Table 2 Primer sequences used for PCR amplification of GALC gene, and DHPLC oven temperatures

From: Six novel mutations detected in the GALC gene in 17 Japanese patients with Krabbe disease, and new genotype–phenotype correlation

Exon Forward primer (5′>3′) Reverse primer (5′>3′) Size (bp) Predicted temperature (°C) DHPLC oven temperature (°C)
1 GGAGTCATGTGACCCACACA CGCGTATCCCCGCAGCTT 242 56 55/56/57
2 GGTGTGCGTGAACACTGTAGA CTATGGTGAAATTCACCATCC 215 54.8 54/55/56
3 GGATGGTGAATTTCACCATAG TCACAGTCCATATGCTGAGGT 333 54.9 54/55/56
4 GGTCCTAGGAAGTACCATTCATG CACCAACACGATTCAGAATTTAA 190 56.4 55/58/61
5 GTTTTATTTTCAATAGCGCCAGC CCTCATGGCATAAAATGGTTAGTC 312 57 55/57/59
6 AATGGTATCGTAACGATAATCTG TTTCTGTGTTAGGAACCATAAGG 190 54.5 54/55/56
7 CTATTATCCAGAACGCTGATTTG GTAATCAAATGGGGAGAAGGC 335 54.4 53/55/56
8 GAAAACCTTGGAGAAGACTCGTA GGCTGGAAGAATAAGGAATTCC 354 53.2 54/56/58
9 CTCCAGGTTTTTAGACATTTAC CTGCTTTGTCTCTTAGAGAAGA 251 55.7 52/55/58
10 CAGACTCAAATTGATATACAGCT GGCATCTGTCTGTATGCTTAT 337 53.1 54/56/58
11 TTCTGTTAATCTTGGGCATTAAC CAGGGCCTCTGTCAATTCATA 317 54.4 52/54/56
12 CATTGGTACATTCTTGCTGGTACT GTCACCATCCACCAAGACAAA 413 54.5 53.5/54.5/56.5
13 ATTCCAAGGGCCTTGATATTG TTTGACAGCCACTCCATCATG 413 55.7 54/56/60
14 AATATCAGCAAGGAGAGCTTCTG GGAGGACCATTGAAAACTCTTC 339 56.7 54/56/58
15 GCATGTGCTGTGAAATGACATA CCCACAAATAACAAGTAGGTGCT 325 55.1 55.1/56.1/57.1
16 CAGATGCCACTCAAGAACCCC CCCCTCCTATTTTATAACAG 251 55.1 52/54/55
17 CCATACATGATCAAGAAACAGAC GAAACAAGAATTGGCTCTGAA 301 57.9 56.9/57.9/58.9