218–223 (2008).
Article ADS CAS PubMed PubMed Central Google Scholar
Di Domenico, F. et al. Expression of human papilloma virus type 16 E5 protein in amelanotic melanoma cells regulates endo-cellular pH and restores tyrosinase activity. J. Exper. Clin. Cancer Res. 28, 4 (2009).
Article Google Scholar
Suprynowicz, F. A. et al. The human papillomavirus type 16 E5 oncoprotein inhibits epidermal growth factor trafficking independently of endosome acidification. J. Virol. 84, 10619–10629 (2010).
Article CAS PubMed PubMed Central Google Scholar
Chakravarti, A., Dicker, A. & Mehta, M. The contribution of epidermal growth factor receptor (EGFR) signaling pathway to radioresistance in human gliomas: a review of preclinical and correlative clinical data. Int. J. Radiat. Oncol. Biol. Phys. 58, 927–931 (2004).
Article CAS PubMed Google Scholar
Rhodes, D. R. et al. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 6, 1–6 (2004).
Article CAS PubMed PubMed Central Google Scholar
Network, T. C. Corrigendum: Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 494, 506 (2013).
Article ADS PubMed Google Scholar
Cancer Genome Atlas Research Network, Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 455, 1061–1068 (2008).
Article Google Scholar
Lee, J. et al. Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum-cultured cell lines. Cancer Cell 9, 391–403 (2006).
Article CAS PubMed Google Scholar
Verhaak, R. G. et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 17, 98–110 (2010).
Article CAS PubMed PubMed Central Google Scholar
Wen, J. et al. Gene expression analysis of pretreatment biopsies predicts the pathological response of esophageal squamous cell carcinomas to neo-chemoradiotherapy. Ann. Oncol. 25, 1769–1774 (2014).
Article CAS PubMed Google Scholar
Yim, E. K. et al. Nanopattern-induced changes in morphology and motility of smooth muscle cells. Biomaterials 26, 5405–5413 (2005).
Article CAS PubMed PubMed Central Google Scholar
Giese, A. & Westphal, M. Glioma invasion in the central nervous system. Neurosurgery 39, 235–250 discussion 250-232 (1996).
Article CAS PubMed Google Scholar
Kim, D. H. et al. Mechanosensitivity of fibroblast cell shape and movement to anisotropic substratum topography gradients. Biomaterials 30, 5433–5444 (2009).
Article CAS PubMed PubMed Central Google Scholar
Xinhan, L. et al. Na+/H+ exchanger isoform 6 (NHE6/SLC9A6) is involved in clathrin-dependent endocytosis of transferrin. Am. J. Physiol. Cell Physiol. 301, C1431–C1444 (2011).
Article PubMed Google Scholar
Brennan, C. W. et al. The somatic genomic landscape of glioblastoma. Cell 155, 462–477 (2013).
Article CAS PubMed PubMed Central Google Scholar
Barkovich, K. J. et al. Kinetics of inhibitor cycling underlie therapeutic disparities between EGFR-driven lung and brain cancers. Cancer Discov. 2, 450–457 (2012).
Article CAS PubMed PubMed Central Google Scholar
Orlowski, J. & Grinstein, S. Diversity of the mammalian sodium/proton exchanger SLC9 gene family. Pflugers Arch. 447, 549–565 (2004).
Article CAS PubMed Google Scholar
Laks, D. R. et al. Neurosphere formation is an independent predictor of clinical outcome in malignant glioma. Stem Cells 27, 980–987 (2009).
Article PubMed PubMed Central Google Scholar
Webb, B. A., Chimenti, M., Jacobson, M. P. & Barber, D. L. Dysregulated pH: a perfect storm for cancer progression. Nat. Rev. Cancer 11, 671–677 (2011).
Article CAS PubMed Google Scholar
Amith, S. R. & Fliegel, L. Regulation of the Na+/H+ exchanger (NHE1) in breast cancer metastasis. Cancer Res. 73, 1259–1264 (2013).
Article CAS PubMed Google Scholar
Reshkin, S. J., Greco, M. R. & Cardone, R. A. Role of pHi, and proton transporters in oncogene-driven neoplastic transformation. Phil. Trans. R. Soc. Lond. B Biol. Sci. 369, 20130100 (2014).
Article Google Scholar
Cancer Genome Atlas, N.. Comprehensive molecular characterization of human colon and rectal cancer. Nature 487, 330–337 (2012).
Picelli, S. et al. Genome-wide linkage scan for colorectal cancer susceptibility genes supports linkage to chromosome 3q. BMC Cancer 8, 87 (2008).
Article PubMed PubMed Central Google Scholar
Ng, D. et al. Replication of a genome-wide case-control study of esophageal squamous cell carcinoma. Int. J. Cancer 123, 1610–1615 (2008).
Article CAS PubMed PubMed Central Google Scholar
Onishi, I. et al. Organellar (Na+, K+)/H+ exchanger NHE7 regulates cell adhesion, invasion and anchorage-independent growth of breast cancer MDA-MB-231 cells. Oncol. Rep. 27, 311–317 (2012).
CAS PubMed Google Scholar
Brett, C. L., Donowitz, M. & Rao, R. Evolutionary origins of eukaryotic sodium/proton exchangers. Am. J. Physiol. Cell. Physiol. 288, C223–C239 (2005).
Article CAS PubMed Google Scholar
Brett, C. L., Wei, Y., Donowitz, M. & Rao, R. Human Na(+)/H(+) exchanger isoform 6 is found in recycling endosomes of cells, not in mitochondria. Am. J. Physiol. Cell. Physiol. 282, C1031–C1041 (2002).
Article CAS PubMed Google Scholar
Nakamura, N., Tanaka, S., Teko, Y., Mitsui, K. & Kanazawa, H. Four Na+/H+ exchanger isoforms are distributed to Golgi and post-Golgi compartments and are involved in organelle pH regulation. J. Biol. Chem. 280, 1561–1572 (2005).
Article CAS PubMed Google Scholar
Bowers, K., Levi, B. P., Patel, F. I. & Stevens, T. H. The sodium/proton exchanger Nhx1p is required for endosomal protein trafficking in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell 11, 4277–4294 (2000).
Article CAS PubMed PubMed Central Google Scholar
Kalman, B., Szep, E., Garzuly, F. & Post, D. E. Epidermal growth factor receptor as a therapeutic target in glioblastoma. Neuromol. Med. 15, 420–434 (2013).
Article CAS Google Scholar
Miettinen, P. J. et al. Epithelial immaturity and multiorgan failure in mice lacking epidermal growth factor receptor. Nature 376, 337–341 (1995).
Article ADS CAS PubMed Google Scholar
Luetteke, N. C. et al. The mouse waved-2 phenotype results from a point mutation in the EGF receptor tyrosine kinase. Genes Dev. 8, 399–413 (1994).
Article CAS PubMed Google Scholar
Weihua, Z. et al. Survival of cancer cells is maintained by EGFR independent of its kinase activity. Cancer Cell 13, 385–393 (2008).
Article PubMed PubMed Central Google Scholar
Pozo, N. et al. Inhibition of DYRK1A destabilizes EGFR and reduces EGFR-dependent glioblastoma growth. J. Clin. Invest. 123, 2475–2487 (2013).
Article CAS PubMed PubMed Central Google Scholar
Ying, H. et al. Mig-6 controls EGFR trafficking and suppresses gliomagenesis. Proc. Natl Acad. Sci. USA 107, 6912–6917 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Mao, F. et al. A role for LRIG1 in the regulation of malignant glioma aggressiveness. Int. J. Oncol. 42, 1081–1087 (2013).
Article CAS PubMed Google Scholar
Ye, F. et al. Upregulation of LRIG1 suppresses malignant glioma cell growth by attenuating EGFR activity. J. Neurooncol. 94, 183–194 (2009).
Article CAS PubMed Google Scholar
Knutson, M. D. & Leeuwenburgh, C. Resveratrol and novel potent activators of SIRT1: effects on aging and age-related diseases. Nutr. Rev. 66, 591–596 (2008).
Article PubMed Google Scholar
Yang, Y. P. et al. Resveratrol suppresses tumorigenicity and enhances radiosensitivity in primary glioblastoma tumor initiating cells by inhibiting the STAT3 axis. J. Cell. Physiol. 227, 976–993 (2012).
Article CAS PubMed Google Scholar
Oberdoerffer, P. et al. SIRT1 redistribution on chromatin promotes genomic stability but alters gene expression during aging. Cell 135, 907–918 (2008).
Article CAS PubMed PubMed Central Google Scholar
Stommel, J. M. et al. Coactivation of receptor tyrosine kinases affects the response of tumor cells to targeted therapies. Science 318, 287–290 (2007).
Article ADS CAS PubMed Google Scholar
Zhang, L., Strouthos, C. G., Wang, Z. & Deisboeck, T. S. Simulating brain tumor heterogeneity with a multiscale agent-based model: linking molecular signatures, phenotypes and expansion rate. Math. Comput. Model. 49, 307–319 (2009).
Article MathSciNet PubMed PubMed Central Google Scholar
Athale, C. A. & Deisboeck, T. S. The effects of EGF-receptor density on multiscale tumor growth patterns. J. Theor. Biol. 238, 771–779 (2006).
Article MathSciNet CAS PubMed Google Scholar
Li, Y. et al. c-Met signaling induces a reprogramming network and supports the glioblastoma stem-like phenotype. Proc. Natl Acad. Sci. USA 108, 9951–9956 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Tzeng, S. Y. et al. Non-viral gene delivery nanoparticles based on poly(beta-amino esters) for treatment of glioblastoma. Biomaterials 32, 5402–5410 (2011).
Article CAS PubMed PubMed Central Google Scholar
Pollard, S. M. et al. Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic screens. Cell Stem Cell 4, 568–580 (2009).
Article CAS PubMed Google Scholar
Riss, T. L. et al. in Assay Guidance Manual eds Gal-Edd N., Sittampalam G. S., Arkin M., Auld D., Austin C., Bejcek B., Glicksman M., Inglese J., Lemmon V., Li Z., McGee J., McManus O., Minor L., Napper A., Riss T., Trask O. J., Weidner J. Eli Lilly & Company and the National Center for Advancing Translational Sciences (2013).
Guerrero-Cazarez, H., Attenello, F., Noiman, L. & Quiñones-Hinojosa, A. Stem Cells in Gliomas Elsevier (2011).
Franck, P. et al. Measurement of intracellular pH in cultured cells by flow cytometry with BCECF-AM. J. Biotechnol. 46, 187–195 (1996).
Article CAS PubMed Google Scholar
Ohgaki, R., Fukura, N., Matsushita, M., Mitsui, K. & Kanazawa, H. Cell surface levels of organellar Na+/H+ exchanger isoform 6 are regulated by interaction with RACK1. J. Biol. Chem. 283, 4417–4429 (2008).
Article CAS PubMed Google Scholar
Gao, J. et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal. 6, pl1 (2013).
Article PubMed PubMed Central Google Scholar

Download references

Acknowledgements

This work was supported by grants from the National Institutes of Health NS070024 (A.Q.H.), and DK054214 and GM62142 (R.R.). K.C.K. was supported by an American Heart Association postdoctoral fellowship (11POST7380034); J.P. received support from the Johns Hopkins PREP program; H.P. was a Fulbright Fellow supported by the International Fulbright Science and Technology Award; and A.H. was a Porter fellow of the American Physiological Society.

Author information

Kalyan C. Kondapalli
Present address: Present address: Department of Natural Sciences, University of Michigan-Dearborn, 4901 Evergreen Road, Dearborn, Michigan 48128, USA,
Vivian Capilla-González
Present address: Present address: Department of Stem Cells, Andalusian Center for Molecular Biology and Regenerative Medicine (CABIMER), Américo Vespucio, s/n, 41092 Seville, Spain,
Kalyan C. Kondapalli and Jose P. Llongueras: These authors contributed equally to this work

Authors and Affiliations

Department of Physiology, The Johns Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, 21205, Maryland, USA
Kalyan C. Kondapalli, Jose P. Llongueras, Hari Prasad, Anniesha Hack & Rajini Rao
Department of Neurosurgery, The Johns Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, 21205, Maryland, USA
Vivian Capilla-González, Christopher Smith, Hugo Guerrero-Cázares & Alfredo Quiñones-Hinojosa

Authors

Kalyan C. Kondapalli
View author publications
You can also search for this author in PubMed Google Scholar
Jose P. Llongueras
View author publications
You can also search for this author in PubMed Google Scholar
Vivian Capilla-González
View author publications
You can also search for this author in PubMed Google Scholar
Hari Prasad
View author publications
You can also search for this author in PubMed Google Scholar
Anniesha Hack
View author publications
You can also search for this author in PubMed Google Scholar
Christopher Smith
View author publications
You can also search for this author in PubMed Google Scholar
Hugo Guerrero-Cázares
View author publications
You can also search for this author in PubMed Google Scholar
Alfredo Quiñones-Hinojosa
View author publications
You can also search for this author in PubMed Google Scholar
Rajini Rao
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

K.C.K. and J.P. conceived and performed all in vitro experiments with GBM 276 and 612; V.C.-G. performed the mouse xenograft experiments; H.P. performed bioinformatics analysis; H.P. and A.H. performed in vitro experiments with GBM 253; J.P., C.S. and H.G.-C. performed BTIC migration on nanopatterned surfaces; K.C.K., J.P. and R.R. wrote the manuscript, with edits from V.C.-G., H.G.-C. and A.Q.-H.; A.Q.-H. and R.R. provided funding and oversight for the project.

Corresponding authors

Correspondence to Alfredo Quiñones-Hinojosa or Rajini Rao.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Information

Supplementary Figures 1-7 and Supplementary Table 1 (PDF 940 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Kondapalli, K., Llongueras, J., Capilla-González, V. et al. A leak pathway for luminal protons in endosomes drives oncogenic signalling in glioblastoma. Nat Commun 6, 6289 (2015). https://doi.org/10.1038/ncomms7289

Download citation

Received: 04 August 2014
Accepted: 12 January 2015
Published: 09 February 2015
DOI: https://doi.org/10.1038/ncomms7289

This article is cited by

IDH1R132H mutation increases radiotherapy efficacy and a 4-gene radiotherapy-related signature of WHO grade 4 gliomas
- Xuetao Han
- Huandi Zhou
- Xiaoying Xue
Scientific Reports (2023)
Gefitinib induces EGFR and α5β1 integrin co-endocytosis in glioblastoma cells
- Anne-Florence Blandin
- Elisabete Cruz Da Silva
- Maxime Lehmann
Cellular and Molecular Life Sciences (2021)
Uterine transcriptome analysis reveals mRNA expression changes associated with the ultrastructure differences of eggshell in young and aged laying hens
- Jia Feng
- Hai-jun Zhang
- Jing Wang
BMC Genomics (2020)
Emerging links between endosomal pH and cancer
- Myungjun Ko
- Alfredo Quiñones-Hinojosa
- Rajini Rao
Cancer and Metastasis Reviews (2020)
MicroRNA-135a regulates NHE9 to inhibit proliferation and migration of glioblastoma cells
- Daniela M. Gomez Zubieta
- Mohamed A. Hamood
- Kalyan C. Kondapalli
Cell Communication and Signaling (2017)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.