Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Lymphoma

Constitutive activation of STAT3 in Sézary syndrome is independent of SHP-1

Abstract

Constitutive and persistent activation of STAT3 has been implicated in the pathogenesis of many malignancies. Studies of CTCL cell lines have previously suggested that aberrant activation of STAT3 is mediated via silencing of the negative regulator SHP-1 by promoter methylation. In this study of ex vivo tumour cell populations from 18 Sézary syndrome (SS) patients, constitutive phosphorylation of STAT3, JAK1 and JAK2 was present in all patients, but was absent in comparative CD4+ T-cells from healthy controls. Furthermore, no loss or significant difference in SHP-1 expression was observed between patients and healthy control samples. Methylation-specific PCR analysis of the SHP-1 CpG island in 47 SS patients and 11 healthy controls did not detect any evidence of methylation. Moreover, small interfering RNA knockdown of SHP-1 had no effect on phosphorylation of STAT3. In contrast, treatment of SS tumour cells with the pan-JAK inhibitor pyridone 6 led to downregulation of phosphorylated STAT3 (pSTAT3), its target genes and induction of apoptosis. No evidence for common JAK1/JAK2-activating mutations was found. These data demonstrate that constitutive activation of STAT3 in SS is not due to the loss of SHP-1, but is mediated by constitutive aberrant activation of JAK family members.

Introduction

Sézary syndrome (SS) is the leukaemic variant of primary cutaneous T-cell lymphoma (CTCL) with an aggressive clinical course, poor prognosis and median survival of 3.13 years.1 The aetiology of SS is not well understood, but in common with other types of CTCL, it is characterised by a clonal proliferation of malignant mature T-cells (Sézary cells) that display skin-homing properties mediated via expression of the receptors CLA and CCR4. A recent immunophenotypic study suggests that the origin of Sézary cells is the central memory T-cell pool, while skin-restricted mycosis fungoides (MF) is derived from skin-resident effector memory T-cells.2 Sézary cells can also be further differentiated from MF cells, based on high level co-expression of the lymph node homing markers CCR7 and L-selectin.

Sézary cells have a low proliferative potential and their accumulation appears to be due to defective T-cell homeostatic mechanisms mediated by dysregulation of key signalling pathways controlling apoptosis and survival.3 The signal transducers and activators of transcription (STATs) are a pleiotropic family of transcription factors that have a pivotal role regulating many gene networks, including those involved in cell survival and proliferation.4 There are seven STAT family gene members that show a high degree of sequence identity at the amino-acid level. Phosphorylation of STATs is normally a rapid and transient process mediated via protein ligand binding of cell-surface cytokine and growth factor receptors that trigger a cascade of phosphorylation events involving the JAK kinases and culminating in the phosphorylation of STATs on a single tyrosine residue.5 Phosphorylated STATs (pSTATs) dimerise and are transported to the nucleus where they activate transcription of target genes. Until recently it was thought that only pSTATs could function as transcription factors, but it is now clear that unphosphorylated monomeric STATs have a distinct set of target genes to their phosphorylated counterparts and can shuttle between the cytoplasm and nucleus in the absence of cytokine activation.6, 7

The most strongly implicated STAT in oncogenesis is STAT3, which is considered an oncogene through its ability to transform cultured cells.8 Persistent or constitutive JAK–STAT3 activation is common in many solid and haematological malignancies, and is recognised as a significant driver of pathways mediating tumour initiation, development and progression.9 Constitutive activation of STAT3 has been demonstrated in studies of cell lines derived from MF and SS patients and anaplastic large cell lymphoma.10, 11, 12, 13, 14, 15, 16, 17, 18, 19 In lesional patient-derived material, strong expression of pSTAT3 has been identified by immunohistochemistry in tumour biopsy samples from advanced stage MF patients, but only weak expression was detected in early patch/plaque lesions.11 In SS patients, the activation status of STAT3 is less clear, with one study demonstrating the strong expression of pSTAT3 in peripheral blood mononuclear cells (PBMCs) from only 2 of 14 patients.10 Another study of six SS patients suggested that activation of STAT3 is not constitutive, but is cytokine dependent.17 However, a recent report demonstrated persistent and constitutive activation of STAT3 in PBMCs from 4/4 SS/MF patients.18

STAT3 activation may be a key abnormality in CTCL because abrogation of constitutive STAT3 activity by dominant-negative STAT3 mutant proteins or STAT3 knockdown by small interfering RNA (siRNA) induces apoptosis in CTCL cell lines.11, 12 The downstream effects of STAT3 knockdown are downregulation of expression of key pSTAT3 target genes including the prosurvival genes Bcl-XL, Mcl-1 and Survivin and the regulators of cell growth cyclin D1, cyclin D2 and cMyc.20

No activating mutations of STAT3 have been reported, and persistent or constitutive STAT3 activation has been attributed to a variety of upstream events in different malignancies based on both studies, in vitro using cell lines and ex vivo using primary cancer cells. In the chronic myeloproliferative disorders, essential thrombocythemia, primary myelofibrosis and polycythemia vera, the activating JAK2 mutation, JAK2 V617F has been detected at a very high frequency.21 In contrast, activating JAK mutations appear to be much less frequent in lymphoid malignancies, and alternative mechanisms of STAT3 activation includes the anaplastic lymphoma kinase (ALK) gene fusion with nucleophosmin found in a subset of anaplastic large cell lymphoma patients,22 and the nuclear pore protein NUP214–ABL1 kinase fusion protein in a small proportion of T-cell acute lymphoblastic leukaemia cases.23 Gain-of-function mutations in JAK1 and JAK3 are notably absent in adult T-cell leukaemia/lymphoma.24 To date, only JAK3 mutations have been investigated in CTCL, and a study of 30 patients found the JAK3 A572V mutation in only one patient with MF and large cell transformation.25

In normal cells, the JAK–STAT3 pathway is tightly regulated, primarily by negative feedback mechanisms involving the protein inhibitors of activated STATs, the suppressors of cytokine signalling (SOCS) and the SH2-containing phosphatases (SHPs). Loss of SHP-1 expression has been linked to aberrant JAK–STAT3 activation in several malignancies, including multiple myeloma,26 adult T-cell leukaemia/lymphoma27 and in a subset of MF patients with large cell transformation28, 29 or advanced tumour stage disease.30 The mechanism of SHP-1 inactivation has been attributed to epigenetic silencing by aberrant promoter hypermethylation, demonstrated by methylation-specific PCR (MSP) in CTCL-derived cell lines,28 and in diagnostic samples from myeloma26 and adult T-cell leukaemia/lymphoma27 rather than due to inactivating mutations. To date, the role of SHP-1 in the persistent activation of the JAK–STAT3 pathway in SS patients has not been investigated.

The aim of this study was to examine the frequency of JAK–STAT3 activation in ex vivo-enriched primary tumour cell populations derived from the peripheral blood of SS patients and to determine whether this is mediated by inactivation of SHP-1.

Patients and methods

Patients and cell lines

All patients fulfilled the WHO–EORTC diagnostic criteria for SS,1 and the presence of an identical T-cell clone was demonstrated in peripheral blood and lesional skin biopsy by TCR gene rearrangement studies using BIOMED-2 primer sets.31 Sézary cell counts were determined at the time of diagnosis and all patients included in the study had a Sézary count >1000 cells/μl3. Total lymphocyte, CD4 counts and CD4/CD8 ratios were noted at sampling as an indicator of tumour burden. All patient samples were obtained from the nationally approved Cutaneous Lymphoma Research Tissue Bank (07/H10712/106). Healthy control samples were obtained with the approval of the Guy's and St Thomas' Hospital Research Ethics Committee (EC01/301).

A total of 59 patients were involved in this study. For experiments involving freshly isolated enriched tumour cell populations, 18 patients were studied. Multiple samples were available from 10 of the 18 patients, and were used for the functional studies. In addition, genomic DNA from enriched tumour samples from 47 SS patients were analysed for the SHP-1 methylation study.

Primary keratinocytes from healthy skin biopsy samples were available in the department. The CTCL cell lines, HuT78 and SeAx, were gifts from Dr S John (King's College London) and Dr M Vermeer (Leiden University Medical Centre), respectively. MyLa and HEK293 cells were obtained from the ECACC (Salisbury, UK). All cultures were maintained in RPMI containing 10% fetal calf serum and 1% penicillin/streptomycin (Invitrogen, Paisley, UK). SeAx cells were supplemented with interleukin (IL)-2 (25 U/ml).

Enrichment of SS tumour cell populations

At present, there are no tumour-specific cell surface biomarkers available to isolate Sézary cells. We have previously shown that because of the marked heterogeneity of tumour cell populations, isolation of CD4+ T-cells is the most appropriate method to enrich for tumour cells without loss of tumour cell sub-populations.32, 33 Lymphoprep (Axis-shield, Kimbolton, UK) gradient centrifugation was used either directly to isolate peripheral blood lymphocytes or following incubation with RosetteSep CD4+ T-cell enrichment cocktail (Stem Cell Technologies, Grenoble, France) to isolate CD4+ T-cells.

Immunoblotting

Cell lysates were prepared and immunoblotting was performed using standard procedures. Each blot was incubated overnight at 4 °C with anti-STAT3, anti-phospho-STAT3, anti-JAK1, anti-phospho-JAK1, anti-JAK2, anti-phospho-JAK2 (New England Biolabs, Hitchin, UK) or polyclonal anti-SHP-1 (Atlas antibodies AB, Stockholm, Sweden) according to the manufacturer's instructions. Immunoreactivity was detected using peroxide-conjugated anti-mouse or anti-rabbit secondary antibody (Abcam, Cambridge, UK), and was visualised using enhanced chemiluminescence (ECL, GE Healthcare, Chalfont St Giles, UK).

Intracellular flow cytometry

All experiments analysed with multiple antibodies were performed sequentially on the same day. A total volume of 1 × 106 cells/ml were fixed in 1% formaldehyde and then permeabilised in 90% methanol. Following permeabilisation, cells were treated for 1 h with the following primary antibodies; anti-STAT3 (1/100), anti-phospho-STAT3 (1/50), anti-JAK-1 (1/100), anti-phospho-JAK1 (1/50), anti-JAK2 (1/100), anti-phospho-JAK2 (1/50) and anti-SHP-1 (1/150). Cells were then incubated with a fluorescent secondary antibody (Alexa Fluro 488 goat anti-rabbit IgG or Alexa Fluro 588 goat anti-mouse IgG, Invitrogen). To detect background fluorescence, samples were incubated with a rabbit or mouse isotype control (Invitrogen). Flow cytometry analysis was performed on a FACSAriaII (BD Biosciences, Oxford, UK); machine settings were standardized and retained throughout the study; 10 000 events were acquired per sample and delta mean fluorescent intensity was calculated by subtracting the mean fluorescent intensity of the isotype control from the mean fluorescent intensity of the specific antibody using Flowjo software (Tree Star Inc., Ashland, OR, USA).

Methylation-specific PCR

DNA was bisulphite converted using the EZ DNA Methylation-Gold Kit (Zymo Research Corporation, Orange, CA, USA), then amplified using the previously published SHP-1 primers.34 Methylation and unmethylation-specific PCRs were performed concurrently for each set of samples and each PCR included the following samples: DNA from the Jurkat cell line as a positive control for unmethylated DNA; Jurkat DNA, which had been methylated in vitro using the M.SssI CpG methyltransferase enzyme (New England Biolabs) to generate completely methylated DNA.

Pyrosequencing

Bisulphite-converted DNA was subjected to PCR using the primers S1F–biotin-TGTTTTATAGGGTTGTGGTGAGA and S1R–CTCCAAACCCAAATAATACTTCA or S2F–TGTTTTATAGGGTTGTGGTGAGA and S1R–biotin-CTCCAAACCCAAATAATACTTCA. An aliquot was taken to check for amplification of the correct size product then 20 μl of PCR amplicon was immobilised onto 4 μl of streptavidin sepharose HP beads (GE Healthcare) and a vacuum prep workstation (Biotage AB, Uppsala, Sweden) was used to isolate and wash the beads with bound single-stranded PCR product. These were deposited onto a pyrosequencing plate (Biotage) and sequencing primer S1S–CCTCCACCAACTACTTTT or S2S–GGAGGAGGGAGAGATG annealed. The pyrosequencing reaction was carried out using a PSQ HS 96 machine (Biotage) following the manufacturer's instructions for methylation analysis.

siRNA knockdown

MyLa cells were washed and resuspended to a cell density of 1 × 106 cells/ml. Electroporation was performed using the electroporator Bio-Rad, Gene Pulser II and 4 mm electroporation cuvettes (Flowgen, East Yorkshire, UK). The samples were electroporated at 240 V and 975 μF with 100 nM of either SHP-1-specific or scrambled siRNA (Abgene, Surrey, UK) and cultured for up to 48 h. A total volume of 1 × 106 cells were examined by intracellular flow cytometry (as described above), and the remanants were extracted for total RNA using the RNeasy minikit (Qiagen Ltd, Crawley, UK) and converted into cDNA using the high-capacity cDNA archive kit (Applied Biosystems, Warrington, UK). cDNA was analysed by RT-PCR with SHP1-specific primers35 and cyclophilin-specific primers (forward: 5′-AAAGCATACGGGTCCTGGCATC-′3; reverse 5′-CGAGTTGTCCACAGTCAGCAATG -3′) to confirm SHP-1 knockdown.

Pan-JAK inhibitor treatment

Cell lines and CD4+ tumour cell populations isolated from SS patients were re-suspended at 1 × 106 cells/ml in complete medium and treated with 0.5 μM of the pan-JAK inhibitor, pyridone 6 (P6) (Merck, Laufelfingen, Switzerland) or a vehicle control (dimethyl sulfoxide) for 120 min.

Detection of apoptosis

Commitment to apoptosis was measured using the Annexin V–PE apoptosis detection kit I (BD Biosciences) and intracellular staining with an antibody against caspase-3 (1/100, Santa Cruz Biotechnology, Heidelberg, Germany). Both assays were quantified using flow cytometry with 10 000 events acquired on a FACSAriaII (BD Biosciences).

Real-time quantitative PCR

cDNA was generated from CD4+ tumour cell populations isolated from SS patients as described above. Real-time PCR was performed on the ABI prism 7000 sequence detection system (Applied Biosystems) using the following optimised TaqMan probe/primer sets: Hs00236329_m1–Bcl-XL, Hs00172036_m1–Mcl-1, Hs00153353_m1–Survivin, Hs00355782_m1–p21, Hs01047580_m1–STAT3, Hs00197982_m1–Bim and Hs99999904_m1–cyclophilin A as an endogenous control. Each sample was analysed in triplicate for both target gene and endogenous control. The ΔΔCt method was used to determine the fold-change by comparison with the relevant untreated sample.

Mutational studies

DNA from 19 SS patients and 8 healthy controls were amplified. For the regions containing V658 (JAK1) or V617 (JAK2), the following JAK1- and JAK2-specific primer pairs were used (JAK1 forward: 5′-CTGGCCTGAGACATTCCTATG-3′; JAK1 reverse: 5′-CCCCTTTGAAAGAGAACACACT-3′) and (JAK2 forward: 5′-CAAGCATTTGGTTTTAAATTATGGAGTATGT-3′; JAK2 reverse: 5′-TAAATTATAGTTTACACTGACACCTAG-3′). PCR products were labelled using α-33PdCTP as previously described.36 Denatured PCR products were analysed by single-stranded conformational polymorphism analysis using 6% polyacrylamide gels with and without 5% glycerol. A negative control (deionised water) was performed for each primer pair.

Statistics

Analysis of flow cytometry data comparing JAK–STAT3, SHP-1 expression levels between SS patients and healthy control samples and the apoptosis data was performed using two-tailed t-test. Paired t-tests with P<0.05, indicating statistical significance, were used to analyse SHP-1 siRNA-treated cells and the P6-treated cells.

Results

Constitutive activation of the JAK–STAT3 pathway in primary Sézary cells

The activation status of the JAK–STAT3 pathway was assessed by immunoblotting using whole-cell lysates from enriched tumour cell populations from six SS patients, CD4+ T-cells from two healthy controls and the CTCL cell line MyLa (Figure 1a). All samples expressed STAT3, JAK1 and JAK2, but in contrast to healthy control CD4+ T-cells, all six SS patients and the CTCL cell line showed strong expression of phosphorylated (pSTAT3, pJAK1 and pJAK2) components, consistent with constitutive JAK–STAT3 activation. Furthermore, the observed constitutive STAT3 activation was found to be persistent, as pSTAT3 expression was retained in enriched CD4+ tumour cell populations maintained in vitro for a 5-day period in the absence of exogenous cytokine stimulation (Supplementary Figure 1).

Figure 1
figure1

Constitutive activation of the JAK–STAT3 pathway in primary Sézary cells. (a) Immunoblot analysis of whole-cell lysates derived from enriched tumour cell populations from six SS patients (P1–P6), CD4+ T-cell from two healthy control samples and the MyLa cell line. Blots are probed with the indicated antibodies against components of the JAK–STAT3 pathway and re-probed with β-actin as loading control. Quantitative flow cytometric analysis of CD4+-enriched tumour samples from 18 SS patients and CD4+ T-cells from 6 healthy control samples of (b) pSTAT3 (c) pJAK1 (d) pJAK2 (e) SHP-1. Data are shown as delta mean fluorescent intensity calculated as described in Patients and methods.

Previous studies in CTCL cell lines have suggested that loss or reduced expression of the protein tyrosine phosphatase SHP-1 mediates aberrant activation of the JAK–STAT3 pathway.28, 30 This led us to examine the SHP-1 status in Sézary tumour cell populations. No difference in SHP-1 expression between patients and healthy controls relative to the β-actin loading control (Figure 1a) was apparent.

To validate these data, we extended the study to include 18 SS patients and 6 healthy controls, and quantified expression accurately using intracellular immunofluorescent staining and flow cytometry. JAK–STAT3 activation was confirmed in all 18 patients (Figures 1b–d), which was significantly increased (pSTAT3 P<0.001, pJAK1 P<0.001 and pJAK2 P<0.0001) compared with healthy control samples. In contrast, no significant difference in total unphosphorylated STAT3, JAK1 or JAK2 expression between patients and healthy controls was observed (data not shown). Furthermore, consistent with the immunoblotting data, no loss or significant difference in SHP-1 expression was observed in patients compared with healthy controls (Figure 1e).

STAT3 activation is independent of SHP-1 in primary Sézary cells

Methylation of the SHP-1 promoter has previously been reported in CTCL cell lines,28, 30 therefore, we compared the methylation status of the SHP-1 promoter in ex vivo-enriched Sézary tumour cells, cell lines and CD4+ lymphocytes from 11 healthy donors. Previously published34 MSP and unmethylation specific (USP) PCR primers were used to amplify bisulphite-converted DNA. Methylation was detected in the CTCL cell lines, Hut78 and SeAx, which correlates with lack of SHP-1 mRNA and protein expression (data not shown) and is consistent with the published findings. In contrast, a weak methylation amplicon was detected in only 1/47 SS patients and 1/11 healthy control samples. Representative MSP/USP data from eight SS patients, eight healthy controls and the CTCL cell lines are shown in Figure 2a.

Figure 2
figure2

STAT3 activation is independent of SHP-1 in CTCL cells. (a) Representative agarose gel of SHP-1 MSP on eight Sézary tumour cell samples, eight healthy controls and four cell lines (b) Pyrosequencing across the 11 CpG dinucleotides in the SHP-1 CpG island in nine Sézary samples (SS), seven healthy controls (H) and six cell lines (CL). Convert is the conversion control, which indicates successful bisulphite conversion if <5% (c) RT-PCR using specific primer pairs for SHP-1 and cyclophilin using cDNA from MyLa cells, which were untreated, electroporated alone, treated with scrambled or with SHP-1 specific siRNA for 24 or 48 h. (d, e) Quantitative flow cytometric analysis of electroporated MyLa cells expressed as delta mean fluorescent intensity, calculated as described in Patients and methods after 24 or 48 h in culture for (d) SHP-1 and (e) pSTAT3.

MSP/USP does not assess the methylation status of all CpG dinucleotides in the CpG island. Therefore, pyrosequencing was used to quantify the methylation status of each CpG dinucleotide in the SHP-1 CpG island in a subset of nine Sézary patient samples, seven healthy control samples and six cell lines. Consistent with SHP-1 expression status (data not shown), MyLa and Jurkat were found to have very low levels of methylation across the SHP-1 CpG island, whereas high levels of methylation were detected in HuT78, SeAx, primary keratinocytes and HEK293 cells. Pyrosequencing analysis also demonstrated very low levels of methylation in both patient tumour cell populations and CD4+ T-cells from healthy controls (Figure 2b), confirming the expression and the MSP data.

These data suggest that activation of JAK–STAT3 pathway in Sézary cells is independent of SHP-1. This was confirmed using siRNA-mediated SHP-1 knockdown in MyLa cells and was validated using SHP-1-specific RT-PCR, intracellular staining and flow cytometry (Figures 2c and d). A significant reduction (P=0.0001) in SHP-1 expression was demonstrated in siRNA-transfected cells and importantly no effect on STAT3 phosphorylation was observed (Figure 2e). These data support our ex vivo finding that in Sézary cells, activation of STAT3 is not mediated by loss of SHP-1 expression.

JAK inhibition downregulates STAT3 activation and induces apoptosis in primary Sézary cells

Enriched tumour cell populations from 10 of the 18 previously assessed patients were treated with the pan-JAK inhibitor P6 for 120 min. P6 was selected, as previous reports suggest it is a more specific and effective inhibitor of JAK–STAT3 activity compared with AG490 in cell lines.37, 38 Intracellular staining and flow cytometry showed a significant decrease in activation of pJAK1 (Figure 3a, P=0.005), pJAK2 (Figure 3b, P=0.002) and consequent decrease in activation of pSTAT3 (Figure 3c, P=0.001) in all samples treated with the pan-JAK inhibitor. The effect of JAK inhibition on the commitment to apoptosis was assessed in five of these patients and two healthy controls using quantitative flow cytometry to detect cleaved caspase-3 and Annexin V (Figures 4a and b). Apoptosis was strongly induced in tumour cell from all five patients, whereas no induction of apoptosis following P6 treatment was observed in healthy control samples. A concomitant decrease in mRNA expression of the pSTAT3 target and anti-apoptotic genes Bcl-XL, Mcl-1 and Survivin was also evident in the tumour cell populations. In contrast, expression of p21 and the proapoptotic gene BIM were both induced in response to P6 treatment as was STAT3 itself (Figure 4c).

Figure 3
figure3

JAK inhibition downregulates STAT3 activation in primary Sézary cells. Quantitative flow cytometric analysis was performed on P6-treated enriched tumour samples from 10 SS patients to determine the effect of P6 on the expression of (a) pJAK1 (b) pJAK2 (c) pSTAT3. Data are expressed as delta mean fluorescent intensity, calculated as described in Patients and methods in untreated (0 min) and P6-treated (120 min) cells.

Figure 4
figure4

Downregulation of STAT3 activation by pan-JAK inhibition induces apoptosis. Apoptosis analysis was performed on 5 from the 10 P6-treated enriched tumour samples (Figure 3) to determine the downstream effects of P6 on primary (P) tumour and healthy (H) samples (a) Caspase-3 apoptosis assay (b) Annexin V apoptosis assay (c) qPCR of pSTAT3 target genes Bcl-XL, Mcl-1 and Survivin, in addition to p21, STAT3 and BIM. The graph denotes the fold change of mRNA expression of P6-treated Sézary samples compared with the untreated Sézary samples.

JAK1 V658F and JAK2 V617F mutations are not present in primary Sézary cells

To establish whether activating mutations of JAK1 or JAK2 are responsible for constitutive activation of the JAK–STAT3 pathway in Sézary cells, we performed single-stranded conformational polymorphism analysis of the region containing the common V658 (JAK1) and V617 (JAK2) mutations, which are frequently mutated in other malignancies with constitutive activation of the JAK–STAT3 pathway.39 No band shifts were observed in DNA samples extracted from the enriched tumour cell populations of 19 Sézary patients (data not shown). The CTCL cell lines HuT78, SeAx and MyLa, and the leukaemic cell line Jurkat also did not harbour either mutation.

Discussion

Aberrant activation of STAT3 has been widely reported in a variety of malignancies (reviewed in Al Zaid Siddiquee and Turkson9 and Yu et al.40). This study of ex vivo-enriched tumour cell populations from a series of SS patients demonstrate that JAK–STAT3 activation is a consistent feature of SS, providing compelling evidence that aberrant STAT3 expression is a significant pathogenetic abnormality in this malignancy. Furthermore, we have shown that in contrast to that reported in vitro studies using CTCL-derived cell lines, persistent JAK–STAT3 activation in primary Sézary cell populations is independent of SHP-1. Moreover, treatment of ex vivo tumour cells from SS patients with the JAK inhibitor P6 demonstrates that JAK phosphorylation is essential for constitutive activation of STAT3 in SS.

Our data supports previous studies demonstrating constitutive expression of STAT3 in CTCL cell lines,10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and confirm findings in a recent report that showed constitutive and sustained ex vivo expression of pSTAT3 over 24 h in PBMCs from a group of four SS/MF patients.18 In contrast, an earlier study documented strong expression of pSTAT3 in only 2 out of 14 SS patients.10 However, this study examined total PBMCs rather than enriched tumour cell populations and some patients had low proportions of Sézary cells (1–91%). Therefore, the apparent contrasts to our data may be explained by a low tumour burden in the PBMCs analysed. It has also been suggested that STAT3 activation in SS is not constitutive, but is dependent on exogenous cytokine stimulation, as expression of pSTAT3 was significantly reduced after overnight culture of Sézary cells from three patients.17 However, another report18 clearly demonstrated persistent expression of pSTAT3 in vitro in the absence of cytokine stimulation, which is consistent with our own observations and supports the conclusion that STAT3 is constitutively activated in SS patients and is independent of exogenous cytokine stimulation.

The underlying mechanism responsible for aberrant STAT3 activation in CTCL has proved elusive, although studies have been mostly restricted to cell lines. The protein tyrosine phosphatase SHP-1 has been proposed as a candidate for aberrant STAT3 activation in CTCL due to its role as a negative regulator of JAK1 and JAK2.41, 42 Previous studies have shown that SHP-1 protein expression is absent in some CTCL cell lines,28 and immunohistochemical analysis has demonstrated reduced SHP-1 expression in lesional tumour biopsy samples from MF patients with advanced stage disease.30 Furthermore, studies of anaplastic large cell lymphoma cell lines revealed STAT3 and DNA methyltransferase-mediated epigenetic silencing of SHP-1.29 However, we found no evidence of SHP-1 downregulation or promoter methylation in primary SS samples when compared with healthy PBMCs, despite using pyrosequencing, which has sufficient sensitivity to detect hypermethylation against a background of normal cells.33 It has been previously recognised that the immortalisation of cell lines can itself cause aberrant DNA methylation as a result of selective pressures present during the growth of these cells in culture.43 Given the lack of changes in DNA methylation or protein expression of SHP-1 in primary cells and the absence of an effect of SHP-1 knockdown in MyLa cells, our results suggest that SHP-1 does not contribute to persistent activation of the JAK–STAT3 pathway in SS. Our data, therefore, suggests that in SS and MF, alternative mechanisms may be responsible for aberrant STAT3 activation. This is consistent with studies of other malignancies40 that have demonstrated multiple mechanisms can lead to aberrant STAT3 activation and also supports recent findings,2 suggesting that SS and MF may have distinct clinicopathogenetic origins.

The SOCS family of negative STAT regulators is also unlikely to mediate aberrant STAT3 activation in SS, as it has been reported that SOCS3 is expressed at high levels in CTCL cell lines and SS patients.19 Moreover, the use of a dominant-negative STAT3 in CTCL cell lines was shown to downregulate constitutive expression of SOCS3, demonstrating that SOCS3 expression is a consequence rather than a mediator of aberrant STAT3 activation. Furthermore, no SOCS3-associated mutations have been identified in CTCL.44

We also detected consistent expression of activated JAK1 and JAK2 in primary SS samples and demonstrate that downregulation of JAK1 and JAK2 expression using the P6 pan-JAK inhibitor results in significant downregulation of STAT3 expression in primary SS cells. Previous studies of a SS cell line and an MF patient sample ex vivo treated with a pan-JAK inhibitor AG490 also showed downregulation of activated STAT3.13 Although activation of JAK3 in CTCL is well documented, no previous studies of JAK1 and JAK2 have been published.25, 45 Although further experiments are required to elucidate the specific contribution and role of individual JAKs, our findings indicate that aberrant activation of STAT3 is mediated via JAK signalling in SS.

In the last decade, several JAK mutations have been identified in acute lymphoblastic leukaemia and myeloproliferative diseases.46, 47 A recent report identified a JAK3 A572V mutation in 1 of 30 MF patients48 studied. We have found no evidence for the most common activating mutations, JAK1 V658F and JAK2 V617, in primary SS samples. This is perhaps not surprising as the literature suggests that JAK mutations, including JAK2 V617, are uncommon in non-Hodgkin's lymphoma.49 However, other rare activating JAK mutations have been described in various malignancies,47, 50 and therefore, a comprehensive analysis for JAK mutations in SS patients is required to fully exclude other activating mutations.

Although an unidentified activating mutation of JAK1 and/or JAK2 might explain the aberrant activation of STAT3 in primary SS, aberrant signalling further upstream of JAK1 and JAK2 should also be considered. JAKs are activated by a plethora of cytokines and growth factors, as well as by signalling through the T-cell receptor. Studies of CTCL cell lines have shown dysregulation of T-cell activation including constitutive IL-2Rα expression,13 spontaneous IL-5 production,14 enhanced secretion of IL-10(ref. 51) and aberrant expression of IL-17.52 In classical Hodgkin's lymphoma, HSP90 is essential for JAK/STAT signalling, as it activates JAK1 and JAK2.53 The Ephrin family of tyrosine kinase receptors have also been shown to activate the JAK–STAT3 pathway.54 Overexpression of one Ephrin family member, EphA4, has been reported in several human cancers, including SS,55 and therefore it represents a potential mechanism for aberrant JAK–STAT3 activation.

Persistent STAT3 signalling is a major feature of many malignancies and it is well recognised that downstream targets of pSTAT3 include a large number of genes that contribute to apoptotic resistance, differentiation and proliferation.40 Our ex vivo findings of the induction of apoptosis following inhibition of STAT3 activation in Sézary cells, supports the hypothesis that pSTAT3 has a pivotal role in mediating the known resistance to apoptosis. These data confirm several in vitro studies using CTCL cell lines, which have induced apoptosis via STAT3 knockdown,11, 12 or STAT3 inhibition with different agents including Curcumin,18 Cucurbitacin,17 Panobinostat15 and Avicin D.16 Our data suggests that downregulation of the pSTAT3 anti-apoptotic genes BCL-2, Survivin and Bcl-XL contribute to the observed commitment to apoptosis. Furthermore, it is now recognised that unphosphorylated monomeric STATs, including STAT3, regulate gene transcription and have distinct target genes to their phosphorylated isoforms.6, 7 Our findings support these observations as P6 inhibition of JAK–STAT3 phosphorylation induced STAT3 mRNA expression and upregulated expression of BIM, a known target of unphosphorylated monomeric STAT3(refs 6,7) and a pro-apoptotic member of the BCL-2 protein family (reviewed in ref. 56).

In conclusion, by studying ex vivo-enriched tumour cell populations from a large cohort of SS patients, we have established that aberrant expression of pSTAT3 is a consistent feature of this malignancy and is likely to be a key pathogenetic abnormality and thus a potential therapeutic target. We have also shown that aberrant STAT3 expression in SS patients is primarily mediated via activation of JAKs. Specifically, we have found no evidence that downregulation of SHP-1, SHP-1 promoter methylation or common activating mutations of JAK1/JAK2 is involved in STAT3 activation. Further studies to exclude rare activating mutations of JAKs and upstream signalling abnormalities in SS are now required.

References

  1. 1

    Agar NS, Wedgeworth E, Crichton S, Mitchell TJ, Cox M, Ferreira S et al. Survival outcomes and prognostic factors in mycosis fungoides/Sezary syndrome: validation of the revised International Society for Cutaneous Lymphomas/European Organisation for Research and Treatment of Cancer staging proposal. J Clin Oncol 2010; 28: 4730–4739.

    Article  Google Scholar 

  2. 2

    Campbell JJ, Clark RA, Watanabe R, Kupper TS . Sezary syndrome and mycosis fungoides arise from distinct T-cell subsets: a biologic rationale for their distinct clinical behaviors. Blood 2010; 116: 767–771.

    CAS  Article  Google Scholar 

  3. 3

    Contassot E, Kerl K, Roques S, Shane R, Gaide O, Dupuis M et al. Resistance to FasL and tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis in Sezary syndrome T-cells associated with impaired death receptor and FLICE-inhibitory protein expression. Blood 2008; 111: 4780–4787.

    CAS  Article  Google Scholar 

  4. 4

    Levy DE, Darnell Jr JE . Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 2002; 3: 651–662.

    CAS  Article  Google Scholar 

  5. 5

    Lim CP, Cao X . Structure, function, and regulation of STAT proteins. Mol Biosyst 2006; 2: 536–550.

    CAS  Article  Google Scholar 

  6. 6

    Yang J, Liao X, Agarwal MK, Barnes L, Auron PE, Stark GR . Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NFkappaB. Genes Dev 2007; 21: 1396–1408.

    CAS  Article  Google Scholar 

  7. 7

    Yang J, Stark GR . Roles of unphosphorylated STATs in signaling. Cell Res 2008; 18: 443–451.

    CAS  Article  Google Scholar 

  8. 8

    Bromberg JF, Horvath CM, Besser D, Lathem WW, Darnell Jr JE . Stat3 activation is required for cellular transformation by v-src. Mol Cell Biol 1998; 18: 2553–2558.

    CAS  Article  Google Scholar 

  9. 9

    Al Zaid Siddiquee K, Turkson J . STAT3 as a target for inducing apoptosis in solid and hematological tumors. Cell Res 2008; 18: 254–267.

    CAS  Article  Google Scholar 

  10. 10

    Zhang Q, Nowak I, Vonderheid EC, Rook AH, Kadin ME, Nowell PC et al. Activation of Jak/STAT proteins involved in signal transduction pathway mediated by receptor for interleukin 2 in malignant T lymphocytes derived from cutaneous anaplastic large T-cell lymphoma and Sezary syndrome. Proc Natl Acad Sci USA 1996; 93: 9148–9153.

    CAS  Article  Google Scholar 

  11. 11

    Sommer VH, Clemmensen OJ, Nielsen O, Wasik M, Lovato P, Brender C et al. In vivo activation of STAT3 in cutaneous T-cell lymphoma. Evidence for an antiapoptotic function of STAT3. Leukemia 2004; 18: 1288–1295.

    CAS  Article  Google Scholar 

  12. 12

    Verma NK, Davies AM, Long A, Kelleher D, Volkov Y . STAT3 knockdown by siRNA induces apoptosis in human cutaneous T-cell lymphoma line Hut78 via downregulation of Bcl-xL. Cell Mol Biol Lett 2010; 15: 342–355.

    CAS  Article  Google Scholar 

  13. 13

    Eriksen KW, Kaltoft K, Mikkelsen G, Nielsen M, Zhang Q, Geisler C et al. Constitutive STAT3-activation in Sezary syndrome: tyrphostin AG490 inhibits STAT3-activation, interleukin-2 receptor expression and growth of leukemic Sezary cells. Leukemia 2001; 15: 787–793.

    CAS  Article  Google Scholar 

  14. 14

    Nielsen M, Nissen MH, Gerwien J, Zocca MB, Rasmussen HM, Nakajima K et al. Spontaneous interleukin-5 production in cutaneous T-cell lymphoma lines is mediated by constitutively activated Stat3. Blood 2002; 99: 973–977.

    CAS  Article  Google Scholar 

  15. 15

    Shao W, Growney JD, Feng Y, O'Connor G, Pu M, Zhu W et al. Activity of deacetylase inhibitor panobinostat (LBH589) in cutaneous T-cell lymphoma models: Defining molecular mechanisms of resistance. Int J Cancer 2010; 127: 2199–2208.

    CAS  Article  Google Scholar 

  16. 16

    Zhang C, Li B, Gaikwad AS, Haridas V, Xu Z, Gutterman JU et al. Avicin D selectively induces apoptosis and downregulates p-STAT-3, bcl-2, and survivin in cutaneous T-cell lymphoma cells. J Invest Dermatol 2008; 128: 2728–2735.

    CAS  Article  Google Scholar 

  17. 17

    van Kester MS, Out-Luiting JJ, von dem Borne PA, Willemze R, Tensen CP, Vermeer MH . Cucurbitacin I inhibits Stat3 and induces apoptosis in Sezary cells. J Invest Dermatol 2008; 128: 1691–1695.

    CAS  Article  Google Scholar 

  18. 18

    Zhang C, Li B, Zhang X, Hazarika P, Aggarwal BB, Duvic M . Curcumin selectively induces apoptosis in cutaneous T-cell lymphoma cell lines and patients′ PBMCs: potential role for STAT-3 and NF-kappaB signaling. J Invest Dermatol 2010; 130: 2110–2119.

    CAS  Article  Google Scholar 

  19. 19

    Brender C, Nielsen M, Kaltoft K, Mikkelsen G, Zhang Q, Wasik M et al. STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma. Blood 2001; 97: 1056–1062.

    CAS  Article  Google Scholar 

  20. 20

    Yu H, Jove R . The STATs of cancer--new molecular targets come of age. Nat Rev Cancer 2004; 4: 97–105.

    CAS  Article  Google Scholar 

  21. 21

    Levine RL, Gilliland DG . JAK-2 mutations and their relevance to myeloproliferative disease. Curr Opin Hematol 2007; 14: 43–47.

    CAS  Article  Google Scholar 

  22. 22

    Chiarle R, Voena C, Ambrogio C, Piva R, Inghirami G . The anaplastic lymphoma kinase in the pathogenesis of cancer. Nat Rev Cancer 2008; 8: 11–23.

    CAS  Article  Google Scholar 

  23. 23

    Hagemeijer A, Graux C . ABL1 rearrangements in T-cell acute lymphoblastic leukemia. Genes Chromosomes Cancer 2010; 49: 299–308.

    CAS  Google Scholar 

  24. 24

    Kameda T, Shide K, Shimoda HK, Hidaka T, Kubuki Y, Katayose K et al. Absence of gain-of-function JAK1 and JAK3 mutations in adult T cell leukemia/lymphoma. Int J Hematol 2010; 92: 320–325.

    CAS  Article  Google Scholar 

  25. 25

    Cornejo MG, Kharas MG, Werneck MB, Le Bras S, Moore SA, Ball B et al. Constitutive JAK3 activation induces lymphoproliferative syndromes in murine bone marrow transplantation models. Blood 2009; 113: 2746–2754.

    CAS  Article  Google Scholar 

  26. 26

    Chim CS, Fung TK, Cheung WC, Liang R, Kwong YL . SOCS1 and SHP1 hypermethylation in multiple myeloma: implications for epigenetic activation of the Jak/STAT pathway. Blood 2004; 103: 4630–4635.

    CAS  Article  Google Scholar 

  27. 27

    Sato H, Oka T, Shinnou Y, Kondo T, Washio K, Takano M et al. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma. Am J Pathol 2010; 176: 402–415.

    CAS  Article  Google Scholar 

  28. 28

    Zhang Q, Raghunath PN, Vonderheid E, Odum N, Wasik MA . Lack of phosphotyrosine phosphatase SHP-1 expression in malignant T-cell lymphoma cells results from methylation of the SHP-1 promoter. Am J Pathol 2000; 157: 1137–1146.

    CAS  Article  Google Scholar 

  29. 29

    Zhang Q, Wang HY, Marzec M, Raghunath PN, Nagasawa T, Wasik MA . STAT3- and DNA methyltransferase 1-mediated epigenetic silencing of SHP-1 tyrosine phosphatase tumor suppressor gene in malignant T lymphocytes. Proc Natl Acad Sci USA 2005; 102: 6948–6953.

    CAS  Article  Google Scholar 

  30. 30

    Witkiewicz A, Raghunath P, Wasik A, Junkins-Hopkins JM, Jones D, Zhang Q et al. Loss of SHP-1 tyrosine phosphatase expression correlates with the advanced stages of cutaneous T-cell lymphoma. Hum Pathol 2007; 38: 462–467.

    CAS  Article  Google Scholar 

  31. 31

    van Dongen JJ, Langerak AW, Bruggemann M, Evans PA, Hummel M, Lavender FL et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia 2003; 17: 2257–2317.

    CAS  Article  Google Scholar 

  32. 32

    Tiemessen MM, Mitchell TJ, Hendry L, Whittaker SJ, Taams LS, John S . Lack of suppressive CD4+CD25+FOXP3+ T cells in advanced stages of primary cutaneous T-cell lymphoma. J Invest Dermatol 2006; 126: 2217–2223.

    CAS  Article  Google Scholar 

  33. 33

    Jones CL, Wain EM, Chu CC, Tosi I, Foster R, McKenzie RC et al. Downregulation of Fas gene expression in Sezary syndrome is associated with promoter hypermethylation. J Invest Dermatol 2010; 130: 1116–1125.

    CAS  Article  Google Scholar 

  34. 34

    Oka T, Ouchida M, Koyama M, Ogama Y, Takada S, Nakatani Y et al. Gene silencing of the tyrosine phosphatase SHP1 gene by aberrant methylation in leukemias/lymphomas. Cancer Res 2002; 62: 6390–6394.

    CAS  Google Scholar 

  35. 35

    Leon F, Cespon C, Franco A, Lombardia M, Roldan E, Escribano L et al. SHP-1 expression in peripheral T cells from patients with Sezary syndrome and in the T cell line HUT-78: implications in JAK3-mediated signaling. Leukemia 2002; 16: 1470–1477.

    CAS  Article  Google Scholar 

  36. 36

    Scarisbrick JJ, Woolford AJ, Russell-Jones R, Whittaker SJ . Loss of heterozygosity on 10q and microsatellite instability in advanced stages of primary cutaneous T-cell lymphoma and possible association with homozygous deletion of PTEN. Blood 2000; 95: 2937–2942.

    CAS  Google Scholar 

  37. 37

    Pedranzini L, Dechow T, Berishaj M, Comenzo R, Zhou P, Azare J et al. Pyridone 6, a pan-Janus-activated kinase inhibitor, induces growth inhibition of multiple myeloma cells. Cancer Res 2006; 66: 9714–9721.

    CAS  Article  Google Scholar 

  38. 38

    Berishaj M, Gao SP, Ahmed S, Leslie K, Al-Ahmadie H, Gerald WL et al. Stat3 is tyrosine-phosphorylated through the interleukin-6/glycoprotein 130/Janus kinase pathway in breast cancer. Breast Cancer Res 2007; 9: R32.

    Article  Google Scholar 

  39. 39

    Ghoreschi K, Laurence A, O′Shea JJ . Janus kinases in immune cell signaling. Immunol Rev 2009; 228: 273–287.

    CAS  Article  Google Scholar 

  40. 40

    Yu H, Pardoll D, Jove R . STATs in cancer inflammation and immunity: a leading role for STAT3. Nat Rev Cancer 2009; 9: 798–809.

    CAS  Article  Google Scholar 

  41. 41

    Klingmuller U, Lorenz U, Cantley LC, Neel BG, Lodish HF . Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals. Cell 1995; 80: 729–738.

    CAS  Article  Google Scholar 

  42. 42

    David M, Chen HE, Goelz S, Larner AC, Neel BG . Differential regulation of the alpha/beta interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol Cell Biol 1995; 15: 7050–7058.

    CAS  Article  Google Scholar 

  43. 43

    Jones PA, Wolkowicz MJ, Rideout III WM, Gonzales FA, Marziasz CM, Coetzee GA et al. De novo methylation of the MyoD1 CpG island during the establishment of immortal cell lines. Proc Natl Acad Sci USA 1990; 87: 6117–6121.

    CAS  Article  Google Scholar 

  44. 44

    Brender C, Lovato P, Sommer VH, Woetmann A, Mathiesen AM, Geisler C et al. Constitutive SOCS-3 expression protects T-cell lymphoma against growth inhibition by IFNalpha. Leukemia 2005; 19: 209–213.

    CAS  Article  Google Scholar 

  45. 45

    Krejsgaard T, Vetter-Kauczok CS, Woetmann A, Lovato P, Labuda T, Eriksen KW et al. Jak3- and JNK-dependent vascular endothelial growth factor expression in cutaneous T-cell lymphoma. Leukemia 2006; 20: 1759–1766.

    CAS  Article  Google Scholar 

  46. 46

    Flex E, Petrangeli V, Stella L, Chiaretti S, Hornakova T, Knoops L et al. Somatically acquired JAK1 mutations in adult acute lymphoblastic leukemia. J Exp Med 2008; 205: 751–758.

    CAS  Article  Google Scholar 

  47. 47

    Mullighan CG, Zhang J, Harvey RC, Collins-Underwood JR, Schulman BA, Phillips LA et al. JAK mutations in high-risk childhood acute lymphoblastic leukemia. Proc Natl Acad Sci USA 2009; 106: 9414–9418.

    CAS  Article  Google Scholar 

  48. 48

    Cornejo MG, Boggon TJ, Mercher T . JAK3: a two-faced player in hematological disorders. Int J Biochem Cell Biol 2009; 41: 2376–2379.

    CAS  Article  Google Scholar 

  49. 49

    Lee JW, Soung YH, Kim SY, Nam SW, Park WS, Lee JY et al. JAK2 V617F mutation is uncommon in non-Hodgkin lymphomas. Leuk Lymphoma 2006; 47: 313–314.

    CAS  Article  Google Scholar 

  50. 50

    Constantinescu SN, Girardot M, Pecquet C . Mining for JAK-STAT mutations in cancer. Trends Biochem Sci 2008; 33: 122–131.

    CAS  Article  Google Scholar 

  51. 51

    Berger CL, Tigelaar R, Cohen J, Mariwalla K, Trinh J, Wang N et al. Cutaneous T-cell lymphoma: malignant proliferation of T-regulatory cells. Blood 2005; 105: 1640–1647.

    CAS  Article  Google Scholar 

  52. 52

    Chong BF, Wilson AJ, Gibson HM, Hafner MS, Luo Y, Hedgcock CJ et al. Immune function abnormalities in peripheral blood mononuclear cell cytokine expression differentiates stages of cutaneous T-cell lymphoma/mycosis fungoides. Clin Cancer Res 2008; 14: 646–653.

    CAS  Article  Google Scholar 

  53. 53

    Schoof N, von Bonin F, Trumper L, Kube D . HSP90 is essential for Jak-STAT signaling in classical Hodgkin lymphoma cells. Cell Commun Signal 2009; 7: 17.

    Article  Google Scholar 

  54. 54

    Lai KO, Chen Y, Po HM, Lok KC, Gong K, Ip NY . Identification of the Jak/Stat proteins as novel downstream targets of EphA4 signaling in muscle: implications in the regulation of acetylcholinesterase expression. J Biol Chem 2004; 279: 13383–13392.

    CAS  Article  Google Scholar 

  55. 55

    van Doorn R, Dijkman R, Vermeer MH, Out-Luiting JJ, van der Raaij-Helmer EM, Willemze R et al. Aberrant expression of the tyrosine kinase receptor EphA4 and the transcription factor twist in Sezary syndrome identified by gene expression analysis. Cancer Res 2004; 64: 5578–5586.

    CAS  Article  Google Scholar 

  56. 56

    Youle RJ, Strasser A . The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol 2008; 9: 47–59.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We thank Ms Silvia Ferreira for providing expert technical assistance. This work was supported by grants from the British Skin Foundation (RCTM), Guy's and St Thomas' Charitable Foundation and includes support from the ‘Skin Matters’ fund (CLJ). Support from Guy's & St Thomas' NHS Foundation (TJM) is gratefully acknowledged. We acknowledge the financial support from the Department of Health via the National Institute for Health Research comprehensive Biomedical Research Centre ward to Guy's and St Thomas' NHS Foundation Trust in partnership with King's College London and King's College Hospital NHS Foundation Trust.

Author information

Affiliations

Authors

Corresponding author

Correspondence to T J Mitchell.

Ethics declarations

Competing interests

The authors declare no conflict of interest.

Additional information

Supplementary Information accompanies the paper on the Leukemia website

Supplementary information

Rights and permissions

Reprints and Permissions

About this article

Cite this article

McKenzie, R., Jones, C., Tosi, I. et al. Constitutive activation of STAT3 in Sézary syndrome is independent of SHP-1. Leukemia 26, 323–331 (2012). https://doi.org/10.1038/leu.2011.198

Download citation

Keywords

  • Sézary syndrome
  • cutaneous T-cell lymphoma
  • STAT3
  • SHP-1
  • JAK

Further reading

Search

Quick links