mab21-l3 regulates cell fate specification of multiciliate cells and ionocytes

Takahashi, Chika; Kusakabe, Morioh; Suzuki, Toshiyasu; Miyatake, Koichi; Nishida, Eisuke

doi:10.1038/ncomms7017

Article
Published: 19 January 2015

mab21-l3 regulates cell fate specification of multiciliate cells and ionocytes

Chika Takahashi¹,
Morioh Kusakabe^1,2,
Toshiyasu Suzuki¹,
Koichi Miyatake¹ &
…
Eisuke Nishida^1,2

Nature Communications volume 6, Article number: 6017 (2015) Cite this article

2707 Accesses
7 Citations
2 Altmetric
Metrics details

Subjects

Abstract

Cell fate specifications of multiciliate cells (MCCs) and ionocytes are commonly suppressed by the Notch pathway in developing epithelia, but are governed by different master regulators, suggesting the existence of a common regulator linking the Notch pathway to both MCC and ionocyte specifications. Here we show that a mab21 family gene, mab21-l3, represents the missing link. In Xenopus embryonic epidermis, mab21-l3 expression is specifically found in MCCs and ionocytes and is downregulated by the Notch pathway. Knockdown of mab21-l3 in Xenopus downregulates both MCC-specific and ionocyte-specific master genes, resulting in drastic loss of MCCs and ionocytes. In mouse tracheal epithelial cells, mab21-l3 expression is also downregulated by the Notch pathway and is required for MCC differentiation. Moreover, conditional gain of function of mab21-l3 rescues Notch-induced loss of MCCs and ionocytes in Xenopus. These results indicate that mab21-l3 acts downstream of the Notch pathway in cell fate specifications of MCCs and ionocytes.

You have full access to this article via your institution.

Download PDF

Inhibition of Wnt signalling by Notch via two distinct mechanisms

Article Open access 27 April 2021

Furry is required for cell movements during gastrulation and functionally interacts with NDR1

Article Open access 23 March 2021

Lef1 regulates caveolin expression and caveolin dependent endocytosis, a process necessary for Wnt5a/Ror2 signaling during Xenopus gastrulation

Article Open access 30 October 2019

Introduction

Flow-generating multiciliate cells (MCCs) and ion-transporting ionocytes are found in epithelia of various organs in vertebrates. MCCs have hundreds of hair-like motile protrusions, multicilia, to generate extracellular fluid flow along epithelial surfaces¹, while ionocytes (also known as ‘mitochondria-rich cells’, which include intercalated cells in mammalian kidney and clear cells in mammalian epididymis) selectively secrete or absorb ions and other small molecules to regulate body fluid homeostasis^2,3,4. Both cells are essential for human physiological processes, and malformation of them is associated with human diseases, including bronchiectasis, hydrocephalus and distal tubule acidosis^1,2. Cell fate specifications of MCCs and ionocytes are known to be suppressed by the Notch pathway in various developing epithelia^{5,6,7,8,9,10,11,12,13,14}. However, MCC-specific and ionocyte-specific transcriptional programmes are governed by different master regulators: a coiled-coil protein multicilin¹⁵ and a forkhead transcription factor foxj1 (refs 16, 17, 18) for MCCs and another forkhead transcription factor foxi1 (refs 7, 8, 9, 19, 20, 21) for ionocytes. This raises the possibility that an unidentified common regulator(s) links the Notch pathway to both MCC and ionocyte specifications.

In this study, we identify an evolutionarily conserved mab21 family gene, mab21-like 3 (mab21-l3), as a key common regulator representing the missing link. Our results suggest that mab21-l3 acts downstream of the Notch pathway in early phases of both MCC and ionocyte specifications, by regulating expression of master regulators for MCCs (multicilin and foxj1) and ionocytes (foxi1).

Results

Xenopus mab21-l3 is expressed in both MCCs and α-ionocytes

The Xenopus embryonic epithelium has been used as a model system to understand epithelial cell specification as it contains MCCs, ionocytes and mucus-secreting goblet cells^7,21,22. During our screen identifying genes that show a characteristic expression pattern in the embryonic epithelium, we found that an evolutionarily conserved gene, mab21-l3, showed a salt-and-pepper pattern of expression (see below). Mab21 was first identified in Caenorhabditis elegans, and three orthologous genes, mab21-like 1 (mab21-l1), mab21-like 2 (mab21-l2) and mab21-l3, have been identified in vertebrates^23,24. Among these three genes, mab21-l3 has been poorly studied. Xenopus mab21-l3 was recently shown to regulate dorsal development²⁴, but its detailed expression pattern and role in epidermal development have not been examined. We first analysed the spatial expression pattern of Xenopus mab21-l3 by whole-mount in situ hybridization (Supplementary Fig. 1a). The expression was first detected in the presumptive ectoderm in the animal region at the early gastrula stage (stage 10.5), and became restricted to the ventral ectoderm with a spotted pattern at the late gastrula stage (stage 12/13). At neurula and tailbud stages (stage 14–30), mab21-l3 is expressed in the epidermis with a salt-and-pepper pattern.

In the Xenopus embryonic epidermis, two subtypes of ionocytes, α- and β-ionocytes, exist, both of which, like MCCs, are known to be distributed in a salt-and-pepper pattern^7,21. We therefore examined whether mab21-l3 is expressed in MCCs and ionocytes. Embryos hybridized with a mab21-l3 antisense probe were subjected to double immunostaining with antibodies against acetylated α-tubulin (an MCC marker) and ae1 (an α-ionocyte marker; Fig. 1a). Cells with strong mab21-l3 expression (black arrowheads) were co-stained with the anti-ae1 antibody, while cells with weak mab21-l3 expression (yellow arrowheads) were co-stained with the anti-acetylated α-tubulin antibody. mab21-l3-expressing cells were positive for either ae1 or acetylated α-tubulin staining, suggesting that the mab21-l3 expression level in β-ionocytes is very low, if expressed. In situ hybridization combined with single immunostaining produced essentially the same results (Supplementary Fig. 1b,c). Thus, mab21-l3 is strongly expressed in α-ionocytes, weakly expressed in MCCs and little or very weakly expressed in β-ionocytes.

**Figure 1: *mab21-l3* expression in *Xenopus* embryonic epidermis.**

We then followed the behaviour of mab21-l3-expressing cells during early development, in which MCC progenitors (red) and ionocyte progenitors (yellow) commonly arise from uncommitted cells (green) in the inner cell layer of ventral ectoderm during gastrula stages (from stage 10 to 13) and then radially intercalate into the outer layer in a regular spacing pattern from mid to late neurula stages (from stage 17 to 21; see Fig. 1b, right). After intercalation is completed, these progenitors mature into MCCs and α/β-ionocytes, respectively, in the outer layer^5,6,7,21 (see Fig. 1b, right). At stages 11–13, mab21-l3 is expressed in the inner cell layer of the epidermis (Fig. 1b, left). At stage 17, mab21-l3-expressing cells are located around the border between two layers. At stages 25–30, mab21-l3 expression is observed in the outer cell layer with a spotted pattern. These results demonstrate that the behaviour of mab21-l3-expressing cells closely resembles that of MCC and/or ionocyte progenitors, and thus raise the possibility that mab21-l3 is involved in MCC/ionocyte specification.

mab21-l3 is required for the formation of MCCs and ionocytes

We next performed knockdown of mab21-l3 with an antisense morpholino oligonucleotide (MO). Mab21-l3 MO, but not a five-base mismatch control (mab21-l3 5mis MO), markedly blocked translation from mab21-l3 mRNA (Supplementary Fig. 2). We co-injected control MO, mab21-l3 MO or mab21-l3 5mis MO with a lineage tracer fluorescein dextran into the left ventral blastomere of 4-cell-stage embryos. Injected embryos, in which uninjected right sides serve as an internal control, were analysed by whole-mount in situ hybridization for marker gene expression. Injection of mab21-l3 MO, but not that of control MO or mab21-l3 5mis MO, led to a drastic decrease in the number of cells expressing the α-ionocyte marker ae1 at stage 22 (Fig. 2a,b). Similarly, cells showing the normal expression level of pendrin, a β-ionocyte marker, were drastically reduced by mab21-l3 MO at stage 22 (Fig. 2c,d). Next we performed immunofluorescence staining of MO-injected embryos with an antibody against acetylated α-tubulin, an MCC marker. The number of MCCs was also drastically decreased in mab21-l3 morphants (Fig. 3a–c). These results indicate that mab21-l3 is required for the formation of both ionocytes and MCCs.

**Figure 2: *mab21-l3* is required for the formation of ionocytes.**

**Figure 3: *mab21-l3* is required for the formation of MCCs.**

mab21-l3 regulates early specification of MCCs and ionocytes

Although mab21-l3 seems to be scarcely expressed in β-ionocytes, mab21-l3 MO markedly decreased the number of β-ionocytes at tailbud stages (Fig. 2c,d), leading to the hypothesis that mab21-l3 functions in ionocyte specification at earlier stages. It has been known that the master regulator for ionocyte specification, foxi1, starts to be expressed in progenitor cells at gastrula stages⁷. Whole-mount in situ hybridization showed that injection of mab21-l3 MO, but not that of control MO or mab21-l3 5mis MO, led to a dramatic decrease in foxi1 expression at the late gastrula stages (stages 12 and 13; Fig. 4a; Supplementary Fig. 3a). The results of real-time quantitative PCR (qPCR) also indicated that mab21-l3 MO significantly reduces the expression level of foxi1 at stages 12 and 13 (Fig. 4d; Supplementary Fig. 3d). These results suggest that mab21-l3 functions in ionocyte specification at the upstream of foxi1. Next we examined the effect of mab21-l3 knockdown on the expression of the established master regulator for MCC specification, foxj1. Both whole-mount in situ hybridization and real-time qPCR analyses revealed that mab21-l3 MO led to a decrease in foxj1 expression at the late gastrula stage (Fig. 4b,d). Moreover, mab21-l3 MO reduced the expression level of a recently identified master regulator for MCC specification, multicilin (Fig. 4c,d; Supplementary Fig. 3b,d), which has been shown to act upstream of foxj1 (ref. 15). Because multicilin has been reported to promote cell cycle exit¹⁵, we examined cell proliferation in mab21-l3 knockdown embryos. Mab21-l3 MO significantly enhanced the accumulation of an M-phase marker, phospho-histone H3 (Fig. 4e), supporting the idea that mab21-l3 inhibits cell proliferation at least in part by inducing multicilin expression. These results show that mab21-l3 is required for MCC specification, acting upstream of the multicilin/foxj1 axis. The expression of the MCC progenitor marker α-tubulin was also suppressed by mab21-l3 MO at stages 12, 13 and 17 (Fig. 5a,b; Supplementary Fig. 3c,d). These results taken together indicate that mab21-l3 plays a crucial role in the formation of both MCC progenitors and ionocyte progenitors, functioning upstream of the established master regulators.

**Figure 4: *mab21-l3* acts upstream of MCC and ionocyte master regulators.**

**Figure 5: *mab21-l3* is required for MCC progenitor marker expression.**

A previous study reported that depletion of the ionocyte master regulator foxi1 leads to the loss of MCCs at later stages (apparent stages 26–27, although the authors did not mention the stage number)²⁵, raising the possibility that the loss of MCCs observed in mab21-l3 knockdown embryos is secondarily caused by the loss of ionocytes. To address this issue, we examined whether foxi1 knockdown leads to the loss of MCCs at earlier stages. At stage 22, ae1 or pendrin expression was drastically decreased, but α-tubulin expression was not or only slightly affected, by the translation-blocking foxi1 MOs (MO1 plus MO2)²⁶ or the splice-blocking foxi1 MO (SBMO)²⁵ (Supplementary Fig. 4). Also, another group reported that α-tubulin expression (at apparent stage 25, although the authors did not mention the stage number) is not affected by foxi1 knockdown in the related species X. tropicalis²¹. Taken together, the loss of ionocytes does not largely affect early specification of MCCs before stage 25, but it affects maturation of MCCs at later stages. Our results also demonstrate that mab21-l3 knockdown decreases expression of MCC markers at earlier stages such as stages 12, 13 and 17 (Figs 4b–d and 5; Supplementary Fig. 3b–d). Thus, the loss of MCCs in mab21-l3 knockdown embryos occurs at very early stages and is not secondarily caused by the loss of ionocytes. Also, we examined whether co-expression of foxi1 rescues the loss of ionocytes and MCCs in mab21-l3 knockdown embryos. Injection of mab21-l3 MO alone resulted in the loss of ae1, pendrin and α-tubulin expressions (Supplementary Fig. 5). Co-injection of mab21-l3 MO with foxi1 mRNA was able to induce weak ae1 expression as well as strong pendrin expression, but was unable to restore α-tubulin expression (Supplementary Fig. 5), indicating that the loss of MCCs in mab21-l3 knockdown embryos can be observed even in the condition activating the ionocyte differentiation programme. Taken together, requirement of mab21-l3 in MCC specification seems to be independent of the presence or absence of ionocytes, thus decreasing the possibility that the loss of MCCs observed in mab21-l3 knockdown embryos is secondarily caused by the loss of ionocytes.

Next we addressed whether mab21-l3 is sufficient for MCC/ionocyte specification. Mab21 family proteins have been suggested to function as a transcriptional regulator^27,28, and exogenously expressed mab21-l3 protein was localized to the nucleus in Xenopus ectoderm (Supplementary Fig. 1d). Because injection of synthesized mRNA encoding myc-tagged wild-type mab21-l3 induced cell death at blastula stages in a preliminary experiment (18/18 (100%) death, 1 ng mab21-l3-myc mRNA per embryo; 12/20 (60%) death, 400 pg mab21-l3-myc mRNA per embryo), we used a glucocorticoid-inducible form of mab21-l3 (mab21-l3-hGR), whose nuclear translocation can be conditionally induced by dexamethasone (DEX). Embryos unilaterally injected with mab21-l3-hGR mRNA were treated with DEX at gastrula stages, and then cultured until tailbud stages, at which the number of MCCs, α-ionocytes or β-ionocytes in the injected side was compared with that in the uninjected side. DEX treatment weakly but significantly increased the number of MCCs, but not that of α-ionocytes or β-ionocytes (Fig. 6a; Supplementary Fig. 6). Moreover, overexpression of mab21-l3-hGR increased the expression level of multicilin in both ectodermal explants and whole embryos at stage 12 (Fig. 6b), although DEX dependency was low possibly because of a short treatment period (from stage 10 to 12). These results taken together suggest that mab21-l3 is sufficient to promote specification of MCCs, but not ionocyte specification, which may require an additional factor(s).

**Figure 6: Conditional gain of function of *mab21-l3* is able to upregulate MCC markers.**

In the Xenopus embryonic epidermis, MCCs and ionocytes arise from the inner cell layer where mab21-l3 is expressed (see Fig. 1b), whereas mucus-secreting goblet cells arise from the outer cell layer. We investigated whether mab21-l3 affects differentiation of goblet cells. The expression of Xeel, the goblet cell marker²², was reduced by mab21-l3 knockdown at stages 17 and 22 (Supplementary Fig. 7a,b). However, at stage 11, expression of outer-layer-specific markers, WRPW-bHLH protein enhancer of split-6e (esr6e) and grainyhead-like 3 (grhl3)^29,30, was not significantly affected by mab21-l3 knockdown (Supplementary Fig. 7c). This result suggests that at stage 11 mab21-l3 is dispensable for specification of outer-layer cells including goblet cell progenitors. At stage 12, expression of grhl3 was unaffected, but expression of esr6e or epidermal keratin (xk81a1, another outer-layer marker) was downregulated by mab21-l3 knockdown (Supplementary Fig. 3e). Thus, outer layer-specific gene expression was initially unaffected, but partly affected later in mab21-l3 knockdown embryos. We also found that the Notch pathway, the established negative regulator for MCC and ionocyte specification, was able to inhibit differentiation of goblet cells at later stages (Supplementary Fig. 8a). We therefore speculate that differentiation of outer-layer progenitors into goblet cells is disturbed at later stages in mab21-l3 MO-injected embryos, possibly due to secondary effects caused by the loss of MCCs and ionocytes at early stages.

Because both ionocytes and MCCs arise from the inner layer of early ectoderm (see Fig. 1b, right), it is possible that the loss of ionocytes and MCCs in mab21-l3 knockdown embryos is secondarily caused by global defects of inner-layer patterning at early stages. To address this point, we examined expression of inner-layer markers, p63, vestigial-like 4 (vgll4) and hyaluronan synthase 1 (has1)^30,31. At stage 12, mab21-l3 knockdown significantly decreased expression of p63, but not that of vgll4 or has1 (Supplementary Fig. 3e), suggesting that inner-layer-specific gene expression is at least partly normal in the absence of mab21-l3. Thus, mab21-l3 does not play a crucial role in controlling all aspects of inner-layer patterning.

mab21-l3 acts downstream of the Notch pathway

Next we investigated the relationship between mab21-l3 and Notch signalling. The intracellular domain of Notch (NICD) has been widely used to induce Notch pathway activation. Overexpression of Xenopus NICD (xNICD) led to marked reduction in mab21–13 expression at stages 13 and 31/32 (Fig. 7a,b; Supplementary Fig. 8a). We also co-injected xNICD mRNA with fluorescein dextran into one ventral blastomere at the 32-cell stage, and the injected embryos, which were cultured until stage 27, were hybridized with a mab21-l3 antisense probe, followed by immunostaining with an antibody against E-cadherin to visualize the plasma membrane (Fig. 7c). mab21-l3 expression could be seen in xNICD-negative epithelial cells, but not in xNICD-positive epithelial cells (Fig. 7c), suggesting that the inhibitory action of Notch on mab21-l3 expression may be cell autonomous. We then searched for a mediator that acts downstream of Notch to repress mab21-l3 transcription. Certain members of the transcriptional repressor Hes family, including hes1 and hes5, are known as major targets of the Notch pathway³². Thus, a Xenopus close homologue of mammalian hes5, esr6e, could be a candidate, because esr6e is known to be induced by the Notch pathway to repress MCC specification⁵. Injection of esr6e mRNA decreased mab21-l3 expression at stages 13 and 31/32 (Fig. 7a,b). Moreover, expression of the α-ionocyte marker ae1 and the β-ionocyte marker pendrin was downregulated by injection of esr6e mRNA, but was upregulated by that of esr6e Δb (a dominant negative form of esr6e)⁵ mRNA (Supplementary Fig. 8b). These results indicate that esr6e mediates the action of Notch signalling to repress mab21-l3 transcription and MCC/ionocyte specification.

**Figure 7: The Notch/esr6e pathway suppresses *mab21-l3* expression.**

We reasoned that ectopic expression of mab21-l3 should rescue Notch-dependent inhibition of MCC/ionocyte specification, if the inhibition is mediated through Notch-dependent downregulation of mab21-l3. We first confirmed Notch inhibition of MCC/ionocyte specification. Injection of xNICD mRNA alone led to the decrease in foxi1 and multicilin expressions at stage 13 (Fig. 8a,b, second left). At later stages, xNICD suppressed ae1 expression, pendrin expression and acetylated α-tubulin abundance (Fig. 9a,b, second top panels), as also indicated by the bar graph (Fig. 9c, white and light grey bars), which represents the ratio of the number of ae1-, pendrin- or acetylated α-tubulin-positive cells in the injected side to that in the uninjected side. These results are consistent with the previous finding that the Notch pathway suppresses both MCC and ionocyte specification. For rescue experiments, we used mab21-l3-hGR. When embryos co-injected with xNICD and mab21-l3-hGR mRNA were cultured with DEX from the late blastula stage (stage 9), the xNICD-induced decrease in foxi1 or multicilin expression was cancelled by mab21-l3-hGR in a DEX-dependent manner (Fig. 8a,b, rightmost and second right). Moreover, mab21-l3-hGR with DEX restored ae1 expression, pendrin expression and acetylated α-tubulin abundance at later stages (Fig. 9a,b, first and second bottom panels), as indicated also by the bar graph (Fig. 9c, dark grey and black bars). Thus, exogenous expression of mab21-l3 is sufficient to overcome Notch-dependent inhibition of MCC/ionocyte specification. It should be noted that DEX treatment from the late gastrula stage (stage 13) could not restore α-tubulin expression (Supplementary Fig. 9), suggesting that mab21-l3 begins to function at late blastula or early gastrula stages, the timing before MCC/ionocyte progenitors are formed. These results taken together demonstrate that mab21-l3 regulates early phases of MCC/ionocyte specification by acting downstream of the Notch pathway and upstream of master regulators (Fig. 9d).

**Figure 8: Conditional gain of function of *mab21-l3* counteracts Notch-dependent downregulation of MCC and ionocyte master genes.**

**Figure 9: Conditional gain of function of *mab21-l3* counteracts Notch-dependent loss of MCCs and ionocytes.**

In response to overexpression of xNICD, the numbers of β-ionocytes, MCCs and α-ionocytes showed a 36, 26 and 19% decrease, respectively (Fig. 9c), suggesting that the sensitivity to Notch activation of β-ionocyte, MCC and α-ionocyte specification is high, medium and low, respectively. Interestingly, expression of mab21-l3 was almost undetectable, weak and strong in β-ionocytes, MCCs and α-ionocytes, respectively (Fig. 1a). Thus, the responsiveness to Notch activation was inversely correlated with the expression level of mab21-l3. These results suggest that the expression level of mab21-l3 is one of the factors influencing Notch responsiveness and cell fate decision in MCC/ionocyte development.

Mouse Mab21-l3 is required for MCC differentiation

We finally examined whether the role of mab21-l3 is conserved in mammals. Overexpression of mouse Notch intracellular domain (mNICD) in mouse tracheal epithelial cells (mTECs) markedly upregulated mouse Hes5, an established Notch-inducible gene that shows close homology to Xenopus esr6e, and significantly downregulated mouse Mab21-l3 (Fig. 10a). These results indicate that the Notch pathway is able to inhibit mab21-l3 expression in mice as well as in Xenopus. Next we assessed a role of mouse Mab21-l3 in MCC differentiation. It has been previously established that MCCs start to be induced at about 3–4 days after exposure of confluent mTECs to an air–liquid interface (ALI)³³. First we examined changes in gene expression before and after ALI exposure. Multicilin exhibited peak expression around 2 days after ALI exposure (ALI+2), while Mab21-l3 exhibited peak expression around the starting time of ALI exposure (ALI+0) (Fig. 10b), consistent with our hypothesis that mab21-l3 acts upstream of multicilin to regulate early phases of MCC specification. In agreement with this result, the BioGPS database ( http://biogps.org/#goto=genereport&id=126868) indicates that human MAB21-L3 gene exhibits peak expression at ALI+0 in the previous microarray data of ALI-treated bronchial epithelial cells (the GEO accession number GSE5264)³⁴.

We next designed two short hairpin RNAs (shRNAs) targeting mouse Mab21-l3, mMab21-l3 shRNA #1 and mMab21-l3 shRNA #2, both of which inhibited Mab21-l3 expression in NIH3T3 cells (Fig. 10c). Each shRNA and GFP was co-expressed in mTECs by lentiviral delivery, and at 6 days after ALI exposure (ALI+6), the multicilia were visualized by immunostaining with the anti-acetylated α-tubulin antibody. While multicilia were formed in 17% of GFP-positive cells expressing control shRNA, they were formed in only 8 and 7% of GFP-positive cells expressing mMab21-l3 shRNA #1 and #2, respectively (Fig. 10d,e). We also examined tracheal progenitor cells called basal cells, which are known to be abundantly present in the mTEC culture³³. The percentage of cells positive for the basal cell marker p63 was not significantly changed by mMab21-l3 shRNAs (Supplementary Fig. 10), ruling out the possibility that Mab21-l3 knockdown has nonspecific toxic effects on mTECs. These results indicate that Mab21-l3 is required for MCC differentiation in mouse.

Discussion

In this study, we uncover a missing molecular link between the Notch pathway and MCC/ionocyte specification. We have identified an evolutionarily conserved gene mab21-l3 as a bifunctional regulator of both MCC and ionocyte specification. Moreover, our rescue experiments suggest that Notch/esr6e-driven repression of mab21-l3 is a key step to restrict the number of MCCs and ionocytes to an appropriate level. We have also shown that mab21-l3 functions upstream of the established master regulators for MCCs (multicilin and foxj1) and ionocytes (foxi1). As mab21-l3 expression is positively regulated by foxi1 (ref. 24), there is a feedback relationship between foxi1 and mab21-l3 (see Fig. 9d). This positive feedback may ensure robust progression of ionocyte differentiation. Also, miR-449 microRNAs, whose genomic locus is close to the multicilin gene¹⁵, could be functionally linked with mab21-l3, because they have been shown to regulate MCC differentiation through inhibition of the Notch signalling pathway in both Xenopus embryonic epidermis and mammalian airway epithelial cells³⁵.

Although our results were mainly obtained in the Xenopus embryonic epidermis, two main points were also shown to be conserved in mammals; that is, the Notch pathway-dependent repression of mab21-l3 expression and the essential role of mab21-l3 in MCC specification. Because the Notch pathway is known to restrict MCC and ionocyte specification in various organs, including mouse lung^12,13, mouse kidney¹⁴, zebrafish pronephros^10,11 and zebrafish skin^8,9, the Notch/mab21-l3 signalling axis could have a conserved role in MCC/ionocyte specification in vertebrates.

In our rescue experiment in Xenopus, the sensitivity to Notch activation was low in α-ionocytes (which strongly express mab21-l3), medium in MCCs (which weakly express mab21-l3) and high in β-ionocytes (which show no or little mab21-l3 expression). This implies that the expression level of mab21-l3 is one of the factors that influence the responsiveness to Notch. Because a search of NCBI GEO and BioGPS databases reveals that mammalian mab21-l3 is expressed in various tissues including oesophagus, rectum and skin, mab21-l3 may fine-tune the responsiveness to Notch in many other biological contexts.

Previous studies have suggested that the mab21 family member could act as a transcriptional regulator^27,28. Our results with mab21-l3-hGR also suggest that mab21-l3 primarily functions in the nucleus. We thus speculate that mab21-l3 protein may interact with additional nuclear proteins such as transcription factors, coactivators, corepressors or chromatin-remodelling factors to activate transcription of genes required for cell fate specification. Because mab21-l3 plays a dual role in MCC and ionocyte specification, the constituents of the mab21-l3 complex may vary in a cell-type or context-dependent manner. Detailed molecular mechanisms of the action of mab21-l3 should be elucidated in future studies.

Methods

Molecular cloning and plasmid construction

The entire coding regions of Xenopus laevis mab21-l3, α-tubulin, foxj1, foxi1, ae1, pendrin, Xeel, multicilin and esr6e were amplified by PCR from late gastrula or neurula complementary DNAs (cDNAs) using primers designed based on deposited sequences (the GenBank/EMBL accession numbers are as follows: mab21-l3, BC073481; α-tubulin, BC077769; foxj1, AJ609390; foxi1, BC042303; ae1, BC072920; pendrin, AY174063; Xeel, AB105372; multicilin, BC124892; esr6e, AF146087). These amplified sequences were cloned into the pBluescript vector (for RNA probe synthesis) or the pCS2+ vector (for RNA probe synthesis or mRNA synthesis). A cDNA fragment (5,251–7,575 bp (base pair) of the coding sequence with accession number M33874), which encodes the intracellular domain of Xenopus Notch (xNICD), was obtained by PCR and cloned into the HA-pCS2+ vector. A cDNA fragment (5,230–7,596 bp of the coding sequence with accession number AB100603), which encodes the intracellular domain of mouse Notch (mNICD), was obtained by PCR and cloned into the lentiviral vector. The sequences of primer pairs used were as follows: Xenopus mab21-l3 (forward 5′- GGTAGATCTATGAAGGGAGTGAAGGCTGAGGATG -3′; reverse 5′- GGTAGATCTTCAGCACACGGAGGAGGCACCTTG -3′); Xenopus α-tubulin (forward 5′- GCCAGATCTATGAGGGAATGCATCTCAGTTC -3′; reverse 5′- GGCAGATCTTTACTCCTCTCCTTCATCTTCATC -3′); Xenopus foxj1 (forward 5′- CCATCGATGGATGTTTGACCTGCCCAGGGCGGCC -3′; reverse 5′- CCGCTCGAGTTATATATAGGAACCCAAGGACGA -3′); Xenopus foxi1 (forward 5′- CCATCGATGGATGAGTGCATTTGATCCACAAGCA -3′; reverse 5′- CCGCTCGAGTTATACTTCTGTACCTTCTCTGTT -3′); Xenopus ae1 (forward 5′- CCATCGATGGATGGCATCTAAAGATCAATCCGAC -3′; reverse 5′- CCGCTCGAGTTAAAAAGGAAAATATTTCCTGCG -3′); Xenopus pendrin (forward 5′- CCGGAATTCATGGCAACAGCAAGAATGGATATC -3′; reverse 5′- CCGCTCGAGTCAGTGTGCCAGTGATCGGAGAGC -3′); Xenopus Xeel (forward 5′- CCGCTCGAGCGGATGGGCAAGATGTTGTCATATAGCCTGTTG -3′; reverse 5′- GGAAGATCTTCCTTAACGGTAGAAGAGCATCACAGCTGCCTC -3′); Xenopus multicilin (forward 5′- CGCGGATCCATGCCGGATTTGTCCAACCGGTTGAG -3′; reverse 5′- CCGCTCGAGTTAATTGGGAACCCATCTAAATTTGTAGCC -3′); Xenopus esr6e (forward 5′- GGAAGATCTTCCATGGAGAGAAAGCCAGTGATTGAG -3′; reverse 5′- CCGGAATTCCGGTTAAGGAGGTGAAAGAACCTGCCAAG -3′); xNICD (forward 5′- ATTAGATCTAATAAGAAGCGTCGCCGTGAACACGG -3′; reverse 5′- CGGAGATCTTTACTTGAAAGCTTCAGGTATGTGGG -3′); and mNICD (forward 5′- TCCGGAATTCGCCACCATGGTGCTGCTGTCCCGCAAGCG -3′; reverse 5′- GCGCGGATCCTTATTTAAATGCCTCTGGAATG -3′).

Embryo manipulation

X. laevis embryos were obtained by in vitro fertilization and cultured in 0.1 × MBS (1.0 mM HEPES, pH 7.4, 8.8 mM NaCl, 0.1 mM KCl, 0.24 mM NaHCO₃, 0.082 mM MgSO₄, 0.03 mM Ca(NO₃)₂ and 0.041 mM CaCl₂). For animal cap assay, ectodermal explants were dissected at stage 10 and harvested at indicated stages for real-time qPCR. mRNAs or antisense MOs were injected into the animal region of indicated blastomeres at the indicated stage (5–400 pg of each mRNA, 2–40 ng of each MO, per blastomere). Frogs were bred and handled with care, according to the established manual³⁶.

Real-time qPCR

Total RNA from Xenopus embryos was extracted using TRIzol reagent (Invitrogen), and cDNA was synthesized using M-MLV reverse transcriptase (Invitrogen). Total RNA extraction from mammalian cells was performed with Qiagen RNeasy Mini Kit (Qiagen), and cDNA was synthesized by QuantiTect Reverse Transcription Kit (Qiagen). For real-time qPCR analysis, we used 7300 real-time PCR System (Applied Biosystems) with SYBR Green PCR Master Mix (Qiagen). Duplicate PCR reactions were performed for each sample in each experiment. The gene expression levels were normalized to those of ornithine decarboxylase (odc) in Xenopus embryos or Gapdh in mouse cells. ‘Relative expression’ in bar graphs indicates the ratio of the normalized expression level in each sample to that in one sample used as a control. Thus, relative expression in one sample used as a control is always defined as 1.0 in each experiment. The sequences of primer pairs used were as follows: Xenopus odc (forward 5′- TGCAAGTTGGAGACTGGATG -3′; reverse 5′- CATCAGTTGCCAGTGTGGTC -3′); Xenopus multicilin (forward 5′- TTCCCTCCACGGAGCAATAC -3′; reverse 5′- CAGTCAGACTCACCTGGAGC -3′); Xenopus α-tubulin (forward 5′- ACGTCTCTCTGTTGACTATGGC -3′; reverse 5′- GTCTGAGTGCTCAAGTGTTGTG -3′); Xenopus foxj1 (forward 5′- GGGACTCCCATGGTTACAGG -3′; reverse 5′- GAGGTGGACGAGGAAATGGG -3′); Xenopus foxi1 (forward 5′- CAAGCACATTCTCCACCACG -3′; reverse 5′- TCGCTGAGGACTAGGCATTG -3′); Xenopus esr6e (forward 5′- GCATACCCAGGAGCACGGACAC -3′; reverse 5′- GAGAGGGTGCAGGGAGGCAAG -3′); Xenopus vestigial-like 4 (vgll4) (forward 5′- CGCTCTGACCATGGACCTG -3′; reverse 5′- GGGTCACTCCGTAATGCTGC -3′); Xenopus hyaluronan synthase 1 (has1) (forward 5′- GCCCAGTGGTGGCACAAGCATC -3′; reverse 5′- ATGGTGCCGGCATAGATGAGGCG -3′); Xenopus p63 (forward 5′- GCCAAGCTCTACCTTTGATGC -3′; reverse 5′- AGGTGGCTGACTTTGCTGTG -3′); Xenopus grhl3 (forward 5′- GAAGGGCGTTAAAGGTGTCC -3′; reverse 5′- CAGACTGCACGATGAATGAGC -3′); Xenopus epidermal keratin (xk81a) (forward 5′- CACCAGAACACAGAGTAC -3′; reverse 5′- CAACCTTCCCATCAACCA -3′); mouse Gapdh (forward 5′- AACATCAAATGGGGTGAGGCC -3′; reverse 5′- GTTGTCATGGATGACCTTGGC -3′); mouse Mab21-l3 (forward 5′- CAAAGTCCTGCAGTTGTTCCG -3′; reverse 5′- GCAACCCAAACCGTAGTGC -3′); mouse Multicilin (forward 5′- GCCAGCTCGGTGAATCTGAG -3′; reverse 5′- GTAACCACCGGTGACTGTCC -3′); and mouse Hes5 (forward 5′- TACCTGAAACACAGCAAAGCCTTC -3′; reverse 5′- TAAAGCAGCTTCATCTGCGTGTCG -3′).

Whole-mount in situ hybridization

Whole-mount in situ hybridization³⁶ on albino or wild-type Xenopus embryos was performed using a robot (InsituPro, Intavis). Embryos were fixed in MEMFA (100 mM MOPS, pH 7.4, 2 mM EGTA, 1 mM MgSO₄ and 3.7% formaldehyde) for 2 h, dehydrated and stored in methanol. After rehydration, embryos were treated with 5 μg ml⁻¹ proteinase K in PBS containing 0.1% Tween20, incubated in 100 mM triethanolamine (pH 8) for 12 min, incubated in 100 mM triethanolamine (pH 8) containing 0.25% acetic anhydride for 12 min and then refixed with 4% paraformaldehyde in PBS for 20 min. After washing, embryos were hybridized with digoxigenin-labelled probes for 18 h at 58 °C, and then subjected to anti-digoxigenin antibody staining. The colour reaction was performed using BM purple. The digoxigenin-labelled antisense and sense probes were synthesized from full-length cDNA sequences of mab21-l3, α-tubulin, foxj1, foxi1, ae1, pendrin and Xeel. For whole-mount in situ hybridization combined with immunostaining, we omitted the proteinase K step.

Morpholino oligonucleotides

Antisense MOs were obtained from Gene Tools. The MO sequences were as follows: mab21-l3 MO, 5′- ATCCTCAGCCTTCACTCCCTTCATC -3′ (the sequence complementary to the predicted start codon is underlined); mab21-l3 5mis MO, 5′- ATCCTgAcCgTTCAgTCgCTTCATC -3′ (lower case letters indicate mismatched bases); a standard control oligo (control MO), 5′- CCTCTTACCTCAGTTACAATTTATA -3′; foxi1 MO1 (ref. 26), 5′- GTGCTTGTGGATCAAATGCACTCAT -3′ (the sequence complementary to the predicted start codon is underlined); foxi1 MO2 (ref. 26), 5′- AGGTCACAAATACACCTGTACTAGC -3′; and foxi1 SBMO²⁵, 5′- ATAATTGCCCTTGCCTGTAAAGAAAA -3′. These MOs were resuspended in sterile water.

Immunoblotting

Embryos were lysed in a buffer consisting of 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1.5 mM MgCl₂, 2 mM EGTA, 25 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 1% NP-40, 10 mM NaF, 1 mM vanadate, 1 mM dithiothreitol and 1% Protease Inhibitor cocktail (Sigma #8340). The lysate was centrifuged and the supernatant was used for immunoblotting with antibodies against Myc (9E10, Santa Cruz #sc-40) or GFP (JL-8, Clontech #632381).

Immunofluorescence staining

For whole-mount immunofluorescence staining, embryos injected with indicated mRNA or MOs were fixed in MEMFA (100 mM MOPS, pH 7.4, 2 mM EGTA, 1 mM MgSO₄ and 3.7% formaldehyde) for 2 h, dehydrated and stored in methanol. After rehydration, embryos were bleached, and then incubated in either of three blocking solutions: 2% skim milk in PBS (for V5 staining), 10% fetal bovine serum in PBS with 0.1% Triton X-100 and 5% dimethylsulphoxide (for acetylated α-tubulin staining), and 2% BSA in PBS with 0.1% Tween20 (for ae1 staining and E-cadherin staining). The primary antibodies used were: anti-V5 antibody (Invitrogen #R960-25, 1:1,000), anti-acetylated α-tubulin antibody (Sigma #T7451, 1:1,000), anti-E-cadherin antibody (BD Bioscience #610182, 1:300) and monoclonal anti-ae1 antibody (IDSHB clone IVF-12, 1:300). Bound primary antibodies were detected with Alexa Fluor 488 goat anti-mouse IgG (Invitrogen #A-11029, 1:1,000) or Alexa Fluor 568 goat anti-mouse IgG (Invitrogen #A-11031, 1:1,000). Images of the embryos were acquired using stereomicroscope SZX12 (Olympus), SZX16 (Olympus) or the DeltaVision Optical Sectioning system (Applied Precision). The confocal image was obtained by using a confocal laser scanning microscope, A1 (Nikon). For immunofluorescence staining of mTECs, cells were fixed in 4% paraformaldehyde at room temperature for 10 min, and then permeabilized with 0.2% Triton X-100 in PBS at room temperature for 10 min. After blocking with 3% BSA in PBS at room temperature for 1 h, cells were incubated with 3% BSA in PBS containing the anti-acetylated tubulin antibody or the anti-p63 antibody (Santa Cruz #sc-8343, 1:100) at 4 °C overnight, washed with PBS and then incubated with 3% BSA in PBS containing Alexa Fluor 568 goat anti-mouse IgG (1:400) or Alexa Fluor 568 goat anti-rabbit IgG (Invitrogen #A11036, 1:400) for 30 min at room temperature. Nuclei were simultaneously stained with Hoechst. Cells were finally mounted in Mowiol. Images were acquired by using an Axioplan2 microscope (Zeiss).

Preparation of lentiviral vectors

Constructs expressing shRNAs against mouse Mab21-l3 (mMab21-l3 shRNAs) were generated by subcloning the silencing oligonucleotides into the ApaI/EcoRI site of the CSII-U6-MCS-EGFP vector, which was designed to co-express shRNA and the enhanced green fluorescent protein (EGFP) reporter³⁷. The sequences of silencing oligonucleotides are as follows: mMab21-l3 shRNA #1-sense, 5′- AAAGCTACCCACCAGATTTCTCAAGAGAAAATCTGGTGGGTAGCTTTCCTTTTTT -3′; mMab21-l3 shRNA #1-antisense, 5′- AATTAAAAAAGGAAAGCTACCCACCAGATTTTCTCTTGAGAAATCTGGTGGGTAGCTTTGGCC -3′; mMab21-l3 shRNA #2-sense, 5′- GCAGAAGGTTGCTGCTATACTCTCAAGAGAAGTATAGCAGCAACCTTCTGCTTTTTTTT -3′; and mMab21-l3 shRNA #2-antisense, 5′- AATTAAAAAAAAGCAGAAGGTTGCTGCTATACTTCTCTTGAGAGTATAGCAGCAACCTTCTGCGGCC -3′. To generate constructs expressing mNICD, the mNICD cDNA was cloned into the CSII-EF-MCS-CMV-EGFP vector, which was generated by replacing the IRES sequence of the CSII-EF-MCS-IRES-EGFP vector³⁷ with the CMV promoter. To produce the recombinant lentivirus, the shRNA-expressing CSII-U6-MCS-EGFP vector or the mNICD-expressing CSII-EF-MCS-CMV-EGFP vector was co-transfected with pCAG-HIVgp and pCMV-VSV-G-RSV-Rev into HEK293T cells using FuGENE HD Transfection Reagent (Promega). Culture supernatants containing the virus were collected 48 h after transfection. For testing the shRNA efficiency, NIH3T3 cells were cultured with the unconcentrated supernatants for 24 h. For infection of mTECs, the lentiviral supernatants were concentrated to achieve 10⁷–10⁸ infectious units per millilitre.

Culture of mTECs

Primary mTEC culture was performed according to the published protocol³³. mTECs were isolated from tracheas of 7 weeks old, wild-type C57BL/6 J male mice, seeded onto Transwell Clear permeable membranes (Corning, #3460) coated with rat-tail collagen, and then cultured with mTEC plus medium³³. For mNICD overexpression experiments, cells were spin infected with the lentivirus in the presence of 5 μg ml⁻¹ polybrene (Sigma) at 2 days after seeding³⁸, and then harvested at confluency for real-time qPCR analysis. For MCC differentiation experiments, cells reaching confluency were exposed to an ALI and cultured with mTEC basic medium³³ containing 2% Nu-Serum (Becton-Dickinson). For shRNA experiments, cells were spin infected with the shRNA-expressing lentivirus in the presence of 5 μg ml⁻¹ polybrene at 2 days after seeding³⁸, and then exposed to ALI after reaching confluency. All mouse experiments were conducted in accordance with the Regulation on Animal Experimentation at Kyoto University and approved by the Animal Experimentation Committee of Kyoto University.

Statistics

Cell counting was done using Image J Software. The t-test was performed using the EXCEL Software (Microsoft). The Tukey’s test and the Dunnett’s test were performed using the SPSS Software (IBM). Results are considered significant when P<0.05.

Additional information

How to cite this article: Takahashi, C. et al. mab21-l3 regulates cell fate specification of multiciliate cells and ionocytes. Nat. Commun. 6:6017 doi: 10.1038/ncomms7017 (2015).

Accession codes

Accessions

GenBank/EMBL/DDBJ

Gene Expression Omnibus

GSE5264

References

Fliegauf, M., Benzing, T. & Omran, H. When cilia go bad: cilia defects and ciliopathies. Nat. Rev. Mol. Cell Biol. 8, 880–893 (2007).
Article CAS Google Scholar
Forgac, M. Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology. Nat. Rev. Mol. Cell Biol. 8, 917–929 (2007).
Article CAS Google Scholar
Brown, D. & Breton, S. Mitochondria-rich, proton-secreting epithelial cells. J. Exp. Biol. 199, 2345–2358 (1996).
CAS PubMed Google Scholar
Hwang, P. P. & Chou, M. Y. Zebrafish as an animal model to study ion homeostasis. Pflugers Arch. 465, 1233–1247 (2013).
Article CAS Google Scholar
Deblandre, G. A., Wettstein, D. A., Koyano-Nakagawa, N. & Kintner, C. A two-step mechanism generates the spacing pattern of the ciliated cells in the skin of Xenopus embryos. Development 126, 4715–4728 (1999).
CAS Google Scholar
Stubbs, J. L., Davidson, L., Keller, R. & Kintner, C. Radial intercalation of ciliated cells during Xenopus skin development. Development 133, 2507–2515 (2006).
Article CAS Google Scholar
Quigley, I. K., Stubbs, J. L. & Kintner, C. Specification of ion transport cells in the Xenopus larval skin. Development 138, 705–714 (2011).
Article CAS Google Scholar
Hsiao, C. D. et al. A positive regulatory loop between foxi3a and foxi3b is essential for specification and differentiation of zebrafish epidermal ionocytes. PLoS ONE 2, e302 (2007).
Article ADS Google Scholar
Janicke, M., Carney, T. J. & Hammerschmidt, M. Foxi3 transcription factors and Notch signaling control the formation of skin ionocytes from epidermal precursors of the zebrafish embryo. Dev. Biol. 307, 258–271 (2007).
Article Google Scholar
Ma, M. & Jiang, Y. J. Jagged2a-notch signaling mediates cell fate choice in the zebrafish pronephric duct. PLoS Genet. 3, e18 (2007).
Article Google Scholar
Liu, Y., Pathak, N., Kramer-Zucker, A. & Drummond, I. A. Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros. Development 134, 1111–1122 (2007).
Article CAS Google Scholar
Guseh, J. S. et al. Notch signaling promotes airway mucous metaplasia and inhibits alveolar development. Development 136, 1751–1759 (2009).
Article CAS Google Scholar
Tsao, P. N. et al. Notch signaling controls the balance of ciliated and secretory cell fates in developing airways. Development 136, 2297–2307 (2009).
Article CAS Google Scholar
Jeong, H. W. et al. Inactivation of Notch signaling in the renal collecting duct causes nephrogenic diabetes insipidus in mice. J. Clin. Invest. 119, 3290–3300 (2009).
CAS PubMed PubMed Central Google Scholar
Stubbs, J. L., Vladar, E. K., Axelrod, J. D. & Kintner, C. Multicilin promotes centriole assembly and ciliogenesis during multiciliate cell differentiation. Nat. Cell Biol. 14, 140–147 (2012).
Article CAS Google Scholar
Chen, J., Knowles, H. J., Hebert, J. L. & Hackett, B. P. Mutation of the mouse hepatocyte nuclear factor/forkhead homologue 4 gene results in an absence of cilia and random left-right asymmetry. J. Clin. Invest. 102, 1077–1082 (1998).
Article CAS Google Scholar
Stubbs, J. L., Oishi, I., Izpisua Belmonte, J. C. & Kintner, C. The forkhead protein Foxj1 specifies node-like cilia in Xenopus and zebrafish embryos. Nat. Genet. 40, 1454–1460 (2008).
Article CAS Google Scholar
Yu, X., Ng, C. P., Habacher, H. & Roy, S. Foxj1 transcription factors are master regulators of the motile ciliogenic program. Nat. Genet. 40, 1445–1453 (2008).
Article CAS Google Scholar
Blomqvist, S. R. et al. Distal renal tubular acidosis in mice that lack the forkhead transcription factor Foxi1. J. Clin. Invest. 113, 1560–1570 (2004).
Article CAS Google Scholar
Blomqvist, S. R., Vidarsson, H., Soder, O. & Enerback, S. Epididymal expression of the forkhead transcription factor Foxi1 is required for male fertility. EMBO J. 25, 4131–4141 (2006).
Article CAS Google Scholar
Dubaissi, E. & Papalopulu, N. Embryonic frog epidermis: a model for the study of cell-cell interactions in the development of mucociliary disease. Dis. Model. Mech. 4, 179–192 (2011).
Article CAS Google Scholar
Hayes, J. M. et al. Identification of novel ciliogenesis factors using a new in vivo model for mucociliary epithelial development. Dev. Biol. 312, 115–130 (2007).
Article CAS Google Scholar
Mariani, M. et al. Two murine and human homologs of mab-21, a cell fate determination gene involved in Caenorhabditis elegans neural development. Hum. Mol. Genet. 8, 2397–2406 (1999).
Article CAS Google Scholar
Sridharan, J., Haremaki, T., Jin, Y., Teegala, S. & Weinstein, D. C. Xmab21l3 mediates dorsoventral patterning in Xenopus laevis. Mech. Dev. 129, 136–146 (2012).
Article CAS Google Scholar
Mir, A. et al. FoxI1e activates ectoderm formation and controls cell position in the Xenopus blastula. Development 134, 779–788 (2007).
Article CAS Google Scholar
Suri, C., Haremaki, T. & Weinstein, D. C. Xema, a foxi-class gene expressed in the gastrula stage Xenopus ectoderm, is required for the suppression of mesendoderm. Development 132, 2733–2742 (2005).
Article CAS Google Scholar
Baldessari, D., Badaloni, A., Longhi, R., Zappavigna, V. & Consalez, G. G. MAB21L2, a vertebrate member of the Male-abnormal 21 family, modulates BMP signaling and interacts with SMAD1. BMC Cell Biol. 5, 48 (2004).
Article Google Scholar
Choy, S. W., Wong, Y. M., Ho, S. H. & Chow, K. L. C. elegans SIN-3 and its associated HDAC corepressor complex act as mediators of male sensory ray development. Biochem. Biophys. Res. Commun. 358, 802–807 (2007).
Article CAS Google Scholar
Chalmers, A. D., Welchman, D. & Papalopulu, N. Intrinsic differences between the superficial and deep layers of the Xenopus ectoderm control primary neuronal differentiation. Dev. Cell 2, 171–182 (2002).
Article CAS Google Scholar
Chalmers, A. D. et al. Grainyhead-like 3, a transcription factor identified in a microarray screen, promotes the specification of the superficial layer of the embryonic epidermis. Mech. Dev. 123, 702–718 (2006).
Article CAS Google Scholar
Tríbulo, C. et al. ΔNp63 is regulated by BMP4 signaling and is required for early epidermal development in Xenopus. Dev. Dyn. 241, 257–269 (2012).
Article Google Scholar
Kageyama, R., Ohtsuka, T. & Kobayashi, T. The Hes gene family: repressors and oscillators that orchestrate embryogenesis. Development 134, 1243–1251 (2007).
Article CAS Google Scholar
You, Y. & Brody, S. L. Culture and differentiation of mouse tracheal epithelial cells. Methods Mol. Biol. 945, 123–143 (2013).
Article Google Scholar
Ross, A. J., Dailey, L. A., Brighton, L. E. & Devlin, R. B. Transcriptional profiling of mucociliary differentiation in human airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 37, 169–185 (2007).
Article CAS Google Scholar
Marcet, B. et al. Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway. Nat. Cell Biol. 13, 693–699 (2011).
Article CAS Google Scholar
Sive, H. L., Grainger, R. M. & Harland, R. M. The Early Development of Xenopus laevis: A Laboratory Manual Cold Spring Harbor Laboratory Press (2000).
Okamoto, K., Fujisawa, J., Reth, M. & Yonehara, S. Human T-cell leukemia virus type-I oncoprotein Tax inhibits Fas-mediated apoptosis by inducing cellular FLIP through activation of NF-kappaB. Genes Cells 11, 177–191 (2006).
Article CAS Google Scholar
Vladar, E. K. & Brody, S. L. Analysis of ciliogenesis in primary culture mouse tracheal epithelial cells. Methods Enzymol. 525, 285–309 (2013).
Article CAS Google Scholar

Download references

Acknowledgements

We thank Y. Takahashi and R. Tadokoro (Kyoto University) for help with confocal fluorescence microscopy and H. Miyoshi (Riken Tsukuba Institute) for lentivirus vectors. We also thank M. Matsuda, T. Araki and members of the Nishida laboratory for technical advice and helpful discussion. This work was supported by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to E.N. and M.K.) and Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology (to E.N.). C.T. is a Research Fellow of the Japan Society for the Promotion of Science. The ae1 monoclonal antibody developed by M. Jennings was obtained from the Developmental Studies Hybridoma Bank under the auspices of the NICHD and maintained by the University of Iowa, Department of Biology, Iowa City, IA 52242, USA.

Author information

Authors and Affiliations

Department of Cell and Developmental Biology, Graduate School of Biostudies, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan
Chika Takahashi, Morioh Kusakabe, Toshiyasu Suzuki, Koichi Miyatake & Eisuke Nishida
JST, CREST, Chiyoda-ku, Tokyo, 102-0075, Japan
Morioh Kusakabe & Eisuke Nishida

Authors

Chika Takahashi
View author publications
You can also search for this author in PubMed Google Scholar
Morioh Kusakabe
View author publications
You can also search for this author in PubMed Google Scholar
Toshiyasu Suzuki
View author publications
You can also search for this author in PubMed Google Scholar
Koichi Miyatake
View author publications
You can also search for this author in PubMed Google Scholar
Eisuke Nishida
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

C.T. and M.K. conceived the study. C.T. designed and performed the experiments with the help of M.K., T.S. and K.M. C.T., M.K., T.S. and E.N. wrote the manuscript. M.K. and E.N. supervised the project. All authors discussed the results and commented on the manuscript.

Corresponding authors

Correspondence to Morioh Kusakabe or Eisuke Nishida.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Information

Supplementary Figures 1-10 (PDF 6727 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Takahashi, C., Kusakabe, M., Suzuki, T. et al. mab21-l3 regulates cell fate specification of multiciliate cells and ionocytes. Nat Commun 6, 6017 (2015). https://doi.org/10.1038/ncomms7017

Download citation

Received: 25 June 2014
Accepted: 02 December 2014
Published: 19 January 2015
DOI: https://doi.org/10.1038/ncomms7017

This article is cited by

La-related protein 6 controls ciliated cell differentiation
- Zarko Manojlovic
- Ryan Earwood
- Yoichi Kato
Cilia (2017)
Structural and biochemical characterization of the cell fate determining nucleotidyltransferase fold protein MAB21L1
- Carina C. de Oliveira Mann
- Reiner Kiefersauer
- Karl-Peter Hopfner
Scientific Reports (2016)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.