Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

RNA m6A methylation regulates the ultraviolet-induced DNA damage response

A Corrigendum to this article was published on 29 November 2017

This article has been updated

Abstract

Cell proliferation and survival require the faithful maintenance and propagation of genetic information, which are threatened by the ubiquitous sources of DNA damage present intracellularly and in the external environment. A system of DNA repair, called the DNA damage response, detects and repairs damaged DNA and prevents cell division until the repair is complete. Here we report that methylation at the 6 position of adenosine (m6A) in RNA is rapidly (within 2 min) and transiently induced at DNA damage sites in response to ultraviolet irradiation. This modification occurs on numerous poly(A)+ transcripts and is regulated by the methyltransferase METTL3 (methyltransferase-like 3)1 and the demethylase FTO (fat mass and obesity-associated protein)2. In the absence of METTL3 catalytic activity, cells showed delayed repair of ultraviolet-induced cyclobutane pyrimidine adducts and elevated sensitivity to ultraviolet, demonstrating the importance of m6A in the ultraviolet-responsive DNA damage response. Multiple DNA polymerases are involved in the ultraviolet response, some of which resynthesize DNA after the lesion has been excised by the nucleotide excision repair pathway3, while others participate in trans-lesion synthesis to allow replication past damaged lesions in S phase4. DNA polymerase κ (Pol κ), which has been implicated in both nucleotide excision repair and trans-lesion synthesis5,6, required the catalytic activity of METTL3 for immediate localization to ultraviolet-induced DNA damage sites. Importantly, Pol κ overexpression qualitatively suppressed the cyclobutane pyrimidine removal defect associated with METTL3 loss. Thus, we have uncovered a novel function for RNA m6A modification in the ultraviolet-induced DNA damage response, and our findings collectively support a model in which m6A RNA serves as a beacon for the selective, rapid recruitment of Pol κ to damage sites to facilitate repair and cell survival.

This is a preview of subscription content, access via your institution

Relevant articles

Open Access articles citing this article.

Access options

Buy article

Get time limited or full article access on ReadCube.

$32.00

All prices are NET prices.

Figure 1: Modification at m6A on RNA accumulates at sites of DNA damage after UV exposure.
Figure 2: METTL3/14 and FTO oppositely regulate m6A RNA at DNA damage sites.
Figure 3: METTL3 is important for UV-induced DNA damage repair and cell survival.
Figure 4: Pol κ localization to damage sites is METTL3-dependent.

Accession codes

Primary accessions

Gene Expression Omnibus

Change history

  • 30 November 2017

    Please see accompanying Corrigendum (http://doi.org/10.1038/nature24007). In Extended Data Fig. 4d of this Letter, images in the bottom row, performed with the PARP inhibitor Olaparib, were inadvertently duplicated in panel e (bottom row, under the ‘PARP inhibitor’ heading). The corrected Extended Data Fig. 4e is shown as Supplementary Information to the Corrigendum. In addition, in the ‘Oligonucleotides’ section of the Methods, the two oligonucleotides used for METTL14 should have been listed as: “sh 1, AGCATTGGTGCCGTGTTAAAT ; or sh 2, GCTGACAGATTTGAAGAATAT.” These errors have not been corrected online.

References

  1. Liu, J. et al. A METTL3–METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nature Chem. Biol. 10, 93–95 (2014)

    Article  ADS  CAS  Google Scholar 

  2. Jia, G. et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nature Chem. Biol. 7, 885–887 (2011)

    Article  CAS  Google Scholar 

  3. Hanawalt, P. C. & Spivak, G. Transcription-coupled DNA repair: two decades of progress and surprises. Nature Rev. Mol. Cell Biol. 9, 958–970 (2008)

    Article  CAS  Google Scholar 

  4. Waters, L. S. et al. Eukaryotic translesion polymerases and their roles and regulation in DNA damage tolerance. Microbiol. Mol. Biol. Rev. 73, 134–154 (2009)

    Article  CAS  Google Scholar 

  5. Ogi, T. & Lehmann, A. R. The Y-family DNA polymerase κ (pol κ) functions in mammalian nucleotide-excision repair. Nature Cell Biol. 8, 640–642 (2006)

    Article  CAS  Google Scholar 

  6. Yoon, J. H., Prakash, L. & Prakash, S. Highly error-free role of DNA polymerase eta in the replicative bypass of UV-induced pyrimidine dimers in mouse and human cells. Proc. Natl Acad. Sci. USA 106, 18219–18224 (2009)

    Article  ADS  CAS  Google Scholar 

  7. Ciccia, A. & Elledge, S. J. The DNA damage response: making it safe to play with knives. Mol. Cell 40, 179–204 (2010)

    Article  CAS  Google Scholar 

  8. Svejstrup, J. Q. The interface between transcription and mechanisms maintaining genome integrity. Trends Biochem. Sci. 35, 333–338 (2010)

    Article  CAS  Google Scholar 

  9. Sakaue-Sawano, A. et al. Visualizing spatiotemporal dynamics of multicellular cell-cycle progression. Cell 132, 487–498 (2008)

    Article  CAS  Google Scholar 

  10. Munns, T. W., Liszewski, M. K. & Sims, H. F. Characterization of antibodies specific for N6-methyladenosine and for 7-methylguanosine. Biochemistry 16, 2163–2168 (1977)

    Article  CAS  Google Scholar 

  11. Wang, X. et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 505, 117–120 (2014)

    Article  ADS  Google Scholar 

  12. Meyer, K. D. et al. 5′ UTR m6A promotes cap-independent translation. Cell 163, 999–1010 (2015)

    Article  CAS  Google Scholar 

  13. Wang, X. et al. N6-methyladenosine modulates messenger RNA translation efficiency. Cell 161, 1388–1399 (2015)

    Article  CAS  Google Scholar 

  14. Zhou, J. et al. Dynamic m6A mRNA methylation directs translational control of heat shock response. Nature 526, 591–594 (2015)

    Article  ADS  CAS  Google Scholar 

  15. Dominissini, D. et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201–206 (2012)

    Article  ADS  CAS  Google Scholar 

  16. Ping, X. L. et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res. 24, 177–189 (2014)

    Article  CAS  Google Scholar 

  17. Liu, N. et al. N6-methyladenosine-dependent RNA structural switches regulate RNA–protein interactions. Nature 518, 560–564 (2015)

    Article  ADS  CAS  Google Scholar 

  18. Alarcón, C. R. et al. HNRNPA2B1 is a mediator of m6A-dependent nuclear RNA processing events. Cell 162, 1299–1308 (2015)

    Article  Google Scholar 

  19. Alarcón, C. R., Lee, H., Goodarzi, H., Halberg, N. & Tavazoie, S. F. N6-methyladenosine marks primary microRNAs for processing. Nature 519, 482–485 (2015)

    Article  ADS  Google Scholar 

  20. Geula, S. et al. Stem cells. m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 347, 1002–1006 (2015)

    Article  ADS  CAS  Google Scholar 

  21. Wang, Y. et al. N6-methyladenosine modification destabilizes developmental regulators in embryonic stem cells. Nature Cell Biol. 16, 191–198 (2014)

    Article  CAS  Google Scholar 

  22. Patil, D. P. et al. m6A RNA methylation promotes XIST-mediated transcriptional repression. Nature 537, 369–373 (2016)

    Article  ADS  CAS  Google Scholar 

  23. Bokar, J. A., Shambaugh, M. E., Polayes, D., Matera, A. G. & Rottman, F. M. Purification and cDNA cloning of the AdoMet-binding subunit of the human mRNA (N6-adenosine)-methyltransferase. RNA 3, 1233–1247 (1997)

    CAS  PubMed  PubMed Central  Google Scholar 

  24. Zheng, G. et al. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol. Cell 49, 18–29 (2013)

    Article  CAS  Google Scholar 

  25. Chou, D. M. et al. A chromatin localization screen reveals poly (ADP ribose)-regulated recruitment of the repressive polycomb and NuRD complexes to sites of DNA damage. Proc. Natl Acad. Sci. USA 107, 18475–18480 (2010)

    Article  ADS  CAS  Google Scholar 

  26. Mitchell, D. L. The relative cytotoxicity of (6-4) photoproducts and cyclobutane dimers in mammalian cells. Photochem. Photobiol. 48, 51–57 (1988)

    Article  CAS  Google Scholar 

  27. Jambhekar, A . et al. Unbiased selection of localization elements reveals cis-acting determinants of mRNA bud localization in Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA 102, 18005–18010 (2005)

    Article  ADS  CAS  Google Scholar 

  28. Ogi, T. et al. Three DNA polymerases, recruited by different mechanisms, carry out NER repair synthesis in human cells. Mol. Cell 37, 714–727 (2010)

    Article  CAS  Google Scholar 

  29. Bi, X. et al. Rad18 regulates DNA polymerase kappa and is required for recovery from S-phase checkpoint-mediated arrest. Mol. Cell. Biol. 26, 3527–3540 (2006)

    Article  CAS  Google Scholar 

  30. Okada, T. et al. Involvement of vertebrate polκ in Rad18-independent postreplication repair of UV damage. J. Biol. Chem. 277, 48690–48695 (2002)

    Article  CAS  Google Scholar 

  31. Wang, X. et al. Structural basis of N6-adenosine methylation by the METTL3–METTL14 complex. Nature 534, 575–578 (2016)

    Article  ADS  CAS  Google Scholar 

  32. Celeste, A. et al. H2AX haploinsufficiency modifies genomic stability and tumor susceptibility. Cell 114, 371–383 (2003)

    Article  CAS  Google Scholar 

  33. Greer, E. L. et al. DNA methylation on N6-adenine in C. elegans. Cell 161, 868–878 (2015)

    Article  CAS  Google Scholar 

  34. Dominissini, D., Moshitch-Moshkovitz, S., Salmon-Divon, M., Amariglio, N. & Rechavi, G. Transcriptome-wide mapping of N6-methyladenosine by m6A-seq based on immunocapturing and massively parallel sequencing. Nature Protocols 8, 176–189 (2013)

    Article  CAS  Google Scholar 

  35. Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnol. 28, 511–515 (2010)

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank members of the Shi laboratory for discussions. We are especially indebted to L. Li for advice, discussion, and sharing reagents; to R. Meganck and A. Sancar for providing reagents and discussions; to F. Huetz for the cell-cycle analysis, S. Elledge for advice, and L. Izhar in the Elledge laboratory for teaching Y.X. how to perform laser micro-irradiation; and to L. Kraus for reagents and advice. We thank Abclonal Biotechnology and Santa Cruz Biotechnology for providing antibodies, and N. Mosammaparast and B. Sleckman for the H2A.X KO mouse embryonic fibroblast (MEF) cells. B.L. was supported by a fellowship from Association pour la Recherche sur le Cancer (ARC) (France) and National Institutes of Health 4 T32 HD 7466-20. This work was supported by a grant from the National Institutes of Health to Y.S. (R01 CA118487) and funds from Boston Children’s Hospital. Y.S. is an American Cancer Society Research Professor.

Author information

Authors and Affiliations

Authors

Contributions

The authorship order of Y.X., B.L., and C.H.H. was determined by a roll of the dice. A.J. is a senior author. Y.X. and Y.S. conceived and designed the project. Y.X., B.L., and C.H.H. designed, performed, and analysed experiments as described below with input from Y.S., A.J., and all authors. Y.X. and C.H.H. performed the micro-irradiation and global UV irradiation immunofluorescence experiments with help from W.S., C.X., H.C., J.O., and S.W. who cultured and prepared the cells. J.O. performed microfilter irradiation experiments under the supervision of L.Z. Y.X., B.L., and C.H.H. established KD, KO, and rescue cell lines with help from C.X., W.S., and D.L. RNA preparation and RNA m6A-seq experiments were performed by B.L. and S.N., and the data were analysed by Z.L. L.Z. provided discussions and input throughout the project, while C.H. provided advice on RNA m6A-seq data analysis performed by B.L. and S.N. Y.S. and A.J. wrote the manuscript with input from C.H., L.Z., and P.H.H.

Corresponding author

Correspondence to Yang Shi.

Ethics declarations

Competing interests

Y.S. is a cofounder of Constellation Pharmaceuticals and a member of its scientific advisory board, and a consultant for Active Motif, Inc.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data figures and tables

Extended Data Figure 1 The m6A-modified RNA accumulates at damage sites in response to UV irradiation.

a, U2OS cells were subjected to the indicated doses of UVC irradiation, incubated at 37 °C for 2 min, and co-stained for m6A and γH2A.X. Relative m6A intensity is indicated on the right. b, U2OS cells were subjected to irradiation with 50 J UVC through a micropore filter, incubated at 37 °C for 2 or 5 min, and co-stained for m6A and DNA (DAPI). c, A375 (melanoma) or HeLa cells were subjected or not (0′) to 25 J UVC irradiation, incubated at 37 °C for the indicated times, and then co-stained for m6A and γH2A.X. d, U2OS cells were subjected or not (0′) to 20 Gy of γ-irradiation, incubated at 37 °C for 4 min, and then co-stained for m6A and γH2A.X. e, U2OS cells were either irradiated with 25 J UVC or treated with DMSO, mitomycin C, hydroxyurea, or arabinoside-C, and then co-stained for m6A and γH2A.X. ce, Relative m6A intensity is indicated on the right. f, FUCCI cells were subjected to 25 J UVC irradiation (top) or micro-irradiation by UVA laser (bottom), incubated at 37 °C for 2 min, and stained for m6A. The top and bottom panels show m6A signal in representative S/G2/M- or G1-phase cells, respectively. Arrows in middle panels denote representative G1-phase cells negative for m6A signal. The percentage of G1 (red) or S/G2/M (green) cells positive for m6A signal is indicated on the right. g, U2OS cells were micro-irradiated by UVA laser, permeabilized and treated with or without RNase A, and co-stained for m6A and γH2A.X (left). The percentage of γH2A.X-positive cells displaying co-localizing m6A signal is indicated. Nucleic acids (DNA and RNA) from cells treated with or without RNase A were isolated and analysed on an agarose gel (right). Ladder, 1 kb DNA ladder. h, Poly(A)+ RNA was extracted from the samples in a and subjected to dot–blot analysis with an antibody recognizing m6A. Methylene blue staining was used as a loading control. All cells were pre-incubated with BrdU before UV or γ-irradiation.

Extended Data Figure 2 METTL3/14, but not WTAP, regulate m6A RNA at damage sites.

a, U2OS cells stably expressing Flag-tagged METTL3 were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and co-stained for m6A and Flag. The percentage of m6A-positive cells with co-localizing Flag signal is indicated on the right. The lower panel shows a representative cell with METTL3 localized at a damage site (arrow). b, Western blot for METTL3 in WT, METTL3 KO (M3 KO), or METTL3 KO U2OS cells stably expressing Flag-tagged METTL3 (M3 KO/WT-R) or its catalytic mutant (M3 KO/Cat-R). Actin is shown as a loading control. c, Western blot for METTL3 in U2OS cells expressing control (Control KD) or two independent shRNAs targeting METTL3 (M3 KD1 and M3 KD2). Actin is shown as a loading control. d, WT or METTL3 KO (M3 KO) U2OS cells were irradiated or not (0′) with 15 J UVC, incubated at 37 °C for 2 or 8 min, and then subjected to poly(A)+ RNA extraction. Isolated poly(A)+ RNA was analysed by dot–blot with an antibody recognizing m6A. Methylene blue staining was used as a loading control. e, Cells shown in c were subjected or not (0′) to 15 J UVC irradiation, incubated at 37 °C for 1, 2, 4, or 10 min, and then subjected to poly(A)+ RNA extraction and dot–blot analysis as described in d. f, WT cells were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and stained for γH2A.X and METTL14. Arrows indicate representative γH2A.X-positive cells with co-localizing METTL14. The percentage of γH2A.X-positive cells showing co-localization with METTL14 is indicated on the right. g, WT U2OS cells expressing control or an shRNA targeting WTAP (WTAP KD) were subjected to UVA laser micro-irradiation, incubated at 37 °C for 2 min, and then co-stained for γH2A.X and WTAP, using three independent WTAP antibodies as indicated. The percentage of γH2A.X-positive cells displaying co-localizing WTAP signal is indicated on the right. h, Western blot for METTL14 in U2OS cells expressing control shRNA or shRNA targeting METTL14 (M14 KD). Actin is shown as a loading control. i, Western blot of METTL3 and METTL14 in WT, two independent METTL3 KO (M3 KO), or two independent METTL3 KO/METTL14 KD (M3 KO + M14 KD) U2OS cell lines. Actin is shown as a loading control. M3 KO1 and M3 KO1 + M14 KD1 were used for all subsequent experiments. j, WT, METTL3 KD (M3 KD), METTL14 KD (M14 KD), WTAP KD, METTL3 KO (M3 KO), or METTL3 KO/METTL14 KD (M3 KO/M14 KD) U2OS cells were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and co-stained for m6A and γH2A.X. The percentage of γH2A.X-positive cells displaying co-localizing m6A signal is indicated on the right. All cells were pre-incubated with BrdU before UV irradiation. All images are representative of at least 50 cells in triplicate. Scale bar, 20 μm.

Extended Data Figure 3 FTO, but not ALKBH5, modulates m6A RNA levels and duration at damage sites.

a, WT or FTO KO U2OS cells were subjected to UVA laser micro-irradiation, incubated at 37 °C for 4 min, and then stained for FTO and γH2A.X as indicated. The middle panel shows a representative γH2A.X-positive cell with FTO co-localizing at the damage site (arrow). The percentage of cells showing co-localization of signals is indicated on the right. b, Western blot of FTO in WT or FTO KO U2OS cells. Actin is shown as a loading control. c, U2OS cells expressing control or one of two independent shRNAs targeting ALKBH5 (ALKBH5 KD1, KD2) were subject to qPCR analysis of ALKBH5 mRNA levels and normalized to GAPDH. d, WT or FTO KO U2OS cells were micro-irradiated by UVA laser, incubated at 37 °C for 4 min, and co-stained for m6A and γH2A.X. Two different exposures for m6A are shown. The percentage of γH2A.X-positive cells showing co-localizing m6A signal is indicated on the right. e, WT, FTO KO, and two ALKBH5 KD U2OS cell lines were irradiated with 50 J UVC, incubated at 37 °C for 2 min, and co-stained for m6A and γH2A.X. Relative m6A intensity is indicated on the right. All cells were pre-incubated with BrdU before UV irradiation. All images are representative of at least 50 cells in triplicate. Scale bar, 20 μm.

Extended Data Figure 4 METTL3, FTO, and PARP1 regulate m6A RNA at damage sites.

a, b, U2OS cells were subjected to UVA laser micro-irradiation, incubated at 37 °C for the indicated time, and then stained for γH2A.X and METTL3 (a) or FTO (b) as indicated. Cells in blue boxes are shown at higher magnification in the second column. Arrows denote γH2A.X-positive damage sites with co-localizing METTL3 (a) or FTO (b). The percentage of γH2A.X-positive cells displaying co-localizing METTL3 or FTO signal is indicated on the right. c, WT or H2A.X KO MEF cells were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and co-stained for m6A and TFIIH or γH2A.X as indicated. Where possible, the percentage of γH2A.X-positive cells showing co-localizing m6A signal is indicated on the right. d, U2OS cells pre-treated with DMSO or PARP inhibitors BYK, PJ-34, or olaparib were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and then co-stained for m6A and γH2A.X. e, U2OS cells pre-treated with DMSO or PARP inhibitor (olaparib, 10 μM) were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and then stained for PARP1, poly(ADP-ribos)ylation (PAR), m6A, and γH2A.X as indicated. The percentage of γH2A.X-positive cells showing co-localizing signal is indicated on the right. f, U2OS cells pre-treated with DMSO or PARP inhibitor (olaparib, 10 μM) were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and then co-stained for γH2A.X and METTL3. Arrows denote representative γH2A.X-positive cells displaying co-localizing METTL3 signal. The percentage of γH2A.X-positive cells showing co-localizing METTL3 is indicated on the right. All cells were pre-incubated with BrdU before UV irradiation. All images are representative of at least 50 cells in triplicate. Scale bar, 20 μm.

Extended Data Figure 5 Sequencing analysis of m6A-methylated RNAs responding to UV.

a, Pie-chart representation of the distribution of m6A peaks in different transcript segments in U2OS cells before (left) or 2 min after irradiation with 50 J UVC (right). CDS, coding sequence region. b, Correlation of m6A peaks between two independent samples from U2OS cells before (top) or 2 min after (bottom) irradiation with 50 J UVC. A total of four replicates was performed for unirradiated cells, and three for irradiated cells. c, Metagene profiles of m6A distribution across the transcriptome of U2OS cells before (−UV) or 2 min after (+UV) irradiation with 50 J UVC. d, Overlap of m6A peaks identified in mRNAs isolated from U2OS cells before (13,989 peaks) or 2 min after irradiation with 50 J UVC (15,465 peaks) (top), and Metagene profiles of m6A peaks uniquely present in unirradiated (3,156 peaks) or irradiated cells (4,632 peaks) (bottom). e, Consensus motifs enriched in m6A peaks from transcripts identified in UV-irradiated cells (15,465 peaks). f, Consensus motifs enriched in m6A peaks from transcripts uniquely methylated in irradiated cells (4,632 peaks). g, Overlap of m6A peaks identified in mRNAs isolated from METTL3 KO cells before (13,852 peaks) or 2 min after (9,471 peaks) irradiation with 50 J UVC. h, Overlap of transcripts that are uniquely methylated after irradiation with 50 J UV in WT and METTL3 KO cells (3,412 and 1,840 transcripts, respectively). i, Correlation of m6A peaks between two independent samples from METTL3 KO cells before (left) or 2 min after irradiation with 50 J UVC (right). All cells were pre-incubated with BrdU before UV irradiation. A total of three replicates was performed for each condition.

Extended Data Figure 6 RNA with m6A modification is required for efficient DNA repair and cell survival after UV exposure.

a, U2OS cells pre-treated with DMSO or PARP inhibitor (olaparib, 10 μM) were subjected or not to 15 J UVC irradiation and incubated at 37 °C for 1, 2, 4, or 6 h. Genomic DNA was purified from unirradiated or irradiated cells, and then subjected to dot–blot analysis with an antibody recognizing CPDs. Methylene blue staining was used as a loading control. b, WT A375 cells, A375 cells expressing METTL3 shRNA (METTL3 KD), or METTL3 KD cells stably expressing shRNA-resistant METTL3 (M3 KD/WT-R) were subjected or not to 25 J UVC irradiation and incubated at 37 °C for 12 or 24 h. Nascent RNA was labelled in unirradiated or irradiated cells at each time-point by incubating for an additional 3 h with 1 mM 5-ethynyl uridine (EU) (green). Images are representative of at least 50 cells in triplicate. Scale bar, 20 μm. c, WT, METTL3 KO (M3 KO), or METTL3 KO U2OS cells stably expressing Flag-tagged METTL3 (M3 KO/WT-R) or its catalytic mutant (M3 KO/Cat-R) were subjected to different dosages of UVC irradiation (0, 5, 10, and 15 J) and used to perform a colony-formation assay. Colonies were stained by crystal violet solution 10–14 days after seeding; the quantification is shown in Fig. 3d. d, U2OS cells infected with control, two independent METTL3 shRNAs (M3 KD1 and M3 KD2), or M3 KD1 cells stably expressing shRNA-resistant WT METTL3 (KD1/WT-R) or its catalytic mutant (KD1/Cat-R) were subjected to different dosages of UVC irradiation (0, 5, 10, and 15 J) and used to perform a colony-formation assay. Colonies were stained by crystal violet solution 10–14 days after seeding (top), and the number of colonies was determined (bottom). The y axis represents colony survival normalized to unirradiated control. All cells were pre-incubated with BrdU before UV irradiation. Results are shown as the mean ± s.e.m. from at least three independent experiments. **P ≤ 0.01 by two-tailed Student’s t-test.

Extended Data Figure 7 RNA with m6A modification does not interact with canonical NER or DSB repair pathways.

a, U2OS cells were subjected to UVA laser micro-irradiation, incubated at 37 °C for 2 min and co-stained for γH2A.X and m6A, XPA, TFIIH, DDB2, XPC, CSA, or CPD as indicated. b, c, WT or METTL3 KO (M3 KO) U2OS cells were subjected to UVA laser, incubated at 37 °C for 2 min, and then co-stained for γH2A.X and XPA or TFIIH (b), and 53BP1 or BRCA1 (c), as indicated. ac, The percentage of γH2A.X-positive cells displaying the indicated signal co-localizing with γH2A.X is shown on the right. All cells were pre-incubated with BrdU before UV irradiation.

Extended Data Figure 8 RNA with m6A modification recruits Pol κ to damage sites.

a, WT or METTL3 KO/METTL14 KD (M3 KO/M14 KD) U2OS cells were micro-irradiated by UVA laser, incubated at 37 °C for 30 s to 10 min, and then stained for the indicated polymerases and γH2A.X. Staining for each polymerase was conducted at the peak of its localization, which occurred at 4 min after UV irradiation for Pol κ, and 8 min after UV irradiation for Pol δ, Pol ε, and Pol η. Pol ι was not detected during the first 10 min after irradiation, using either of the two antibodies listed in the Methods section (ABclonal A1942 shown). Arrows denote representative γH2A.X-positive damage sites with co-localizing polymerase. The percentage of γH2A.X-positive cells displaying the indicated signal co-localizing with γH2A.X is indicated on the right. b, Table summarizing the observed localization patterns of the tested polymerases (from a and Fig. 4a). c, U2OS cells were subjected to UVA laser micro-irradiation, incubated at 37 °C for the indicated time, and then co-stained for Pol κ and γH2A.X as shown. Arrows denote representative γH2A.X-positive damage sites with co-localizing Pol κ. The percentage of γH2A.X-positive cells displaying co-localizing Pol κ is indicated on the right. The 10 min time-point displayed greater cell-to-cell heterogeneity in the intensity of Pol κ staining than the other time-points. d, Western blot of Pol κ in WT or METTL3 KO (M3 KO) U2OS cells. Actin is shown as a loading control. e, U2OS cells pre-treated with DMSO or PARP inhibitor (olaparib, 10 μM) were micro-irradiated by UVA laser, incubated at 37 °C for 2 min, and then co-stained for γH2A.X and Pol κ, as indicated. Arrows denote representative γH2A.X-positive damage sites with co-localizing Pol κ, and the percentage of cells showing co-localization is indicated on the right. All images are representative of at least 50 cells in triplicate. Scale bar, 20 μm. f, Western blot of Pol κ, Flag, and METTL3 in WT, METTL3 KO, and METTL3 KO U2OS cells stably expressing Flag-tagged Pol κ (M3 KO/Flag–Pol κ). g, METTL3 KO (M3 KO) or METTL3 KO U2OS cells stably expressing Flag-tagged Pol κ (M3 KO/Flag–Pol κ) were irradiated or not (0 h) with UVC, and incubated at 37 °C, at which point genomic DNA was extracted. DNA was subjected to dot–blot analysis with an antibody recognizing CPDs. Methylene blue staining was used as a loading control. All cells were pre-incubated with BrdU before UV irradiation.

Extended Data Figure 9 The m6A readers and known Pol κ interactors are not responsible for early Pol κ recruitment to UV damage sites.

a, WT U2OS cells, stably expressing Flag-tagged YTHDC1, YTHDF1, or YTHDF2, were subjected to UVA laser micro-irradiation, incubated at 37 °C for 2 min and co-stained for Flag and m6A or γH2A.X as indicated. b, WT, HNRNPA2B1 KD, YTHDC1 KD, YTHDF1 KD, or YTHDF2 KD U2OS cells were subjected to UVA laser micro-irradiation, incubated at 37 °C for 2 min and co-stained for Pol κ and γH2A.X. c, XPA KD or PCNA KD U2OS cells were subjected to UVA laser micro-irradiation, incubated at 37 °C for 2 min and co-stained for Pol κ and γH2A.X. ac, Data from one representative experiment are shown. d, U2OS cells were subjected to UVA laser micro-irradiation and incubated at 37 °C for 2 or 10 min, and then co-stained for γH2A.X and m6A, Pol κ, or RAD18 as indicated. Arrows denote representative γH2A.X-positive damage sites with co-localizing Pol κ; n = 3, 50 cells per replicate. ad, The percentage of cells displaying the indicated signal co-localizing with γH2A.X (or with m6A (a, left)) is indicated on the right. All cells were pre-incubated with BrdU before UV irradiation. Scale bar, 20 μm.

Extended Data Figure 10 Knockdown efficiencies of candidates tested for their effects on Pol κ recruitment.

af, U2OS cells were infected with control or shRNA targeting (a) HNRNPA2B1 (HNRNPA2B1 KD), (b) YTHDF1 (YTHDF1 KD), (c) YTHDC1 (YTHDC1 KD), (d) YTHDF2 (YTHDF2 KD), (e) XPA (XPA KD), or (f) PCNA (PCNA KD). mRNA levels were measured by qPCR and normalized to that of GAPDH. Results are shown as the mean ± s.e.m. from at least three independent experiments. Protein expression levels were examined in control and KD cells by western blot; actin is shown as a western blot loading control.

Supplementary information

Supplementary Information

This file contains the original source images for all data obtained by electrophoretic separation in the study. (PDF 331 kb)

PowerPoint slides

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Xiang, Y., Laurent, B., Hsu, CH. et al. RNA m6A methylation regulates the ultraviolet-induced DNA damage response. Nature 543, 573–576 (2017). https://doi.org/10.1038/nature21671

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nature21671

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing