Abstract
Plastid-to-nucleus retrograde signals emitted by dysfunctional chloroplasts impact photomorphogenic development, but the molecular link between retrograde- and photosensory-receptor signalling has remained unclear. Here, we show that the phytochrome and retrograde signalling (RS) pathways converge antagonistically to regulate the expression of the nuclear-encoded transcription factor GLK1, a key regulator of a light-induced transcriptional network central to photomorphogenesis. GLK1 gene transcription is directly repressed by PHYTOCHROME-INTERACTING FACTOR (PIF)-class bHLH transcription factors in darkness, but light-activated phytochrome reverses this activity, thereby inducing expression. Conversely, we show that retrograde signals repress this induction by a mechanism independent of PIF mediation. Collectively, our data indicate that light at moderate levels acts through the plant’s nuclear-localized sensory-photoreceptor system to induce appropriate photomorphogenic development, but at excessive levels, sensed through the separate plastid-localized RS system, acts to suppress such development, thus providing a mechanism for protection against photo-oxidative damage by minimizing the tissue exposure to deleterious radiation.
Similar content being viewed by others
Introduction
Interorganellar communication coordinates gene expression of nuclear and organelle genomes and is essential to ensure cell fitness. In some eukaryotes, bidirectional communication between mitochondria and nucleus regulates the processes such as life span (yeast), cell cycle (Drosophila) or tumour progression (animal cells)1. In plants, where the majority of chloroplast components are encoded in the nucleus, anterograde regulation from nucleus to chloroplast and retrograde signalling (RS) from chloroplast to nucleus, are critical to adjust chloroplast biogenesis and photosystem assembly to the prevailing environment and chloroplast status2,3,4. Despite the important implications of RS on cellular function in all organisms, insight into the underlying mechanisms remains sparse.
Deetiolation is the critical switch from skotomorphogenic to photomorphogenic development, triggered in the seedlings emerging from subterranean darkness into sunlight, and is characterized by an extensive transcriptional reprogramming that drives the morphological changes necessary to establish a normal green photosynthetically active seedling5. In the dark, skotomorphogenic seedlings use fast-growing hypocotyls to rapidly reach the soil surface, together with a protective apical hook and appressed cotyledons with undeveloped chloroplasts. In contrast, light inhibits hypocotyl elongation and stimulates cotyledon separation and expansion, congruent with the development of functional chloroplasts, thus enabling light capture for photosynthesis. A subgroup of basic helix-loop-helix transcriptional regulators, termed phytochrome-interacting factors(PIFs), accumulate in the dark and promote skotomorphogenesis through regulation of about 10% of the genes in the genome6. Light exposure activates the phytochrome family of red and far-red light-responsive photoreceptors that directly interact with the PIFs and trigger their proteolytic degradation, thereby redirecting gene expression to drive deetiolation7,8,9. Indicative of the central role of the PIFs in this process, a dark-grown quadruple pifq mutant, deficient in four PIFs (PIF1, PIF3, PIF4 and PIF5), largely phenocopies wild-type (WT) seedlings grown in the light at both the morphological and transcriptional levels. These mutant seedlings display a constitutively photomorphogenic (cop-like) phenotype, which includes partially developed chloroplasts10,11.
On the basis of the phenotypes of plants with induced plastid dysfunctionality, plastid signals have been reported to impact normal light-regulated development12,13,14,15. Although the evidence indicates that RS can repress some aspects of early seedling photomorphogenic development, in addition to affecting chloroplast biogenesis12,13,14,15, mechanistic insight into the connection between the photomorphogenic and RS pathways has been lacking. While many of the components of the phytochrome pathway (PIFs) and the RS pathway (GUN1, GLK1) examined in the present work have been reported in a number of publications9,10,12,16,17,18, here we present data that connect the two in a comprehensive fashion, identifying the molecular framework that integrates the two pathways at a central node at the apex of a transcriptional network that regulates early seedling photomorphogenic development. We show that the phytochrome and the GUN1 RS pathways act antagonistically to control the expression of GLK1, a key transcriptional regulator of photomorphogenesis directly repressed by the PIFs in the dark. Whereas light at moderate levels acts through the phytochrome/PIF sensory-photoreceptor system to induce GLK1 expression and photomorphogenic development, light at excessive levels is sensed by the plastid and represses GLK1 induction and photomorphogenesis through a GUN1-mediated RS mechanism independent of PIF mediation. Our data indicate that RS provides a mechanism for protection against photo-oxidative damage by minimizing the tissue exposure to deleterious radiation.
Results
Retrograde signals suppress PIF-mediated photomorphogenesis
As an experimental system, we treated light-grown seedlings with lincomycin, a drug known to activate RS by inhibiting chloroplast biogenesis19. Strikingly, we found that WT seedlings grown on lincomycin in white light resembled dark-grown seedlings, with long hypocotyls and appressed unexpanded cotyledons that did not accumulate chlorophyll (Fig. 1a,b). This effect was also observed under red light (Supplementary Fig. 1) and after treatment with norflurazon, a herbicide that inhibits carotenoid biosynthesis and causes photo-oxidative damage of chloroplasts in white light20,21 (Supplementary Fig. 2). The effect of lincomycin on the early development of WT seedlings observed here was considerably stronger than in some previous studies12,22. This discrepancy may have resulted from these studies having used seedlings grown on 2% sucrose (which we did not administer in our experiments), or from differences in the light conditions. It is well-documented that exogenous sucrose significantly alters normal light-regulated gene-expression and metabolic-pathway patterns, together with associated deviations in growth and developmental responses23,24,25,26. On the other hand, our findings are similar to, and extend, other studies showing that defects in chloroplast biogenesis produced by mutations in the SIGMA 2 and 6 components of the chloroplast RNA polymerase (which induce RS similarly to lincomycin)27 prevented normal seedling photomorphogenesis under continuous light (Supplementary Fig. 3)28. When we examined the kinetics of the deetiolation process, we found that the rapid cotyledon separation response, normally exhibited by dark-grown WT seedlings upon light exposure, was nearly completely blocked in the presence of lincomycin, consistent with the end point analysis (Fig. 1c). We also observed an inhibitory effect on the rapid hook-opening response, indicating that lincomycin has an early effect on hook development. However, this recovered over time and is not detectable in the end point analysis. These observations suggest that RS activity either pre-exists or can be deployed very rapidly in defective plastids, to prevent the normal light-induced response in the seedling apex, very early during deetiolation. In addition, our results indicate that the effects of RS induced by defects in plastid function, are not confined to chloroplast biogenesis, but rather pleiotropically repress seedling photomorphogenesis in the light15. This conclusion raises the possibility that the informational-light-induced, PIF-mediated transcriptomic changes that normally implement the photomorphogenic programme, in response to activation of the sensory-photoreceptor pathways, might be affected under these conditions. A previous study showing significant overlap between the transcriptomic changes induced by lincomycin and by a shift from low-to-high fluence-rate white- or blue-light14 supports this possibility.
To examine this potential PIF involvement genetically, we analysed pifq mutants in the presence of lincomycin. We reasoned that if the PIF-regulated network is also targeted by RS to inhibit photomorphogenesis in the light, we should detect an effect on the photomorphogenic phenotype induced by the absence of the PIF-quartet in the pifq mutant in the dark. Strikingly, we found that lincomycin does indeed strongly suppress the cop-like phenotype of pifq in the dark (Fig. 1d,e; Supplementary Fig. 4). The drug completely suppressed cotyledon separation in pifq seedlings, sustained hook curvature, and restored cotyledon appression to levels similar to those exhibited by etiolated WT seedlings in darkness. Lincomycin also induced a modest (1 mm) but statistically significant (Student’s t-test) increase in hypocotyl elongation in pifq seedlings compared with the untreated control (see Fig. 1d,e; Supplementary Fig. 4). Partial suppression of the constitutive photomorphogenic phenotype was also observed in dark-grown cop1 seedlings in the presence of lincomycin (Supplementary Fig. 5), in agreement with the notion that the constitutively photomorphogenic phenotype of cop1 in the dark might be caused, in part, by the lower accumulation of PIFs seen in cop1 (ref. 29), and consistent with previous results in pea19. In contrast to lincomycin, norflurazon treatment did not induce RS and did not affect the phenotype of pifq in the dark (Supplementary Fig. 6), in agreement with the fact that light is needed to induce RS in carotenoid-deficient seedlings20,21. In dark-grown WT seedlings, lincomycin did not alter the etiolated phenotype, having only a minor effect on hook curvature (Fig. 1d,e; Supplementary Fig. 4). At the subcellular level, treatment with lincomycin interfered with plastid development in both WT and pifq dark-grown seedlings, preventing the partial differentiation of etioplasts into chloroplasts observed in non-treated pifq seedlings in the dark (Fig. 1f).
RS antagonize the light induction of PIF-repressed genes
Because defects in chloroplast biogenesis activate RS, and activation of RS is well-known to regulate nuclear gene expression14,23, we analysed whether RS might indeed be able to target the PIF-regulated transcriptome during early seedling development. For this purpose, we initially used published data11,23,27. Interestingly, of 871 previously defined red light-induced genes11, 457 (52%) are inhibited in their normal light responsiveness by RS (in agreement with Ruckle et al.14), and of those, 343 (75%) correspond to genes shown previously11 to be repressed by the PIFs in the dark (Fig. 2a; Supplementary Data 1). We labelled these 343 genes as ‘Gene-Set PIF-RS’ (for PIF- and RS-repressed). Moreover, the expression levels of this gene-set in WT seedlings grown in the presence of light and lincomycin resembled those in untreated WT in the dark, indicating that RS is, directly or indirectly, blocking their light responsiveness (Fig. 2b; Supplementary Fig. 7). Importantly, our analysis shows further that this congruent regulation of gene expression by RS and PIFs is strongly selective for light-induced/PIF-repressed genes, because only 19 of the 313 previously identified light-repressed/PIF-induced genes11 were re-induced by lincomycin in light-grown WT seedlings, and their expression level was not restored to WT-dark levels (Supplementary Fig. 8). These results suggest that RS inhibits deetiolation, at least partly, by antagonizing the light-induced expression of a large set of PIF-repressed genes, without altering the normal light-triggered repression of the PIF-induced gene set.
Newly performed RNA-seq-based transcriptomic analysis here of dark-grown, non-drug-treated, WT and pifq seedlings, identified 521 PIF-repressed and 1,826 PIF-induced genes whose expression changed statistically significantly and by at least twofold (SSTF) in 3-day-old pifq seedlings compared with WT in the absence of light (see Supplementary Note 1 for a detailed description of the analysis). Lincomycin strongly, but selectively, reversed this pifq molecular phenotype, extensively and preferentially restoring the status of the PIF-repressed network in the pifq mutant to WT levels (Fig. 2c; Supplementary Note 1), by statistically significantly repressing the expression of 68% (354) of the PIF-repressed SSTF genes (Supplementary Figs 9 and 10; Supplementary Note 1; Supplementary Data 2). This 354-gene set corresponds predominantly to PIF-repressed/light-induced genes that have been shown in previous reports to be downregulated by RS in the light in WT seedlings27, and largely overlaps with the ‘Gene-Set PIF-RS’ defined above (Supplementary Note 1; Supplementary Fig. 11). Interestingly, only 9–13% of the genes in these sets are direct PIF targets (Supplementary Fig. 12)16, suggesting indirect regulation of the majority by the PIFs. The two largest represented groups correspond to chloroplast- and nuclear-localized proteins (Supplementary Fig. 13). These results show that activation of RS in the dark reverses the expression of the transcriptional network induced in pifq, concomitant with the suppression of the cop-like seedling phenotype of the mutant. Altogether, our findings indicate that the RS preferentially targets the PIF-repressed genes in restraining light-induced deetiolation. This conclusion is in contrast to a previous model proposing the converse, namely, that integration of the RS and photoreceptor-mediated light signals was accomplished via informational-light induction of genes that were further induced by the RS14. Moreover, our findings suggest that the RS and informational-light-regulated signalling pathways must converge downstream of the PIFs to antagonistically regulate the initiation of seedling photomorphogenesis. This conclusion is in contrast to a previous model based on small differences detected in hy5 mutants, proposing that the RS ‘rewires’ the light signalling network in a manner that converts informational light from a positive to a negative signal and vice versa, through transforming HY5 from a positive to a negative regulator of gene expression13. Our findings support a model for PIF-regulated genes, in which RS represses the light induction of PIF-repressed genes by a mechanism that acts in the absence of the PIF proteins and, therefore, is independent of any direct RS regulation of PIF transcriptional activity.
GUN1-mediated RS antagonizes PIF-regulated gene expression
To begin to gain further insight into how the RS pathway might converge on the PIF-regulated transcriptional network, we treated light-grown abi4, gun1, gun5 and gun6 mutant seedlings with lincomycin. GUN1 and ABI4 are two major described mediators of the RS pathway23, and GUN5 and GUN6 are involved in plastid-to-nucleus signal transduction21,30. We found that lincomycin prevented full deetiolation of abi4, gun5, and gun6 seedlings in the light, similarly to WT (Fig. 3a,b; Supplementary Figs 14 and 15). However, in striking contrast, gun1 seedlings partially deetiolated in the presence of lincomycin in the light, displaying light-imposed inhibition of hypocotyl elongation and open and expanded cotyledons (Fig. 3a,b; Supplementary Figs 14 and 15). To examine the molecular phenotypes, we assessed the role of GUN1 and ABI4 in the regulation of the expression of the ‘Gene-Set PIF-RS’ defined above. By analysing the available expression data for gun1 and abi4 (ref. 23), we found that these genes responded strongly to lincomycin in WT and abi4, but not in gun1, which displayed gene expression levels in lincomycin-grown seedlings, comparable to those of seedlings not treated with lincomycin (Fig. 3c,d). From these collective data, we conclude that GUN1, but likely not ABI4, GUN5 or GUN6, is necessary for the production, transmission or implementation of the lincomycin-induced RS that inhibits the photoreceptor-mediated, light-induced expression of a subset of light-induced/PIF-repressed genes, thereby repressing seedling photomorphogenesis in the light in response to chloroplast dysfunction.
PIFs and RS antagonistically regulate GLK1 transcription
Because the GUN1 gene does not appear to bind PIFs in its promoter16, and is not a PIF-regulated gene (Supplementary Data 2), phytochrome-mediated light- and plastid-RS signalling must converge downstream of both GUN1 and the PIFs, likely through co-regulation of one or more common target genes. Interestingly, analysis of DNA-binding motifs revealed that the ‘Gene-Set PIF-RS’ is significantly and specifically enriched in the putative GLK-binding site CCAATC (z-score=5.35; Fig. 4a)17. GLK1 is a PIF-repressed gene, which is directly targeted by PIFs in the dark16,31,32 (Supplementary Fig. 16), and that has been proposed to respond to RS downstream of GUN1 (refs 17 and 18). This evidence suggested to us that GLK1 might provide clues to the link between informational-light/PIF and RS/GUN1 signalling. Consistent with this notion, GLK1 expression is induced in light-grown WT seedlings, as well as being upregulated in pifq in the dark11,16. We found also that the expression induced in both conditions was largely suppressed by lincomycin, and in a GUN1-dependent fashion (at least in the light) extending previous findings17 (Fig. 4b). These results indicate that RS acts on or upstream of GLK1. Moreover, a similar expression pattern was observed for a set of 93 genes previously defined as GLK1-induced17 (Fig. 4c). In addition, the PIF-RS gene set is enriched in GLK1-regulated genes, and GLK1-bound genes are enriched in PIF-RS genes (Supplementary Fig. 17). Taken altogether, these results indicate that GLK1 is transcriptionally targeted, in antagonist fashion, by informational-light and GUN1-facilitated-retrograde signals, which induce and repress GLK1 expression, respectively, to regulate a subset of PIF-RS-controlled genes. Our results also indicate that GLK1 is not regulated under these conditions by either ABI4 (Supplementary Fig. 18; in agreement with our findings presented in Fig. 3c,d) or by HY5, which was previously proposed to respond to RS13 (Supplementary Fig. 19).
To test whether the transcriptional regulation of GLK1 by light and RS might be relevant to seedling photomorphogenesis, we examined the phenotype of seedlings with altered GLK1 expression. We reasoned that if GLK1 is a key link regulating photomorphogenesis downstream of both sensory-photoreceptor-mediated light signalling and RS, glk1 mutants should exhibit alterations in response to activation of these pathways. In agreement with this proposal, glk1 seedlings were indistinguishable from the WT in the dark but displayed longer hypocotyls and less separated cotyledons when grown in the light (Fig. 4d; Supplementary Fig. 20), indicating that GLK1 acts positively in seedling photomorphogenic development. Seedlings constitutively expressing GLK1 under the control of the 35 S promoter (GLK1-OX), were similar to WT in the dark although did show slightly shorter hypocotyls (Supplementary Fig. 20b), but, in striking contrast to WT, partially deetiolated in the presence of lincomycin in response to light, as indicated by short hypocotyls, and open and expanded cotyledons (Fig. 4e,f), and displayed high LHCB expression in lincomycin-treated seedlings, similarly to gun1 (Supplementary Fig. 21). In contrast to GLK1, the closely related GLK2 gene appears to have a minor role in this process (Supplementary Fig. 22). These findings extend and refine the previously described role of GLK1 as a regulator of photosynthetic-apparatus-gene expression17, to define it as a previously unrecognized positive factor that acts pleiotropically to orchestrate the broader photomorphogenic programme. Altogether with the evidence that GLK1 is a direct target of PIF-imposed repression, the data support the conclusion that GLK1 is a pivotal target directly at the convergence of the informational-light/PIF and RS/GUN1 signalling pathways. This conclusion implies strongly in turn, that the GUN1-facilitated, RS-imposed repression of the light-induced expression of GLK1, that is otherwise necessary for deetiolation, provides a mechanism to attenuate seedling photomorphogenesis in the event of chloroplast disruption. Such disruption has been shown to activate RS under natural environments triggered by excess light33,34, highlighting the likely biological significance of this proposed attenuation mechanism.
High-intensity light inhibits PIF-mediated deetiolation
To investigate the proposed mechanism and the role of PIF-RS-regulated GLK1 expression more closely, we examined the consequences of exposing dark-grown seedlings to RS-inducing high light intensity (high light, 310 μmols m−2 s−1; Supplementary Fig. 23), compared with lower light levels (130 μmols m−2 s−1, defined here as ‘low light’ for convenience). Under high light intensity, we detected GUN1-mediated repression of deetiolation within 3 h (Fig. 5a,b), consistent with the effect of lincomycin on early deetiolation responses to the dark-to-low light transition (Fig. 1c). Under these conditions, we observed that the rapid, low light induction of GLK1 expression was significantly reduced by high light intensity, whereas induction levels of GLK1 expression in gun1 were similar in low and high light (Fig. 5c, Supplementary Fig. 24). This result suggests that high light intensities can antagonize the low-light induction of GLK1 expression, at least in part through GUN1-mediated RS. In agreement with this conclusion, analysis of the available data35 indicates that high light intensities prevent the informational low-light induction of GLK1-induced genes, a behaviour that is similar for the genes in ‘Gene-Set PIF-RS’ or the genes whose light-induction is inhibited by RS (Fig. 5d). Because PIF3 levels in the WT and gun1 were below the level of detection in both low and high light (Fig. 5e), and pifq deetiolation and GLK1 induction was slower under high light than low light (Supplementary Fig. 25), our findings collectively support the notion that GLK1 expression under high light is repressed in a PIF-independent fashion by a GUN1-facilitated pathway, to antagonize the light induction of the photomorphogenic programme. Moreover, in agreement with the role we propose for GLK1 as downstream effector of both informational-light and RS, we found that GLK1-OX seedlings were largely insensitive to high light intensity and underwent deetiolation similarly in both low and high light (Fig. 5f). On the basis of these assembled data, we conclude that activation of GUN1-mediated RS by high light during early deetiolation represses informational-light-induced derepression of GLK1, attenuating hook unfolding and cotyledon separation. This might protect the seedling by minimizing the exposed cotyledon surface to avoid excess light damage, adding to other high light-induced strategies like excess light dissipation33,36. Consistent with this notion, survival of gun1 mutants during deetiolation under high light is significantly poorer than WT13,37.
Discussion
Our findings support a mechanistic model (Fig. 6), whereby the PIFs directly repress GLK1 expression in the dark to support skotomorphogenesis. In the light, phytochrome-induced degradation of the PIFs relieves the repression of GLK1 expression and this permits initiation of photomorphogenic development, as long as the plastid is functionally intact, through GLK1 regulation of photosynthetic genes17 and potentially of as yet undefined genes involved in the regulation of other facets of photomorphogenesis (putative ‘Gene(s) X’ in Fig. 6). In conditions where the plastid is damaged, RS is activated and antagonizes the phytochrome-signal output by repressing the light-induced derepression of GLK1, through a GUN1-facilitated, PIF-independent pathway, which effectively attenuates normal photomorphogenesis for the purpose of protecting the seedling. According to this model, whereas the phytochrome/PIF system monitors dark-light transitions, as well as light quality and periodicity, to optimize light-regulated development, the chloroplast functions as a sensor of excess light (at levels where the phytochrome/PIF system is saturated), to prevent potentially irreversible damage. Hence, coincidence of external light stimuli and internal chloroplast integrity is necessary to promote photomorphogenesis.
Activation of RS has been proposed, alternately, to involve both positively and negatively acting configurations30,38. In principle, our data are consistent with either possibility, in which lincomycin would, respectively, either (a) disrupt a positive intact-plastid-emitted signal, which acts in a GUN1-regulated manner and is necessary for the expression of GKL1 following derepression by PIF removal, or (b) induce a negative plastid-emitted signal, which acts to repress the nuclear transcription of GLK1 in a GUN1-mediated manner (Fig. 6). In either configuration, our observation that the cop-like phenotype of pifq is suppressed by lincomycin in the dark suggests that activation of RS by plastid malfunction is independent of light, consistent with previous reports of RS activity in darkness19,27. Although the mechanism by which RS repress light-induced derepression of GLK1 expression remains unknown, our results establish that the process requires GUN1, is independent of the PIFs, and does not appear to involve GUN5, GUN6 or ABI4 (in agreement with Kakizaki et al.18), and might involve regulation at the transcriptional and/or post-transcriptional levels through a factor or factors (‘A’ in our model in Fig. 6) of yet unknown nature.
Methods
Plant materials and growth conditions
Arabidopsis thaliana seeds used in these studies have been described elsewhere, including pifq (ref. 10), glk1.1 (ref. 39), GLK1-OX and GLK2-OX lines (ref. 40), abi4-t (ref. 41), gun5-1 (ref. 21), gun6-1D (ref. 30), cop1-4 (ref. 42) and hy5-215 (ref. 43), all in the Columbia (Col-0) ecotype, and sigma2-1 (ref. 44) and sigma6 (soldat8; ref. 45) in the WS and Ler and ecotypes, respectively. The newly described gun1 allele (gun1-201) corresponds to insertion line SAIL_290_D09 obtained from ABRC (Supplementary Fig. 26). Seeds were sterilized and plated on medium without sucrose as described46. Seedlings were then stratified for 4 days at 4 °C in darkness, and then placed under continuous white light (1 μmol m−2 s−1), red light (1.3 μmol m−2 s−1) or darkness for 3 days, except in experiments shown in Fig. 1c, performed using a white light intensity of 25 μmol m−2 s−1, and in Fig. 5, performed using a combination of red (60%) and blue (40%) light, where Light corresponds to 130 μmol m−2 s−1 and High light to 310 μmol m−2 s−1. Fluence rates were measured with a Spectrosense2 metre associated with a 4-channel sensor47. For lincomycin treatments, media was supplemented with 0.5 mM lincomycin (Sigma L6004) or as indicated (Supplementary Fig. 4)19. For norflurazon treatment, media was supplemented with 5 uM norflurazon (Novartis 100–848-AA). To measure hypocotyl length, hook angle and cotyledon angle and area, seedlings were arranged horizontally on a plate and photographed using a digital camera (Nikon D80). Measurements were performed using NIH Image software (Image J, National Institutes of Health)48. At least 25 seedlings were measured to calculate the mean and s.e.m. in at least two biological replicates. In Supplementary Fig. 25, the response to light was measured in individual pifq seedlings across time.
Gene expression analysis
Quantitative RT–PCR, RNA extraction, cDNA synthesis and qRT–PCR were done as described48. Briefly, 1 μg of total RNA extracted using the RNeasy Plant Mini Kit (Qiagen) were treated with DNase I (Ambion) according to the manufacturer’s instructions. First-strand cDNA synthesis was performed using the SuperScript III reverse transcriptase (Invitrogen) and oligo dT as a primer (dT30). cDNA was then treated with RNase Out (Invitrogen) before 1:20 dilution with water, and 2 μl was used for real-time PCR (Light Cycler 480; Roche) using SYBR Premix Ex Taq (Takara) and primers at a 300 nM concentration. Gene expression was measured in three independent biological replicates (with the exception of Supplementary Fig. 6b (one), Supplementary Fig. 23 (four) and Supplementary Figs 24 and 25 (two)), in at least three technical replicates for each biological sample. PP2A (AT1G13320) was used for normalization49. Primers used to analyse LHCB1.4 (AT2G34430) and LHCB2.2 (AT2G05070) were described previously10,27. GLK1 (AT2G20570) expression was measured using primers 5′- GCTACGAGATTTAGAGCACCG -3′ and 5′- TTGACGGATGTAAGTCTACCG -3′, and GUN1 (AT2G31400) expression using primers 5′- TGAGTATATTGACTGGCTGGG -3′ and 5′- GCATTTTGACAGGTGGAATGG -3′.
RNA-seq library construction and data processing
Total RNA from 3-day-old dark-grown seedlings was extracted using QIAshredder columns and the RNeasy Plus Mini Kit (Qiagen). RNA-seq libraries were prepared using Illumina’s directional mRNA-seq sample preparation following the manufacturer’s protocol with some modifications. The mRNA was purified from 20 μg of total RNA using Dynabeads Oligo (dT)25 (Invitrogen) and fragmented using Fragmentation Reagents (Ambion). The resulting polyA-tailed 3′-end fragments were captured using Dynabeads Oligo (dT)25 (Invitrogen), and then treated by Antarctic Phosphatase (NEB) and T4 Polynucleotide Kinase (NEB). The sample was purified using RNeasy MinElute Cleanup Kit (Qiagen) and Illumina's SRA 5′-adaptor was ligated to the eluted mRNA fragments by T4 RNA Ligase 1 (NEB). Reverse transcription was performed using the SuperScript III First-Strand Synthesis System (Invitrogen) and the 3′-cDNA adaptor derived from Illumina’s v1.5 sRNA 3′-adaptor conjugated with the anchored oligo (dT)20 primer. The first-strand cDNA was purified using the Agencourt AMPure XP system. The second-strand cDNA was synthesized and amplified by PCR using Phusion High-Fidelity DNA Polymerase with Illumina's sRNA PCR primer set. The library was purified using the Agencourt AMPure XP system and the size was validated by Bioanalyzer 2000 (ref. 50). Libraries from triplicate biological samples were sequenced on the Illumina HiSeq platform. Reads were aligned to the TAIR10 representative transcriptome using Bowtie51 with one mismatch allowed. To prevent false counts, mapping was performed using the 3′-end 500-bp region of the coding strand. Differentially expressed genes were identified using the edgeR package52 among those genes in which at least 2 of the 6 samples being compared had⩾5 reads per million. SS genes were defined as those that differ with a P value≤0.05 (adjusted for false-discovery rate), and SSTF genes as those that differ by more than or equal to twofold with a P value≤0.01 (adjusted for false-discovery rate)11 (Supplementary Fig. 27).
Microarray data comparison and transcript analysis
Expression data shown in Figs 2b, 3c,d and 4c, and Supplementary Figs 8b, 11b and 18b, were obtained from microarray data from GSE5770 (ref. 23) and GSE17159 (ref. 11). As a control, gene expression in the shared WT Light sample from the two experiments were first compared in each subgroup of genes analysed in each figure to validate that there were no statistically significant differences and thus the rest of the samples were comparable. Represented WT light values in Figs 2b and 4c, and Supplementary Figs 8b, 11b and 18b, are from ref. 23. Expression data shown in Fig. 5d were obtained from GSE7743 (ref. 35).
Promoter analysis for DNA-binding motifs
Analysis was performed using the ‘Motif Analysis’ tool available at The Arabidopsis Information Resource (http://Arabidopsis.org/tools/bulk/motiffinder/index.jsp) for statistically overrepresented 6-mer motifs in the 500-bp genomic sequence upstream of the start codon of genes in gene-set PIF-RS, the SCOPE motif finder (http://genie.dartmouth.edu/scope/), and the Arabidopsis Gene Regulatory Information Server ‘Agris’ (http://arabidopsis.med.ohio-state.edu/AtTFDB/).
Statistics
Gene expression and morphological data shown in Figs 1b, 4 and 5c, and Supplementary Figs 2, 5b, 6c, 7, 14b, 15b, 18a, 19a, 22b, 24 and 25b, were analysed by one-way analysis of variance, and the differences between means were evaluated using Tukey-b post hoc multiple comparison test (IBM SPSS Statistics Software). Statistically significant differences were defined as those with a P value<0.05. Morphological and expression data were analysed using Excel (Microsoft) for statistically significant differences from their control. P values were determined by homoscedastic Student’s t-test for data in Figs 1c, 4b,d and 5a,f, and Supplementary Figs 1b, 4, 6b, 20, 21, 22c, 25a and 26b, and WT and pifq in Fig. 1e, and by heteroscedastic Student’s t-test for data in Figs 2b, 3c and 4c, and Supplementary Figs 8b and 18b. Statistically significant differences were defined as those with a P value<0.05. In the figures significance level is indicated as *P<0.05, **P<0.01 and ***P<0.001. Hypergeometric tests shown in Fig. 4a and Supplementary Fig. 17 were performed using R.
Protein extraction and immunoblots
Protein extracts were prepared from 2-day-old dark-grown WT and gun1 seedlings transferred to white light for the time and light intensities indicated in Fig. 5e. Tissue samples were collected and frozen in liquid nitrogen, and samples were manually ground under frozen conditions before resuspension in extraction buffer. Protein extraction was performed in boiling extraction buffer (100 mM MOPS (pH 7.6), 2% SDS, 10% glycerol, 4 mM EDTA, 2 g l−1 aprotinin, 3 g l−1 leupeptin, 1 g l−1 pepstatin and 2 mM PMSF). Total protein was quantified using a Protein DC kit (Bio-Rad), and β-mercaptoethanol was added just before loading53. Aliquots from each sample containing equal amounts of total protein (150 μg) were subjected to 7.5% SDS-PAGE gels. Proteins were then transferred to Immobilon-P membrane (Millipore), and immunodetection of endogenous PIF3 was performed as previously detailed54 using a rabbit anti-PIF3 polyclonal antibody55 (1:10,000 dilution) incubated with Hikari solution (Nacalai Tesque). Peroxidase-linked anti rabbit secondary antibody (1:5,000 dilution; Amersham Biosciences NA934) and a SuperSignal West Femto chemiluminescence kit (Pierce) were used for detection of luminescence using LAS-4000 Image imaging system (Fujifilm). The membrane was stained with Coomassie blue as a loading control. The uncropped scan of the western blot shown in Fig. 5e is provided in Supplementary Fig. 28.
Transmission electron microscopy
Cotyledons from 3-day-old dark-grown seedlings were fixed and processed as described in ref. 11, except that a Leica EM PACT2-RTS high-pressure freezing machine (Leica Microsystems, Vienna, Austria) was used for the high-pressure freezing method. Ultrathin sections were visualized in a Jeol JEM1010 electron microscope (JEOL Ltd, Akishima, Tokyo, Japan). Images were recorded with a SIS Mega View III CCD camera.
Additional information
Accession codes: RNA-seq data reported in this study have been deposited in the Gene Expression Omnibus database under the accession number GSE78969.
How to cite this article: Martín, G. et al. Phytochrome and retrograde signalling pathways converge to antagonistically regulate a light-induced transcriptional network. Nat. Commun. 7:11431 doi: 10.1038/ncomms11431 (2016).
Accession codes
References
Butow, R. A. & Avadhani, N. G. Mitochondrial signalling: the retrograde response. Mol. Cell 14, 1–15 (2004) .
Pogson, B. J., Woo, N. S., Förster, B. & Small, I. D. Plastid signalling to the nucleus and beyond. Trends Plant Sci. 13, 602–609 (2008) .
Jarvis, P. & López-Juez, E. Biogenesis and homeostasis of chloroplast and other plastids. Nat. Rev. Mol. Cell Biol. 14, 787–802 (2013) .
Chi, W., Sun, X. & Lixin, Z. Intracellular signalling from plastid to nucleus. Annu. Rev. Plant Biol. 64, 559–582 (2013) .
Jiao, Y., Lau, O. S. & Deng, X. W. Light-regulated transcriptional networks in higher plants. Nat. Rev. Genet. 8, 217–230 (2007) .
Leivar, P. & Monte, E. PIFs: systems integrators in plant development. Plant Cell 26, 56–78 (2014) .
Rockwell, N. C., Su, Y.-S. & Lagarias, J. C. Phytochrome structure and signalling mechanisms. Annu. Rev. Plant Biol. 57, 837–858 (2006) .
Monte, E. et al. The phytochrome-interacting transcription factor, PIF3, acts early, selectively, and positively in light-induced chloroplast development. Proc. Natl Acad. Sci. USA 101, 16091–16098 (2004) .
Ni, W. et al. A mutually assured destruction mechanism attenuates light signalling in Arabidopsis. Science 344, 1160–1164 (2014) .
Leivar, P. et al. Multiple phytochrome-interacting bHLH transcription factors repress premature photomorphogenesis during early seedling development in darkness. Curr. Biol. 18, 1815–1823 (2008) .
Leivar, P. et al. Definition of early transcriptional circuitry involved in light-induced reversal of PIF-imposed repression of photomorphogenesis in young Arabidopsis seedlings. Plant Cell 21, 3535–3553 (2009) .
Ruckle, M. E. & Larkin, R. M. Plastid signals that affect photomorphogenesis in Arabidopsis thaliana are dependent on genomes uncoupled 1 and cryptochrome 1. New Phytol. 182, 367–379 (2009) .
Ruckle, M. E., DeMarco, S. M. & Larkin, R. M. Plastid signals remodel light signalling networks and are essential for efficient chloroplast biogenesis in Arabidopsis. Plant Cell 19, 3944–3960 (2007) .
Ruckle, M. E., Burgoon, L. D., Lawrence, L. A., Sinkler, C. A. & Larkin, R. M. Plastids are major regulators of light signalling in Arabidopsis. Plant Physiol. 159, 366–390 (2012) .
Larkin, R. M. Influence of plastids on light signalling and development. Philos. Trans. R. Soc. London Ser. B 369, 20130232 (2014) .
Pfeiffer, A., Shi, H., Tepperman, J. M., Zhang, Y. & Quail, P. H. Combinatorial complexity in a transcriptionally centered signalling hub in Arabidopsis. Mol. Plant 7, 1598–1618 (2014) .
Waters, M. T. et al. GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis. Plant Cell 21, 1109–1128 (2009) .
Kakizaki, T. et al. Coordination of plastid protein import and nuclear gene expression by plastid-to-nucleus retrograde signalling. Plant Physiol. 151, 1339–1353 (2009) .
Sullivan, J. A. & Gray, J. C. Plastid translation is required for the expression of nuclear photosynthesis genes in the dark and in roots of the pea lip1 mutant. Plant Cell 11, 901–910 (1999) .
Oelmüller, R., Levitan, I., Bergfeld, R., Rajasekhar, V. K. & Mohr, H. Expression of nuclear genes as affected by treatments acting on the plastids. Planta 168, 482–492 (1986) .
Susek, R. E., Ausubel, F. M. & Chory, J. Signal transduction mutants of arabidopsis uncouple nuclear CAB and RBCS gene expression from chloroplast development. Cell 74, 787–799 (1993) .
Cottage, A., Mott, E. K., Kempster, J. A. & Gray, J. C. The Arabidopsis plastid-signalling mutant gun1 (genomes uncoupled1) shows altered sensitivity to sucrose and abscisic acid and alterations in early seedling development. J. Exp. Bot. 61, 3773–3786 (2010) .
Koussevitzky, S. et al. Signals from chloroplasts converge to regulate nuclear gene expression. Science 316, 715–719 (2007) .
Dijkwel, P. P., Kock, P. A. M., Bezemer, R., Weisbeek, P. J. & Smeekens, S. C. M. Sucrose represses the developmentally controlled transient activation of the plastocyanin gene in Arabidopsis thaliana seedlings. Plant Physiol. 110, 455–463 (1996) .
Stewart, J. L., Maloof, J. N. & Nemhauser, J. L. PIF genes mediate the effect of sucrose on seedling growth dynamics. PLoS ONE 6, e19894 (2011) .
Graham, I. A. Seed storage oil mobilization. Annu. Rev. Plant Biol. 59, 115–142 (2008) .
Woodson, J. D., Perez-Ruiz, J. M., Schmitz, R. J., Ecker, J. R. & Chory, J. Sigma factor-mediated plastid retrograde signals control nuclear gene expression. Plant J. 73, 1–13 (2013) .
Oh, S. & Montgomery, B. L. Phytochrome-induced SIG2 expression contributes to photoregulation of phytochrome signalling and photomorphogenesis in Arabidopsis thaliana. J. Exp. Bot. 64, 5457–5472 (2013) .
Bauer, D. et al. Constitutive photomorphogenesis 1 and multiple photoreceptors control degradation of phytochrome interacting factor 3, a transcription factor required for light signalling in Arabidopsis. Plant Cell 16, 1433–1445 (2004) .
Woodson, J. D., Perez-Ruiz, J. M. & Chory, J. Heme synthesis by plastid ferrochelatase I regulates nuclear gene expression in plants. Curr. Biol. 21, 897–903 (2011) .
Song, Y. et al. Age-triggered and dark-induced leaf senescence require the bHLH transcription factors PIF3, 4, and 5. Mol. Plant 7, 1776–1787 (2014) .
Oh, E., Zhu, J.-Y. & Wang, Z.-Y. Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses. Nat. Cell Biol. 14, 802–809 (2012) .
Gordon, M. J., Carmody, M., Albrecht, V. & Pogson, B. Systemic and local responses to repeated HL stress-induced retrograde signalling in Arabidopsis. Front. Plant Sci. 3, 303 (2013) .
Szechyńska-Hebda, M. & Karpiński, S. Light intensity-dependent retrograde signalling in higher plants. J. Plant Physiol. 170, 1501–1516 (2013) .
Kleine, T., Kindgren, P., Benedict, C., Hendrickson, L. & Strand, Ã. Genome-wide gene expression analysis reveals a critical role for CRYPTOCHROME1 in the response of Arabidopsis to high irradiance. Plant Physiol. 144, 1391–1406 (2007) .
Müller, P., Li, X. & Niyogi, K. K. Non-photochemical quenching. a response to excess light energy. Plant Physiol. 125, 1558–1566 (2001) .
Mochizuki, N., Susek, R. & Chory, J. An intracellular signal transduction pathway between the chloroplast and nucleus is involved in de-etiolation. Plant Physiol. 112, 1465–1469 (1996) .
Lee, K. P., Kim, C., Landgraf, F. & Apel, K. EXECUTER1- and EXECUTER2-dependent transfer of stress-related signals from the plastid to the nucleus of Arabidopsis thaliana. Proc. Natl Acad. Sci. USA 104, 10270–10275 (2007) .
Fitter, D. W., Martin, D. J., Copley, M. J., Scotland, R. W. & Langdale, J. A. GLK gene pairs regulate chloroplast development in diverse plant species. Plant J. 31, 713–727 (2002) .
Waters, M. T., Moylan, E. C. & Langdale, J. A. GLK transcription factors regulate chloroplast development in a cell-autonomous manner. Plant J. 56, 432–444 (2008) .
Shu, K. et al. ABI4 regulates primary seed dormancy by regulating the biogenesis of abscisic acid and gibberellins in Arabidopsis. PLoS Genet. 9, e1003577 (2013) .
Deng, X.-W. & Quail, P. H. Genetic and phenotypic characterization of cop1 mutants of Arabidopsis thaliana. Plant J. 2, 83–95 (1992) .
Oyama, T., Shimura, Y. & Okada, K. The Arabidopsis HY5 gene encodes a bZIP protein that regulates stimulus-induced development of root and hypocotyl. Genes Dev. 11, 2983–2995 (1997) .
Shirano, Y. et al. Chloroplast development in Arabidopsis thaliana requires the nuclear-encoded transcription factor Sigma B. FEBS Lett. 485, 178–182 (2000) .
Coll, N. S., Danon, A., Meurer, J., Cho, W. K. & Apel, K. Characterization of soldat8, a suppressor of singlet oxygen-induced cell death in Arabidopsis seedlings. Plant Cell Physiol. 50, 707–718 (2009) .
Monte, E. et al. Isolation and characterization of phyC mutants in Arabidopsis reveals complex crosstalk between phytochrome signalling pathways. Plant Cell 15, 1962–1980 (2003) .
Martínez-García, J. F. et al. The shade avoidance syndrome in Arabidopsis: the antagonistic role of phytochrome A and B differentiates vegetation proximity and canopy shade. PLoS ONE 9, e109275 (2014) .
Sentandreu, M. et al. Functional profiling identifies genes involved in organ-specific branches of the PIF3 regulatory network in Arabidopsis. Plant Cell 23, 3974–3991 (2011) .
Shin, J., Park, E. & Choi, G. PIF3 regulates anthocyanin biosynthesis in an HY5-dependent manner with both factors directly binding anthocyanin biosynthetic gene promoters in Arabidopsis. Plant J. 49, 981–994 (2007) .
Zhang, Y. et al. A quartet of PIF bHLH factors provides a transcriptionally centered signalling Hub that regulates seedling morphogenesis through differential expression-patterning of shared target genes in Arabidopsis. PLoS Genet. 9, e1003244 (2013) .
Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25–R25 (2009) .
Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140 (2009) .
Leivar, P. et al. The Arabidopsis phytochrome-interacting factor PIF7, together with PIF3 and PIF4, regulates responses to prolonged red light by modulating phyB levels. Plant Cell 20, 337–352 (2008) .
Soy, J. et al. Phytochrome-imposed oscillations in PIF3 protein abundance regulate hypocotyl growth under diurnal light/dark conditions in Arabidopsis. Plant J. 71, 390–401 (2012) .
Al-Sady, B., Ni, W., Kircher, S., Schäfer, E. & Quail, P. H. Photoactivated phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated degradation. Mol. Cell 23, 439–446 (2006) .
Acknowledgements
We thank J. Langdale, J. Chory, Q. Xie, N. Sánchez-Coll and G. Toledo-Ortiz for materials, and M. Rodríguez-Concepción and G. Toledo-Ortiz for comments on the manuscript. We also thank the European Arabidopsis Biological Stock Center for the Arabidopsis T-DNA insertion lines. This work was supported by grants from the Spanish ‘Ministerio de Ciencia e Innovación’ BIO2009-07675, ‘Ministerio de Economía’ BIO2012-31672, ‘Ministerio de Educación, Cultura y Deporte’ PRX12/00631, and from the Generalitat de Catalunya 2009-SGR-206 to E.M.; by ‘Comissionat per a Universitats i Recerca del Departament d’Innovació, Universitats i Empresa’ fellowship from the Generalitat de Catalunya (Beatriu de Pinós programme) and Marie Curie IRG PIRG06-GA-2009-256420 grant to P.L.; by grant from ‘Ministerio de Economía’ BIO2012-31860 to D.L.; and by grants from the National Institutes of Health (NIH; 2R01 GM-047475) and USDA ARS Current Research Information System (5335-21000-032-00D) to P.H.Q.
Author information
Authors and Affiliations
Contributions
G.M., P.L. and E.M. designed the study; G.M., P.L., D.L., J.M.T. and E.M. performed the research; G.M., P.L., P.H.Q. and E.M. wrote the paper. All the authors analysed the data, discussed the results and made comments on the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Supplementary information
Supplementary Figures and Note
Supplementary Figures 1-28 and Supplementary Note 1 (PDF 16755 kb)
Supplementary Data Set 1
Analysis and expression data of genes co-regulated by Retrograde Signaling, Light treatment and PIF transcription factors. Co-regulation is reported in Fig. 2a and Supplementary Fig. 8a. PIF and Light regulated genes were defined previously in 11. Retrograde Signaling regulated genes were previously reported in 27. Expression data was obtained from GSE17159 and GSE5770 respectively and are shown in Figs 2b, 3c,d and 4c, and Supplementary Figs 8b, 11b, and 18b. PIF bound genes were defined previously in 16. Subcellular localization is obtained from subcellular predictions available in TAIR (http://www.Arabidopsis.org). (XLS 1039 kb)
Supplementary Data Set 2
PIF and Lincomycin regulated genes in 3 day-old dark-grown seedlings. List of SSTF genes defined as those that differ by ≥2-fold with P values (adjusted for false discovery rate) ≤0.05 in WT dark vs pifq dark, and SS genes, set as those expressed statistically significantly different with P values (adjusted for false discovery rate) ≤0.05, comparing pifq dark VS pifq dark Lincomycin. Expression data are shown in Fig. 2c, and Supplementary Figs 9, 10, and 11b. PIF bound and Retrograde Signaling (RS) regulated genes were defined previously in 16 and 27 respectively. Subcellular localization is obtained from subcellular predictions available in TAIR (http://www.Arabidopsis.org) (XLS 742 kb)
Supplementary Data Set 3
Lincomycin-regulated genes in 3 day-old dark-grown WT and pifq seedlings. List of SSTF genes defined as those that differ by ≥2-fold with P values ≤0.01 (adjusted for false discovery rate, FDR) in WT dark vs WT dark lincomycin or pifq dark vs pifq dark lincomycin. This analysis is reported in Supplementary Fig. 27. Retrograde signaling (RS)-regulated genes were defined previously in 27. (XLS 276 kb)
Rights and permissions
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
About this article
Cite this article
Martín, G., Leivar, P., Ludevid, D. et al. Phytochrome and retrograde signalling pathways converge to antagonistically regulate a light-induced transcriptional network. Nat Commun 7, 11431 (2016). https://doi.org/10.1038/ncomms11431
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/ncomms11431
This article is cited by
-
Natural genetic variation in GLK1-mediated photosynthetic acclimation in response to light
BMC Plant Biology (2024)
-
BPG4 regulates chloroplast development and homeostasis by suppressing GLK transcription factors and involving light and brassinosteroid signaling
Nature Communications (2024)
-
Identification and function analysis of yellow-leaf mutant (YX-yl) of broomcorn millet
BMC Plant Biology (2022)
-
RCB initiates Arabidopsis thermomorphogenesis by stabilizing the thermoregulator PIF4 in the daytime
Nature Communications (2021)
-
Induction of TOC and TIC genes during photomorphogenesis is mediated primarily by cryptochrome 1 in Arabidopsis
Scientific Reports (2020)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.