Retinoblastoma protein and anaphase-promoting complex physically interact and functionally cooperate during cell-cycle exit

  • A Corrigendum to this article was published on 01 March 2007

Abstract

The retinoblastoma protein (pRB) negatively regulates the progression from G1 to S phase of the cell cycle, in part, by repressing E2F-dependent transcription1. pRB also possesses E2F-independent functions that contribute to cell-cycle control — for example, during pRB-mediated cell-cycle arrest pRB associates with Skp2, the F-box protein of the Skp1–Cullin–F-box protein (SCF) E3 ubiquitin ligase complex, and promotes the stability of the cyclin-dependent kinase-inhibitor p27Kip1 through an unknown mechanism2,3. Degradation of p27Kip1 is mediated by ubiquitin-dependent targeting of p27Kip1 by SCF –Skp2 (ref. 4). Here, we report a novel interaction between pRB and the anaphase-promoting complex/cyclosome (APC/C) that controls p27Kip1 stability by targeting Skp2 for ubiquitin-mediated degradation. Cdh1, an activator of APC/C, not only interacts with pRB but is also required for a pRB-induced cell-cycle arrest. The results reveal an unexpected physical convergence between the pRB tumour-suppressor protein and E3 ligase complexes, and raise the possibility that pRB may direct APC/C to additional targets during pRB-mediated cell-cycle exit.

Main

Mutation of the Rb gene confers an inheritable predisposition to cancer5. pRB is a negative regulator of cell-cycle progression and functions, at least in part by repressing the transcription of E2F-regulated genes. In addition, pRB causes a sustained accumulation of p27Kip1, which does not involve transcriptional changes at the p27Kip1 promoter and does not require pRB association with E2F2,3. Stabilization of p27Kip1 contributes to the ability of pRB to induce cell-cycle arrest, differentiation and senescence2,3,6. Several studies have shown that p27Kip1 expression is an important prognostic marker in human cancers7. Precisely how pRB causes p27Kip1 to accumulate during G1 arrest is not well understood.

We used a GST–pRB-affinity column and mass spectrometry to identify proteins, in addition to E2F and chromatin-remodelling factors, that associate with pRB. Surprisingly, nearly every subunit of the APC/C8 specifically bound to pRB. The presence of ten APC/C subunits was identified by multiple peptides (see Supplementary Information, Table S1), and association between pRB and APC/C was confirmed by immunoblotting (Fig.1a). APC/C genetically interacts with the pRb orthologue lin-35 in Caenorhabditis elegans9, but has not previously been physically linked to pRB.

Figure 1: pRB, but not p107 and p130, associates with APC/Ccdh1.
figure1

Affinity purification of pRB-associated cellular proteins from HeLa cell nuclear extract. Proteins were bound to a large pocket (amino acids 379–928) GST–pRB construct (GST–RBLP). (a) Verification of pRB-associated APC/C subunits: input, 2% input; pRB, GST–RBLP; GST, GST alone; −/+ NE, HeLa cell nuclear extract. DP1 serves as a positive and Cdc6 as a negative control. (b) pRB-associated proteins were eluted under native conditions and separated by a glycerol gradient. Fractions were taken and analysed for comigrating APC/C subunits. (c) Large pocket GST-fusion proteins of pRB, p107 and p130 were incubated with HeLa cell nuclear extracts to test APC/C binding. DP1 (from HeLa cell nuclear extracts) and E1A (from HEK293 whole-cell extracts) serve as positive controls. (d) Myc-tagged pRB, p107 and p130 (Myc–PP, pocket protein) were transiently cotransfected with untagged Cdc27 in U2OS cells and harvested after 24 h to verify in vivo association. Cdc27 was coimmunoprecipitated using anti-Myc antibodies. Uncropped images of the gels are shown in the Supplementary Information, Fig. S6a–d.

The APC/C core complex associates with two WD-40 repeat-containing activator proteins, Cdc20 (also know as fizzy/fzy and p55 CDC) and Cdh1 (also known as fizzy-related/fzr), in a cell cycle-dependent manner8. Although exponentially growing HeLa cells contain both APC/C activator proteins, Cdc20 and Cdh1, recombinant pRB displays a strong preference for the G1 phase activator protein Cdh1 (Fig. 1a).

To verify that pRB binds to the intact APCcdh1 complex, GST–pRB-associated proteins were eluted from the column and separated on a glycerol gradient. pRB-associated APCcdh1 components migrated as a single complex of high molecular mass and fractionated away from other pRB binding partners such as E2F and DP1 (Fig. 1b, and data not shown).

pRB and the two other members of the pocket protein family, p107 and p130, are defined by a conserved protein domain — the so called 'pocket' — which mediates protein–protein interactions10. p107 and p130 differ from pRB in that their overexpression does not cause sustained p27Kip1 protein accumulation2. Interestingly, neither p107 nor p130 displayed any affinity for APC/C subunits in binding assays in vitro (Fig. 1c) or in vivo (Fig. 1d), indicating that the interaction with APC/C is a unique property of pRB.

Cdh1 and Cdc20 associate with the same set of core APC/C subunits. The observation that pRB bound preferentially to APCcdh1(Fig. 1a) suggested that the interaction is most likely mediated through Cdh1. Mapping the regions of pRB and Cdh1 required for association revealed that Cdh1 binds to the small pocket domain of pRB (see Supplementary Information, Fig. S2a) and that the pRB/APCcdh1 interaction was reduced, but not entirely eliminated, by mutations within the LxCxE binding cleft (see Supplementary Information, Fig. S2b) that completely disrupt the interaction of pRB with the human papilloma virus (HPV) oncoprotein E7 and with some chromatin-remodelling factors10,11,12. The interaction between pRB and Cdh1 also requires the carboxy-terminal WD-40 repeat domain of Cdh1 (see Supplementary Information, Fig. S2c), which has been implicated in substrate recognition13. Therefore, we investigated whether pRB is targeted by APCcdh1for degradation. pRB is a long-lived protein that is functionally active in G1 at a time when APCcdh1 is also active, and our experiments suggest that pRB is not targeted by APCcdh1 for ubiquitination. APC/C in vitro ubiquitination reactions, which readily support polyubiquitination of cyclin B1, showed no ubiquitination of pRB (Fig. 2a). Furthermore, using a cell line stably expressing tetracycline-inducible Cdh1 (ref. 14), we observed that pRB levels did not decrease when Cdh1 expression triggered efficient degradation of known substrates, such as geminin, Plk-1 and Cdc20 (Fig. 2b). Indeed, an increase in pRB levels was detected, which may be a consequence of Cdh1 overexpression, as cells accumulate at the G1–S border14. Clearly, pRB protein levels are not decreased when other APC/C targets are degraded and hence pRB is most likely not marked for degradation by APCcdh1.

Figure 2: pRB is itself not a target for APC/C-mediated degradation, but pRB-associated APC/C is catalytically active.
figure2

(a) Catalytically active APCcdh1 was affinity-purified from HeLa cell nuclear extracts using anti-Cdc27 antibody (anti-GST antibody was used as a negative control, ns Ab) and visualized by immunoblotting. The APCcdh1-loaded or control beads were used for an in vitro ubiquitination reaction with in vitro translated, 35S-labelled N-terminal fragment of cyclin B1 (cycB1: amino acid 1–101) as a positive control substrate, or with in vitro translated 35S-labelled Myc-tagged pRB (Myc–pRB) and subjected to autoradiography. Ubn: polyubiquitinated forms. (b) Cdh1 was induced by tetracycline withdrawal in a stable, Cdh1-inducible U2OS cell line and protein samples were taken at various times after induction and APC/C targets and pRB were analysed by immunoblotting. Vincullin serves as a loading control. (c) pRB-associated cellular proteins were eluted under native conditions and pRB-associated APCcdh1 was enriched by immunoprecipitation using anti-Cdc27 antibody (or anti-Myc control antibody) and the amino-terminal fragment of cyclin B1 was subjected to an in vitro ubiquitination reaction as described in a.

An alternative possibility is that pRB helps to recruit specific substrates to APCcdh1. To examine this possibility, we first asked whether pRB-associated APCcdh1 is catalytically active. pRB-associated proteins were purified from HeLa cell nuclear extracts and eluted under native conditions. The pRB-associated APC/C fraction was recovered by immunoprecipitation and its ability to ubiquitinate cyclin B1 was assayed (Fig. 2c). The results indicate that pRB-associated APCcdh1 is active and has the potential to target proteins for degradation.

Turnover of p27Kip1 is facilitated by the SCF–Skp2 E3 ubiquitin ligase complex4. Skp2, the F-box protein of the SCF complex, is an important target of APCcdh1 during G1 (Refs 15, 16). pRB has been recently shown to associate with Skp2 (ref. 3). As pRB has also been shown to stabilize p27Kip1 when re-expressed in Rb-deficient cells, we hypothesized that the pRB-associated APCcdh1 complex may target Skp2 for degradation during pRB-mediated G1 arrest. The effects of expressing pRB in the pRB-negative osteosarcoma cell line SAOS2 on the levels of Skp2 and p27Kip1 proteins was examined. Reintroduction of pRB into these cells causes G1 arrest, cell-cycle withdrawal and cellular senescence, and provides a sensitive assay for pRB's arrest functions. Using a SAOS2 cell line expressing pRB under the control of tetracycline (SAOS-tetRb) it was observed that pRB induction caused a rapid downregulation of endogenous Skp2 that was followed closely by p27Kip1 accumulation and G1 arrest (Fig. 3a, b). These changes are consistent with previously published observations3. Immunoprecipitation showed that pRB and endogenous APCcdh1 physically associated with one another at the time when rapid Skp2 degradation was observed (Fig. 3c). The pRB–APCcdh1 complex remained present, even after Skp2 was no longer detected.

Figure 3: pRB–APCcdh1 association, ubiquitination of Skp2 and p27Kip1 protein accumulation are coordinated during pRB-mediated cell-cycle arrest.
figure3

(a) pRB was induced by tetracycline in a stably transfected SAOS2 cell line (SAOS-tetRB) and protein samples for immunoblotting were harvested at various times after pRB induction. GAPDH, loading control. Uncropped images of the gels are shown in the Supplementary Information, Fig. S6e. (b) pRB-mediated G1 arrest of corresponding samples was monitored by FACS counting BrdU-incorporating S-phase cells after tetracycline treatment of parental SAOS2 cells that do not carry inducible pRB (parental, grey bars), and of pRB-inducible SAOS2 as in a (tet–pRB). (c) pRB–APCcdh1 association was monitored over time by immunoprecipitation using anti-pRB antibodies. The pRB antibody concentration was limiting with regard to extract to obtain equal quantities of immunoprecipitated pRB at the different times. Ig: heavy chain. Uncropped images of the gels are shown in the Supplementary Information, Fig. S6f. (d, e) As controls for the specificity of APCcdh1- and pRB-mediated Skp2 protein turnover, SAOS-tetRB cells were transfected with Flag-tagged Skp2 and treated with either the proteasome inhibitor MG132 or mock treated (d), and with Flag-tagged Skp2 and cdh1 siRNA (e). p44/42, loading control. (f) The rate of Skp2 ubiquitination in vivo was measured in the presence or absence of pRB by transfecting HA-tagged ubiquitin and Flag-tagged Skp2 into SAOS-tetRB cells. Cdh1 siRNA cotransfection served as a control. Immunoprecipitations from MG132-treated cell extracts were carried out using Flag-antibody. Ubiquitin chains were visualized using anti-HA antibodies for immunoblotting (IB).

Further experiments show that pRB-induced downregulation of Skp2 was dependent on proteasomal degradation and was mediated by Cdh1. Treatment of pRB-induced arrested cells with the proteasome inhibitor MG132 caused the re-accumulation of Skp2 (Fig. 3d). Depletion of Cdh1 protein by small interfering RNA (siRNA) completely prevented the degradation of Skp2 (Fig. 3e). Expression of exogenous p27Kip1, which also causes a G1 arrest2, did not alter Skp2 protein levels (see Supplementary Information, Fig. S3b), indicating that the decrease in Skp2 is not an indirect effect of cell-cycle arrest. In addition, a nondegradable Skp2 amino-terminal deletion mutant, Skp2Δ90 (ref. 15), showed no downregulation on induction of pRB, confirming that the changes observed in Skp2 protein levels were dependent on recognition of the D-box(es) by Cdh1 and protein degradation (see Supplementary Information, Fig. S3c). We also observed a significant increase in Skp2 ubiquitination after induction of pRB (Fig. 3f), which was completely abolished when cdh1 was depleted by siRNA (Fig. 3f). Consistent with this observation, Skp2 turnover was accelerated in the presence of pRB, whereas, conversely, p27Kip1was significantly stabilized (see Supplementary Information, Fig. S3d). Skp2 ubiquitination and turnover also occured in the absence of pRB, albeit with much lower efficiency. This indicates that pRB promotes the Cdh1-dependent degradation of Skp2 on cell-cycle arrest, but is not strictly required for cell cycle-dependent turnover of Skp2.

This inverse relationship between pRB and Skp2 protein levels was also apparent in a second set of experiments using a pRB-positive osteosarcoma cell line, U2OS, carrying a doxycycline-inducible small hairpin RNA (Rb shRNA)17. Skp2 turnover is dependent on APCcdh1 in U2OS cells (see Supplementary Information, Fig. S3e). When pRB was depleted from contact-inhibited U2OS Rb shRNA cells, the reduction in pRB caused an accumulation of Skp2 (see Supplementary Information, Fig. S5a). In fact, pRB depletion elevated Skp2 levels as efficiently as treatment of U2OS cells with the proteasome inhibitor MG132.

pRB has previously been shown to interact with Skp2 (ref. 3). Here, we show that pRB also associates with APCcdh1. To determine whether pRB, Cdh1 and Skp2 physically interact and form a triple complex in vivo, U2OS cells were transfected with epitope-tagged forms of these proteins and the transfected cells were treated with MG132 to block the degradation of Skp2. All three proteins were detected in immune complexes prepared by sequential immunoprecipitation (Fig. 4a).

Figure 4: pRB associates with both APCcdh1 and Skp2 simultaneously and interacts specifically with APC/C during cell-cycle exit.
figure4

(a) U2OS cells were cotransfected with Flag-tagged Skp2 (Flag–Skp2), HA-tagged pRB (HA–pRB), and Myc-tagged Cdh1 (Myc–Cdh1), incubated for 24 h and treated with MG132 to confirm formation of a pRB–APCcdh1–Skp2 triple complex in vivo. Complexes were immunoprecipitated first by anti-Flag antibody and eluted with Flag peptide, then immunoprecipitated for a second time using anti-HA antibody and were eluted with SDS loading buffer. Uncropped images of the gels are shown in the Supplementary Information, Fig. S6g. (b) Nuclear extracts from human diploid fibroblasts (IMR90) were made either from asynchronously growing (asyn.) or contact-inhibited (CI, for 1 or 3 days) populations. Endogenous pRB was immunoprecipitated and associated endogenous APC/C subunits (APC2, Cdc16) were detected during cell-cycle exit. ns Ab; non-specific anti-mouse antibody. Uncropped images of the gels are shown in the Supplementary Information, Fig. S6h. (c) Whole-cell extracts for immunoblots were made from IMR90 cells at the same times as in b in the presence or absence of pRB (through shRNA knockdown by lentiviral transfection) to assess p27Kip1 levels. p44/42, loading control. (d) Corresponding FACS samples from BrdU-labelled IMR90 cells were also taken to verify cell-cycle exit on contact inhibition.

Although the structure of the pRB–APCcdh1–Skp2 triple complex is unknown, binding studies give some insights. Cdh1 recognises the D-boxes in the N-terminus of Skp2 (amino acids 1–90)15,16, whereas pRB interacts with amino acids 61–101 (ref. 3), suggesting that Cdh1 and pRB bind to closely adjacent sites on Skp2. APCcdh1 binding to pRB is dependent partially on the LxCxE binding cleft (see Supplementary Information, Fig. S2b), but Skp2 binding (amino acids 637–738 and amino acids 772–824) maps at sites distinct from the cleft (amino acids 753–761)3. Interestingly, a pRB mutant (pRBΔ22; amino acids 738–772) that lacks the LxCxE binding cleft failed to induce the accumulation of p27Kip1, despite being able to associate with Skp2 (ref. 3). Together, these observations suggest that pRB associates with APCcdh1 and Skp2 through distinct surfaces, and that it may need to interact with both proteins to promote p27Kip1accumulation and cell-cycle exit.

To determine the cellular context in which pRB and APCcdh1 interact, coimunoprecipitation assays were used to monitor the association of these proteins in nontransformed, primary human diploid fibroblasts, IMR90. We failed to detect an interaction between pRB and APCcdh1 in extracts of asynchronously dividing IMR90 cells, but these proteins could be readily coprecipitated when cells were arrested by contact inhibition entering G0 (Fig. 4b, d). This association correlates with the accumulation of p27Kip1 (Fig. 4c), a change that is dependent on pRB (Fig. 4c). These results indicate that APCcdh1 associates preferentially with a hypophosphorylated form of pRB (Fig. 4b, c and see Supplementary Information, Fig. S3a), suggesting that additional tiers of regulation, distinct from the cyclic phosphorylation/dephosphorylation of pRB that occurs during cell proliferation, may be required to regulate the timely interaction of pRB and APCcdh1 during cell-cycle exit.

Our data suggest that Skp2 degradation is promoted by pRB–APCcdh1 association during cell-cycle arrest. p27Kip1 is a target of the SCF–Skp2 complex4 and its accumulation is a key event in pRB-mediated G1 arrest2. Downregulation of Skp2 leads to p27Kip1 accumulation (Fig. 3a). These observations predict that APCcdh1-mediated effects may be required for pRB-induced cell-cycle arrest. This possibility was examined using siRNA-mediated knockdown of endogenous cdh1 in SAOS-tetRb cells. Cdh1 knockdown in the presence of pRB resulted in the re-expression of endogenous Skp2 and a significant decrease in the expression of endogenous p27Kip1 (Fig. 5a). Loss of Cdh1 strongly suppressed the ability of pRB to arrest the cell cycle (Fig. 5b). In Cdh1-depleted populations, a large proportion of the cells continued to proliferate despite the presence of pRB (Fig. 5c), indicating that Cdh1, at least in this cell line, is required for pRB-mediated cell-cycle arrest.

Figure 5: Targeting of Skp2 and p27Kip1 accumulation are required for pRB-mediated cell-cycle arrest.
figure5

(a) To examine the influence of Cdh1 activity on pRB-mediated G1 arrest, SAOS-tetRB cells were transfected with cdh1 or luciferase control siRNA and protein samples for immunoblotting were harvested 48 hours after pRB induction. (b) Cells from a were subjected to FACS analysis and BrdU-incorporating S-phase cells were monitored. (c) Cells from a were stained with trypan blue, counted at day one and day two and the cell number for the cells treated with luciferase siRNA was set to 1 (cell number: arbitrary cell number). (d, e) As a control, SAOS-tetRB cells were transfected with Cul-1 siRNA and protein samples for immunoblotting (d) and FACS samples (e) were harvested. (f) A pRB mutant that is unable to bind to APCcdh1 (RBΔLΔG) was stably transfected into SAOS2 cells, induced with tetracycline and protein samples were harvested at various times after induction for immunoblotting. p44/42, loading control. The mean ± s.d. of three independent experiments are shown in b, c and e.

Several additional experiments confirmed the specificity of the effect of Cdh1 knockdown on pRB: first, depletion of Cdh1 in pRB-negative, parental SAOS2 cells (see Supplementary Information, Fig. S4a, b) and uninduced SAOS-tetRb cells (Fig. 5a, b) caused only minimal changes in the cell-cycle profiles and Skp2 and p27Kip1 protein levels in these cells. Second, we examined the influence of inactivating SCF, another major E3-ligase complex that is active during G1, and found that siRNA-mediated depletion of Cul-1 had no effect on pRB-induced downregulation of Skp2, accumulation of p27Kip1 or cell-cycle arrest (Fig. 5d, e). Third, a pRB mutant that fails to associate with APCcdh1, RBΔLΔG (see Supplementary Information, Fig. S2b), was unable to downregulate Skp2 or cause the accumulation of p27Kip1 when stably re-expressed in SAOS2 cells (Fig. 5f), and failed to induce sustained cell-cycle arrest (see Supplementary Information, Fig. S4c). Fourth, Cdh1 was also not required for the G1 arrest induced by overexpression of p107 in SAOS2 cells (see Supplementary Information, Fig. S4d). The pRB-related pocket protein p107 shares the ability of pRB to interact with E2F proteins and some chromatin-remodelling factors, but fails to interact with APCcdh1 (Fig. 1c, d).

Detailed analysis of pRB function has led to the conclusion that pRB possesses several activities that contribute to its ability to regulate cell proliferation. In addition to regulating E2F, pRB also stabilises p27Kip1. This effect is independent of pRB-mediated transcriptional regulation and is instead caused by changes in p27Kip1 protein turnover2. The observation that pRB-interacts with Skp2 led to the suggestion that pRB might physically disrupt the SCF–Skp2–p27Kip1 interaction3. Here, we provide evidence that pRB associates with APCcdh1 and Skp2, thereby mediating rapid degradation of Skp2. This provides a mechanistic explanation for how pRB expression stabilises p27Kip1.

For many known APC/C targets during mitosis and early G1 (for example, Cdc20, cyclin A and securin) the relative processivity of multi-ubiquitination by APC/C and the activities of deubiqutinating enzymes are key factors that determine the order in which substrates are removed18. In some instances, however, APC/C seems to require additional non-core components at different times during the cell-cycle to be fully functional19. In a manner that may be analogous to the pRB–APCcdh1–Skp2 association described here, APCcdh1–D-box-mediated ubiquitination of the transcriptional corepressor SnoN is considerably enhanced following TGFβ signalling — by association of Smad2/3 to both the SnoN substrate and, through association of Cdh1, with the APC/C20,21.

The observation that pRB interacts with APC/C, whereas p107 and p130 do not, presumably explains why pRB is the only member of this protein family to induce sustained high levels of p27Kip1 protein in SAOS2 cells2, which are associated with osteoblast differentiation6. Although our experiments show a role for pRB–APCcdh1 during cell-cycle exit, it is possible that the continued activity of pRB–APCcdh1, as suggested by our experiments, may help to maintain the differentiated state. This raises the possibility that pRB may direct APCcdh1 to additional targets, not only during pRB-mediated G1 arrest, but also during differentiation and senescence. Potential candidates include RBP2 (ref. 22), EID-1 (ref. 23), and Id2 (ref. 24) — proteins that antagonise pRB-mediated differentiation. In U2OS cells17, the shRNA-mediated depletion of Rb caused the accumulation of Skp2 and of the APCcdh1 target, polo-like kinase (Plk-1), whereas APCcdc20 targets (such as cyclin B1 and securin) were unaffected (see Supplementary Information, Fig. S5a, b). pRB also seems to promote the degradation of EID-1, but not RBP-2. These results support the hypothesis that pRB specifically promotes the turnover of APCcdh1 targets, but they also suggest that Skp2 is unlikely to be the only APC/C substrate that is targeted by pRB.

Several studies4,7,25 have highlighted the functional cooperation between APCcdh1, SCF–Skp2 and pRB in G1 control. Our data show an unexpected physical convergence between these controls, connecting the pRB tumour suppressor protein with the activities of two major E3 ubiquitin ligase complexes. It will be interesting to investigate where this convergence occurs. Although pRB association with APCcdh1 seems to be independent of E2F binding, a recent study reported the presence of APC/C in the vicinity of an E2F-regulated promoter19. This, together with a study in Drosophila showing that APCcdh1 acts locally to control protein stability at synapses26, raises the interesting possibility that pRB association with APCcdh1 occurs in the vicinity of E2F-regulated promoters. Clearly, further studies are needed to determine how different functions of pRB are coordinated in the regulation of cell-cycle exit and differentiation.

Methods

DNA constructs and siRNA.

GST–pRB, GST–p107, GST–p130 and all pRB mutants10,11,27 were cloned by inserting PCR-amplified large pocket sequence from corresponding pCMV–Neo–Bam expression plasmids into pGEX-2TKN (Pharmacia, Uppsala, Sweden), using the following primers and restriction enzymes (NEB, Beverley, MA): pRB (FD116), GCGCGGATCCGCCACCATGTACCCATACGACGTCCCAGA CTACGCTGAAGAGGTGAATGTAATTCCTC cut BamHI and pRB (FD124), CCTGGGATCCTCATTTCTCTTCCTTG cut BamHI; p107 (N), CGCGGATCCATGGCAACTCCTGTTGCATCAGCCACC cut NcoI and p107 (C), CTTCGCTCTAGATGATTTGCTCTTTCACTGACAACATC cut XbaI; p130 (N), CGCGGATCCCATATGACTCCAGTTTCTACAGCTACGC cut NdeI and p130 (C), CTTCGCTCTAGACAGTGGGAACCACGGTCATTAG cut XbaI.

Full-length pRB sequence was inserted as a BamHI fragment from pCMV–pRB–Neo–Bam into pcDNA4/TO (Invitrogen, Carlsbad, CA). Cdh1 siRNA oligomers were previously described15.

Cell culture and transfection.

Osteosarcoma cell lines SAOS2, U2OS and IMR90 (human diploid fibroblasts) were maintained in Dulbecco's minimal essential medium (DMEM, Cellgro/Mediatech,Herndon, VA) supplemented with 10% fetal bovine serum (Gibco–Invitrogen, Carlsbad, CA). HeLa cells were maintained in minimal essential medium (SMEM, Gibco–Invitrogen) supplemented with 10% newborn bovine serum (Gibco–Invitrogen) and grown in Spinner flasks. U2OS Rb shRNA cells17 and U2OS TetCdh1 cells14 were previously described. Stable SAOS-tetRB cells were generated transfecting SAOS2TR (stably transfected with pcDNA6/TR, Invitrogen) cells with pRB–pcDNA/TO, followed by selection in zeocin (100 μg ml−1) and blasticidin (2.5 μg ml−1). pRB expression was induced by addition of tetracycline (0.5 μg ml−1). To inhibit proteasomal degradation cells were treated with MG132 (10 μM, Calbiochem, Darmstadt, Germany) for 4–6 h. For transfections, cells were plated in 6-well plates and transfected the next day with 2 μg total plasmid or siRNA oligomers per well using lipofectamine 2000 (Invitrogen) or by electroporation, and harvested after 24–48 h. IMR90 cells were infected with lentivirus using 293T cell packaging vectors VSVG L, RSV REV, RGR and pLKO.1–puro short hairpin Rb (Rb shRNA, TRCN0000040163, Sigma, St Louis, MO).

Immunoblotting and antibodies.

Immunoblotting was performed using standard methods. Protein samples were lysed in E1A lysis buffer (ELB; 250 mM NaCl, 50 mM HEPES at pH 7.6, 1 mM EDTA, 0.1% NP40, 1 mM DTT, 0.25 mM PMSF, 1× complete protease inhibitor cocktail; Roche, Mannheim, Germany), sonicated, clarified by centrifugation and SDS-sample buffer was added. The following antibodies were used: APC2 (rabbit; Neomarker, Freemont, CA), cdc6 (DCS180.3, mouse; Oncogene, Boston, MA), cdc16 (sc-6395, goat; Santa-Cruz, Santa Cruz, CA), cdc20 (sc-1907, goat), cdc27 (cl.35, mouse, BDTransduction Labs, San Diego, CA), Cdh1 (DH-01, mouse; Neomarkers), cyclin A (sc-396, rabbit), cyclin B (GNS1, mouse), DP1 (sc-610, rabbit), E1A (M73, mouse), E2F1 (KH95, mouse), EID (SH18, mouse), Flag (M2, mouse; Sigma), GAPDH (6c5, mouse; Advanced ImmunoChemical, Long Beach, CA), geminin (sc-13015, rabbit), GST (sc-138, mouse), HA (HA-7, mouse; Sigma), Myc (9E10, mouse), p27Kip1 (cl.57, mouse; BDTransduction Labs), p42/44 (rabbit; Cell Signaling, Danvers, MA), Plk-1 (sc-17783, mouse), pRB (G3-245, mouse; BDPharmingen, San Diego, CA), RBP2 (1416, rabbit), securin/Pds-1 (DCS-280, mouse; MBL, Woburn, MA), Skp2 (sc-7164, rabbit) and vincullin (mouse; Sigma)

Immunoprecipitations.

For coimmunoprecipitations, cells lysates were generated using ELB supplemented with NaF (4 mM), NaVO4 (1 mM), and MG132 (20 μM), sonicated and pre-cleared. Immunoprecipitations were carried out using beads conjugated with either anti-HA, anti-Flag or –anti-Myc antibodies (Sigma) at 4 °C for 3 h, followed by three washes in ELB. Beads were boiled for 5 min (10 minutes for polyubiquitin) in SDS-sample buffer. Flag-peptide elution was carried out in ELB supplemented with Flag peptide (200 μg ml−1, Sigma) for 1 h at 4 °C.

For immunoprecipitations from nuclear extracts, cells were harvested in PBS with 3 mM EDTA, resuspended in hypotonic buffer (10 mM HEPES at pH 7.6, 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 0.1% Triton X-100, and protease inhibitors — 0.5 μg ml−1 aprotinin, 0.5 μg ml−1leupetin and 0.25 mM PMSF), and incubated on ice for 10 min. Nuclei were gently spun out, resuspended in 0.4 M KCl buffer (50 mM HEPES at pH 7.6, 0.4 M KCl, 0.1% NP40, 4 mM NaF, 4 mM NaVO4, 0.2 mM EDTA, 0.2 mM EGTA, 10% glycerol, 1 mM DTT and protease inhibitors), incubated on ice for 25 minutes and nuclei were spun out again at 25,000g. The supernatant was gently diluted 1:1 with dilution buffer (50 mM HEPES at pH 7.6, 4 mM NaF, 4 mM NaVO4, 10% glycerol and protease inhibitors) and pre-cleared with protein G beads (Pharmacia, Uppsala, Sweden) for 1 h. Antibody (3 μg ml−1) and protein G beads (20 μl ml−1) were added to the pre-cleared extract and incubated for 12 h at 4 °C. Antibodies used for immunoprecipitation were: pRB (G3-245), Cdh1 (DH-01) and Cdc27 (AF3.1, mouse; MBL). Immunoprecipitates were washed three times in wash buffer (0.25 M KCl buffer) and boiled in SDS-sample buffer.

Affinity purification and glycerol gradient.

BL21 were transformed with pRB, p107 and p130 large pocket GST-fusion constructs, induced with 100 μM IPTG (Sigma) at A600 = 0.7, and incubated at 24 °C for 12 hours. Bacteria were resuspended in extraction buffer (20 mM HEPES at pH 7.6, 0.5 M NaCl, 0.5 mM EDTA, 10% glycerol, 0.5% NP40, 1 mM DTT, 0.25 mM PMSF, 1 mM benzamidine, 2 μg ml−1 aprotinin), sonicated and cleared by centrifugation (15,000g, 30 min). Glutathione–sepharose (150 μl per 500 ml bacteria culture, Pharmacia) was added for 1 h. Beads were washed three times with extraction buffer containing 1 M NaCl and 1% NP40, then five times with extraction buffer and equilibrated with KCl buffer (20 mM HEPES at pH 7.6, 0.1 mM EDTA, 10% glycerol, 0.02% NP40, 1 mM DTT and protease inhibitors).

HeLa cell nuclear extracts were generated, as previously described28, from log-phase cells. Extracts were pre-cleared using glutathione–sepharose and 1 ml of extract was incubated with 75 μg GST-fusion protein for 3 h at 4 °C. Beads were washed eight times with 0.25 M KCl buffer (20 mM HEPES at pH 7.6, 0.25 M KCl, 0.1 mM EDTA, 10% glycerol, 0.25% NP40, 1 mM DTT, 0.25 mM PMSF) and once with buffer containing 0.1 M NaCl instead of KCl and 0.2% NP40. Associated proteins were eluted with NaCl buffer containing 0.35% sarcosyl (instead of NP40) for 1 h at 4 °C (for immunoblotting), or with glutathione-elution buffer (0.25 mM glutathione (Sigma), 80 mM Tris at pH 7.9, 100 mM NaCl, 10% glycerol, 0.1 mM EDTA, 0.02% NP40, 1 mM DTT and protease inhibitors) for 1 h at 4 °C. Glutathione-eluted proteins were either separated on a 15–40% glycerol gradient in an ultracentrifuge (Beckman TLS55, at 259,000g) for seven hours at 4 °C and 100 μl fractions were diluted in 6× SDS-sample buffer, or used for in vitro ubiquitination reaction.

Protein stability.

Cells were grown to confluence, tetracycline induced for 24 h and treated with cycloheximide (25 μg ml−1) for the times indicated. Densitometry was carried out on a BioRad Gel Doc XR gel imager.

In vitro ubiquitination.

Active APC/C-fractions were isolated by immunoprecipitation from either HeLa cell nuclear extracts or from the glutathione-eluted pRB GST-pulldown protein fraction mixing anti-cdc27 (AF3.1, MBL) antibody and protein G beads for 2 h at 4 °C. Beads were washed twice in 0.25 M KCl buffer and once in in vitro ubiquitination (IVU) buffer (20 mM HEPES at pH 7.6, 100 mM NaCl, 10% glycerol, 1 mM benzamidine, 2 μg ml–1 aprotinin). 35S-methionine-labeled N-terminal cyclin B1 and Myc-tagged, full-length pRB were generated by in vitro translation (Promega, Madison, WI) and 2 μl were added to the in vitro ubiquitination reaction mix containing: 1 mg ml–1 bovine ubiquitin (Sigma), 144 μg ml–1 His-tag-purified Uba (E1), 80 μg ml–1 His–UbcX (E2), 1× ATP-mix (1 mM ATP, 1 mM MgCl2, 30 mM creatine phosphate, 10 μg ml–1 creatine phosphate kinase) and APC/C-loaded beads. The reaction was incubated at 30 °C in a shaker and fractions were taken and diluted in SDS-sample buffer. Gels were visualized by autoradiography.

Flow cytometry.

Cells were labelled for 1 h with BrdU (Amersham, Little Chalfont, UK), harvested, fixed in ethanol, denatured in 2 M HCl, 0.5% Triton X-100, and neutralised in 0.1 M borate at pH 8.5. Cells were then incubated with anti-BrdU antibody (1:50, mouse; Becton-Dickinson, San Jose, CA) for 30 min in 1× PBS, 0.5% Tween-20, 1% BSA, washed and incubated with FITC-conjugated anti-mouse antibody (1:50, horse; Vector Labs, Burlingame, CA) for 30 min. Cells were stained with propidium iodide (Sigma) at 4 °C over night (10 μg ml−1 propidium iodide, 250 μg ml−1 RNase A (Sigma), 10% FBS, in PBS) and analysed using a Becton-Dickinson FACSort flow cytometer and CellQuest software.

Note: Supplementary Information is available on the Nature Cell Biology website.

References

  1. 1

    Classon, M. & Harlow E. The retinoblastoma tumour suppressor in development and cancer. Nature Rev. Cancer 2, 910–917 (2002).

  2. 2

    Alexander, K. & Hinds P. W. Requirement for p27(KIP1) in retinoblastoma protein-mediated senescence. Mol. Cell. Biol. 21, 3616–3631 (2001).

  3. 3

    Ji, P. et al. An Rb-Skp2-p27 pathway mediates acute cell cycle inhibition by Rb and is retained in a partial-penetrance Rb mutant. Mol. Cell. 16, 47–58 (2004).

  4. 4

    Amati, B. & Vlach J. Kip1 meets SKP2: new links in cell-cycle control. Nature Cell Biol. 1, E91–E93 (1999).

  5. 5

    Weinberg, R. A. The retinoblastoma protein and cell cycle control. Cell 81, 323–330 (1995).

  6. 6

    Thomas, D. M. et al. Terminal osteoblast differentiation, mediated by runx2 and p27KIP1, is disrupted in osteosarcoma. J. Cell. Biol. 167, 925–934 (2004).

  7. 7

    Bloom, J. & Pagano M. Deregulated degradation of the cdk inhibitor p27 and malignant transformation. Semin. Cancer Biol. 13, 41–47 (2003).

  8. 8

    Castro, A. et al. The anaphase-promoting complex: a key factor in the regulation of cell cycle. Oncogene 24, 314–325 (2005).

  9. 9

    Fay, D. S., Keenan S. & Han M. fzr-1 and lin-35/Rb function redundantly to control cell proliferation in C. elegans as revealed by a nonbiased synthetic screen. Genes Dev. 16, 503–517 (2002).

  10. 10

    Dick, F. A., Sailhamer E. & Dyson N. J. Mutagenesis of the pRB pocket reveals that cell cycle arrest functions are separable from binding to viral oncoproteins. Mol. Cell. Biol. 20, 3715–3727 (2000).

  11. 11

    Dick, F. A. & Dyson N. J. Three regions of the pRB pocket domain affect its inactivation by human papillomavirus E7 proteins. J. Virol. 76, 6224–6234 (2002).

  12. 12

    Isaac, C. E. et al. The retinoblastoma protein regulates pericentric heterochromatin. Mol. Cell. Biol. 26, 3659–3671 (2006).

  13. 13

    Kraft, C. et al. The WD40 propeller domain of Cdh1 functions as a destruction box receptor for APC/C substrates. Mol. Cell. 18, 543–553 (2005).

  14. 14

    Sorensen, C. S. et al. Nonperiodic activity of the human anaphase-promoting complex-Cdh1 ubiquitin ligase results in continuous DNA synthesis uncoupled from mitosis. Mol. Cell. Biol. 20, 7613–7623 (2000).

  15. 15

    Wei, W. et al. Degradation of the SCF component Skp2 in cell-cycle phase G1 by the anaphase-promoting complex. Nature 428, 194–198 (2004).

  16. 16

    Bashir, T. et al. Control of the SCF(Skp2-Cks1) ubiquitin ligase by the APC/C(Cdh1) ubiquitin ligase. Nature. 428, 190–193 (2004).

  17. 17

    Dickins, R. A. et al. Probing tumor phenotypes using stable and regulated synthetic microRNA precursors. Nature Genet. 37, 1289–1295 (2005).

  18. 18

    Rape, M., Reddy S. K. & Kirschner M. W. The processivity of multiubiquitination by the APC determines the order of substrate degradation. Cell 12, 89–103 (2006).

  19. 19

    Turnell, A. S. et al. The APC/C and CBP/p300 cooperate to regulate transcription and cell-cycle progression. Nature 438, 690–695 (2005).

  20. 20

    Stroschein, S. L. et al. Smad3 recruits the anaphase-promoting complex for ubiquitination and degradation of SnoN. Genes Dev. 15, 2822–2836 (2001).

  21. 21

    Wan, Y., Liu X. & Kirschner M. W. The anaphase-promoting complex mediates TGF-β signaling by targeting SnoN for destruction. Mol. Cell. 8, 1027–1039 (2001).

  22. 22

    Benevolenskaya, E. V. et al. Binding of pRB to the PHD protein RBP2 promotes cellular differentiation. Mol. Cell. 18, 623–635 (2005).

  23. 23

    Miyake, S. et al. Cells degrade a novel inhibitor of differentiation with E1A-like properties upon exiting the cell cycle. Mol. Cell. Biol. 20, 8889–8902 (2000).

  24. 24

    Lasorella, A. et al. Degradation of Id2 by the anaphase-promoting complex couples cell cycle exit and axonal growth. Nature 442, 471–474 (2006).

  25. 25

    Ang, X. L. & Harper J. W. Interwoven ubiquitination oscillators and control of cell cycle transitions. Sci STKE e31 (2004).

  26. 26

    van Roessel, P. et al. Independent regulation of synaptic size and activity by the anaphase-promoting complex. Cell 119, 707–718 (2004).

  27. 27

    Dick, F. A. & Dyson N. J. pRB contains an E2F1-specific binding domain that allows E2F1-induced apoptosis to be regulated separately from other E2F activities. Mol. Cell. 12, 639–649 (2003).

  28. 28

    Dignam, J. D., Lebovitz R. M. & Roeder R. G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475–1489 (1983).

  29. 29

    Imaki, H. et al. Cell cycle-dependent regulation of the Skp2 promoter by GA-binding protein. Cancer Res. 63, 4607–4613 (2003).

  30. 30

    Wirbelauer, C. et al. The F-box protein Skp2 is a ubiquitylation target of a Cul1-based core ubiquitin ligase complex: evidence for a role of Cul1 in the suppression of Skp2 expression in quiescent fibroblasts. EMBO J. 19, 5362–5375 (2000).

  31. 31

    Zhang, H. et al. p19Skp1 and p45Skp2 are essential elements of the cyclin A-CDK2 S phase kinase. Cell 82, 915–925 (1995).

  32. 32

    Vernell, R., Helin K. & Muller H. Identification of target genes of the p16INK4A-pRB-E2F pathway. J. Biol. Chem. 278, 46124–46137 (2003).

Download references

Acknowledgements

We thank: C. Pfleger for numerous APC/C-related plasmids; R. Watson for Myc-tagged pRB, p107, p130 plasmids; S. Lowe for U2OS shRB cell line; J. Rocco for pcDNA6/TR and pcDNA4/TO plasmids; and B. Schulman for the CMV–Myc–Skp2 plasmid. We also like to thank P. Hinds and K. Münger for helpful comments on the manuscript. This study was supported by National Institutes of Health (NIH) grant CA64402 to N.J.D and by the Massachusetts General Hospital Fund for Medical Discovery to U.K.B.

Author information

Correspondence to Anders M. Näär or Nicholas J. Dyson.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Information

Supplementary figures S1, S2, S3, S4, S5 and S6 (PDF 531 kb)

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Binné, U., Classon, M., Dick, F. et al. Retinoblastoma protein and anaphase-promoting complex physically interact and functionally cooperate during cell-cycle exit. Nat Cell Biol 9, 225–232 (2007). https://doi.org/10.1038/ncb1532

Download citation

Further reading