The crystal structure of Cpf1 in complex with CRISPR RNA

Abstract

The CRISPR–Cas systems, as exemplified by CRISPR–Cas9, are RNA-guided adaptive immune systems used by bacteria and archaea to defend against viral infection1,2,3,4,5,6,7. The CRISPR–Cpf1 system, a new class 2 CRISPR–Cas system, mediates robust DNA interference in human cells1,8,9,10. Although functionally conserved, Cpf1 and Cas9 differ in many aspects including their guide RNAs and substrate specificity. Here we report the 2.38 Å crystal structure of the CRISPR RNA (crRNA)-bound Lachnospiraceae bacterium ND2006 Cpf1 (LbCpf1). LbCpf1 has a triangle-shaped architecture with a large positively charged channel at the centre. Recognized by the oligonucleotide-binding domain of LbCpf1, the crRNA adopts a highly distorted conformation stabilized by extensive intramolecular interactions and the (Mg(H2O)6)2+ ion. The oligonucleotide-binding domain also harbours a looped-out helical domain that is important for LbCpf1 substrate binding. Binding of crRNA or crRNA lacking the guide sequence induces marked conformational changes but no oligomerization of LbCpf1. Our study reveals the crRNA recognition mechanism and provides insight into crRNA-guided substrate binding of LbCpf1, establishing a framework for engineering LbCpf1 to improve its efficiency and specificity for genome editing.

Access options

Rent or Buy article

Get time limited or full article access on ReadCube.

from$8.99

All prices are NET prices.

Figure 1: Triangle-shaped structure of the LbCpf1–crRNA complex.
Figure 2: The distorted conformation of the LbCpf1-bound crRNA is stabilized by extensive intramolecular interactions and (Mg(H2O)6)2+.
Figure 3: Recognition of crRNA by LbCpf1.
Figure 4: LHD is involved in dsDNA binding of LbCpf1.

Accession codes

Primary accessions

Protein Data Bank

Data deposits

The atomic coordinates and structure factors of the LbCpf1-crRNA complex have been deposited in the Protein Data Bank under the accession code 5ID6.

References

  1. 1

    Makarova, K. S. et al. An updated evolutionary classification of CRISPR–Cas systems. Nature Rev. Microbiol. 13, 722–736 (2015)

    CAS  Article  Google Scholar 

  2. 2

    Wiedenheft, B., Sternberg, S. H. & Doudna, J. A. RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331–338 (2012)

    CAS  ADS  Article  Google Scholar 

  3. 3

    Marraffini, L. A. CRISPR-Cas immunity in prokaryotes. Nature 526, 55–61 (2015)

    CAS  ADS  Article  Google Scholar 

  4. 4

    Barrangou, R. et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 1709–1712 (2007)

    CAS  ADS  PubMed  PubMed Central  Google Scholar 

  5. 5

    Garneau, J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67–71 (2010)

    CAS  ADS  Article  Google Scholar 

  6. 6

    Westra, E. R. et al. The CRISPRs, they are a-changin’: how prokaryotes generate adaptive immunity. Annu. Rev. Genet. 46, 311–339 (2012)

    CAS  Article  Google Scholar 

  7. 7

    Sorek, R., Lawrence, C. M. & Wiedenheft, B. CRISPR-mediated adaptive immune systems in bacteria and archaea. Annu. Rev. Biochem. 82, 237–266 (2013)

    CAS  Article  Google Scholar 

  8. 8

    Schunder, E., Rydzewski, K., Grunow, R. & Heuner, K. First indication for a functional CRISPR/Cas system in Francisella tularensis . Int. J. Med. Microbiol. 303, 51–60 (2013)

    CAS  Article  Google Scholar 

  9. 9

    Zetsche, B. et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759–771 (2015)

    CAS  Article  Google Scholar 

  10. 10

    Wright, A. V., Nuñez, J. K. & Doudna, J. A. Biology and applications of CRISPR systems: harnessing nature’s toolbox for genome engineering. Cell 164, 29–44 (2016)

    CAS  Article  Google Scholar 

  11. 11

    Barrangou, R. & Marraffini, L. A. CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity. Mol. Cell 54, 234–244 (2014)

    CAS  Article  Google Scholar 

  12. 12

    Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167–170 (2010)

    CAS  ADS  PubMed  PubMed Central  Google Scholar 

  13. 13

    van der Oost, J. et al. CRISPR-based adaptive and heritable immunity in prokaryotes. Trends Biochem. Sci. 34, 401–407 (2009)

    CAS  Article  Google Scholar 

  14. 14

    Jiang, W. & Marraffini, L. A. CRISPR-Cas: new tools for genetic manipulations from bacterial immunity systems. Annu. Rev. Microbiol. 69, 209–228 (2015)

    CAS  Article  Google Scholar 

  15. 15

    Sternberg, S. H. & Doudna, J. A. Expanding the biologist’s toolkit with CRISPR-Cas9. Mol. Cell 58, 568–574 (2015)

    CAS  Article  Google Scholar 

  16. 16

    Hsu, P. D., Lander, E. S. & Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262–1278 (2014)

    CAS  Article  Google Scholar 

  17. 17

    Anders, C., Niewoehner, O., Duerst, A. & Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature 513, 569–573 (2014)

    CAS  ADS  Article  Google Scholar 

  18. 18

    Nishimasu, H. et al. Crystal structure of Staphylococcus aureus Cas9. Cell 162, 1113–1126 (2015)

    CAS  Article  Google Scholar 

  19. 19

    Nishimasu, H. et al. Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 156, 935–949 (2014)

    CAS  Article  Google Scholar 

  20. 20

    Jinek, M. et al. Structures of Cas9 endonucleases reveal RNA-mediated conformational activation. Science 343, 1247997 (2014)

    Article  Google Scholar 

  21. 21

    Jiang, F. et al. A Cas9-guide RNA complex preorganized for target DNA recognition. Science 348, 1477–1481 (2015)

    CAS  ADS  Article  Google Scholar 

  22. 22

    Deltcheva, E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 471, 602–607 (2011)

    CAS  ADS  Article  Google Scholar 

  23. 23

    Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 (2012)

    CAS  ADS  Article  Google Scholar 

  24. 24

    Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnol. 31, 827–832 (2013)

    CAS  Article  Google Scholar 

  25. 25

    Garneau, J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67–71 (2010)

    CAS  ADS  Article  Google Scholar 

  26. 26

    Draper, D. E. & Reynaldo, L. P. RNA binding strategies of ribosomal proteins. Nucleic Acids Res. 27, 381–388 (1999)

    CAS  Article  Google Scholar 

  27. 27

    Draper, D. E., Grilley, D. & Soto, A. M. Ions and RNA folding. Annu. Rev. Biophys. Biomol. Struct. 34, 221–243 (2005)

    CAS  Article  Google Scholar 

  28. 28

    Fonfara, I. et al. The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature http://dx.doi.org/10.1038/nature17945 (20 April 2016)

  29. 29

    Bessho, Y. et al. Structural basis for functional mimicry of long-variable-arm tRNA by transfer-messenger RNA. Proc. Natl Acad. Sci. USA 104, 8293–8298 (2007)

    CAS  ADS  Article  Google Scholar 

  30. 30

    Kamadurai, H. B., Jain, R. & Foster, M. P. Crystallization and structure determination of the core-binding domain of bacteriophage lambda integrase. Acta Crystallogr. Sect. F 64, 470–473 (2008)

    CAS  Article  Google Scholar 

  31. 31

    Otwinowski, Z. & Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307–326 (1997)

    CAS  Article  Google Scholar 

  32. 32

    McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Crystallgr. 40, 658–674 (2007)

    CAS  Article  Google Scholar 

  33. 33

    Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D 60, 2126–2132 (2004)

    Article  Google Scholar 

  34. 34

    Adams, P. D. et al. PHENIX: building new software for automated crystallographic structure determination. Acta Crystallogr. D 58, 1948–1954 (2002)

    Article  Google Scholar 

  35. 35

    DeLano, W. L. PyMOL Molecular Viewer (http://www.pymol.org) (2002)

  36. 36

    Wienken, C. J., Baaske, P., Rothbauer, U. & Braun, D. Protein-binding assays in biological liquids using microscale thermophoresis. Nat. Commun. 1, 100 (2010)

    ADS  Article  Google Scholar 

  37. 37

    Tang, G. et al. EMAN2: an extensible image processing suite for electron microscopy. J. Struct. Biol. 157, 38–46 (2007)

    CAS  Article  Google Scholar 

  38. 38

    Scheres, S. H. RELION: implementation of a Bayesian approach to cryo-EM structure determination. J. Struct. Biol. 180, 519–530 (2012)

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We thank F. Yu and J. He at Shanghai Synchrotron Radiation Facility for help with data collection. We thank J. Chai for critical reading of the manuscript. We acknowledge the Tsinghua University Branch of China National Center for Protein Sciences Beijing for providing the facility support. This research was funded by the National Natural Science Foundation of China grant numbers 31422014, 31450001 and 31300605 to Z.H.

Author information

Affiliations

Authors

Contributions

Z.H. designed the experiments. D.D., K.R. and X.Q. performed the bulk of the experiments. Data were analysed by Z.H., D.D., K.R. and X.Q.; J. Z., M.G., X.G., H. L., N.L., D.Y., C.M., S.W., D.W., B.Z., Y.M., S.F., N.G. and J.W. contributed to some experiments and discussions. Z.H., D.D., K.R. and X.Q. wrote the paper.

Corresponding author

Correspondence to Zhiwei Huang.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Extended data figures and tables

Extended Data Figure 1 Structural comparison of the RuvC domains of LbCpf1, SaCas9 and SpyCas9.

Structural superposition of LbCpf1RuvC with SaCas9RuvC (PDB, 5CZZ) and SpyCas9RuvC (PDB, 4UN3). The catalytic residues of the three RuvC domains are labelled. LbCpf1RuvC, SaCas9RuvC and SpyCas9RuvC domains are coloured in grey, green and cyan, respectively.

Extended Data Figure 2 Structural comparison of the LbCpf1-bound crRNA and the SpyCas9-bound sgRNA.

Shown are the structures of LbCpf1-bound crRNA (left) and the SpyCas9-bound sgRNA (PDB, 4UN3) (right).

Extended Data Figure 3 The direct repeat sequence of crRNA binds LbCpf1.

a, crRNA in the crystal remains intact. Crystals of the LbCpf1–crRNA complex were collected and the integrity of crRNA was checked by denaturing TBE-urea (10%) polyacrylamide gel electrophoresis and stained by ethidium bromide. b, A crRNA lacking the guide sequence (crRNA*) binds LbCpf1. Data shown here are representative of three independent microscale thermophoresis experiments and the errors were calculated as standard deviation. c, crRNA* inhibits crRNA-guided LbCpf1 endonuclease activity in vitro. 0.8 μg crRNA and 3 μg purified LbCpf1 protein were mixed with varying amount of crRNA*. 1 μg dsDNA was then added to the mixture that was pre-incubated at 37 °C for 10 min. The nucleotides were analysed by running the mixture on TBE-urea polyacrylamide gels (10%) and visualized by ethidium bromide staining. Non-target strand sequence: 5′-TCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGA AAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCTTTAGAGAAGTCATTTAATAAGGCCACTGTTAAAAAGCTTGGCGTAATCAGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA-3′.

Extended Data Figure 4 Sequence alignment of Cpf1 proteins from different species.

Sequence alignment of Cpf1 proteins from different species. Conserved and similar residues are highlighted with red and yellow grounds respectively. Residues of LbCpf1 involved in crRNA interaction are indicated with slate solid dots at bottom. α-helices and β-strands are shown as curly and arrow symbols, respectively. Protein domains identified in the structure are indicated.

Extended Data Figure 5 crRNA binding triggers dramatic structure rearrangement of LbCpf1.

a, crRNA binding induces no oligomerization of LbCpf1 in sedimentation-velocity analytical ultracentrifugation. The peak sedimentation coefficients and the calculated molecular weights for LbCpf1 in the absence (blue) and presence (red) of crRNA are indicated. The frictional coefficient ratios for LbCpf1 and LbCpf1–crRNA are 2.19 and 1.89, respectively. b, crRNA binding renders LbCpf1 more resistant to trypsin. The full-length LbCpf1 protein was treated with trypsin in the absence or presence of crRNA or crRNA* for 30 min. The samples were then subjected to SDS–PAGE analysis. crRNA*, crRNA with the guide sequence deleted. c, Negative staining electron microscopy analysis of LbCpf1 and LbCpf1–crRNA complexes. Left, representative raw micrographs of negative-stained LbCpf1 (top) and LbCpf1–crRNA complex (bottom) samples. Right, representative 2D class averages of negatively stained particles of LbCpf1 (top) and LbCpf1–crRNA complex (bottom) samples.

Extended Data Figure 6 LHD is stabilized by interaction with LbCpf1 from a different asymmetric unit.

LHD is involved in crystal packing in the LbCpf1–crRNA crystals. Shown in the figure are the LbCpf1–crRNA structures from two neighbouring asymmetric units. The LHD and UK domains of LbCpf1 are shown in magenta and slate, respectively. Packing between the LHD from one asymmetric unit and the UK domain from a neighbouring asymmetric unit is marked with the red dashed circle.

Extended Data Figure 7 A LHD-truncated LbCpf1 protein retains high binding affinity with crRNA.

Data shown are representatives of three independent microscale thermophoresis experiments; error bars, s.d.

Extended Data Figure 8 The interactions of 5′ end of crRNA with LbCpf1.

Detailed interactions of sugar-phosphate backbone of crRNA with LbCpf1 OBD. The residues from OBD responsible for LbCpf1 crRNA cleavage activity are labelled and shown in aquamarine.

Extended Data Figure 9 A model of crRNA-guided LbCpf1 activation.

a, A model of LbCpf1 activation triggered by crRNA. The apo state LbCpf1 is maintained in an expended conformation. LbCpf1 is switched into a substrate-binding state through structural rearrangement trigger by crRNA binding to the OBD of LbCpf1. Then substrate DNA binds to LbCpf1 with the involvement of the LHD and base pairs with the LbCpf1-bound crRNA, resulting in endonuclease cleavage of the dsDNA. b, A model of non-target and target DNA (shown in green) bound to LbCpf1. Individual LbCpf1 domains are coloured according to the scheme in a, crRNA is shown in cartoon and coloured in orange.

Extended Data Table 1 Data collection, phasing and refinement statistics

Supplementary information

Supplementary Figure

This file contains the uncropped scans, with size marker indications, for Figure 4d and Extended Data Figures 3a, c and 5b. (PDF 283 kb)

PowerPoint slides

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Dong, D., Ren, K., Qiu, X. et al. The crystal structure of Cpf1 in complex with CRISPR RNA. Nature 532, 522–526 (2016). https://doi.org/10.1038/nature17944

Download citation

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing