Table 3: Dissociation constants of T-STAR and Sam68 STAR and QUA1-KH domains to SELEX-derived AU-rich RNAs determined by fluorescence polarization.

From: Structural basis of RNA recognition and dimerization by the STAR proteins T-STAR and Sam68

Kd (μM)T-STARSam68
 STARQUA1-KHSTARQUA1-KH
G8.511.78.136.110.3
G7.15.44.58.24.3
SRE-48.59.465.719.1
Nrxn21.11.73.72.2
  1. G8.5: CUGGGUGACACACUAGCUAUAGCAUUAAAAGACCGAGCAAGU.
  2. G7.1: UCCGGAUUGGCCUAAAUAGAUGCGCGAUAAUAAUAGAGUA.
  3. SRE-4: UUUGGGGGUUCAAUAAAAAUUUUCACUAUCCUAUUAACAGUUCCGCCGCUCC.
  4. Nrxn2: CCCAAUUAACUAACUAACUAACUUUAAAA.