KIR2DL5 alleles mark certain combination of activating KIR genes

Abstract

Killer cell Ig-like receptors (KIR) control the immune response of NK cells and some T cells to infections and tumors. KIR genes evolve rapidly and are variable between individuals in their number, type and sequence. Here, we determined the nature of KIR2DL5 gene polymorphism in four ethnic groups using direct DNA sequencing method. Nine new sequences were discovered. Within the panel of 248 KIR2DL5-positive individuals, 14 KIR2DL5-sequences differing in coding regions were observed. They differed at only seven amino acid positions, and such limited polymorphism is consistent with its conserved nature throughout the hominoid lineage. Ethnic deviation was seen in the distribution of KIR2DL5A, KIR2DL5B and their alleles. African Americans had more KIR2DL5 alleles than other populations indicating that more polymorphisms are yet to be discovered in Africans. Linkage between KIR2DL5-alleles and certain activating-KIR genes were observed, but frequency of these linked clusters differed substantially between populations. Consequently, KIR2DL5 alleles can be used as markers to predict the activating-KIR gene content. Typing system distinguishing A*001 and B*002 alleles can serve as a powerful screening test to assess the content of most variable activating-KIR genes that have been implicated in human disease and in the outcome of hematopoietic stem cell transplantation.

Introduction

By interacting with specific HLA class I molecules, the killer cell immunoglobulin-like receptors (KIR) control the effector function of natural killer (NK) cells and subsets of T cells against infection and tumor transformation.1, 2 The KIR receptors can be grouped into three distinct lineages based on the configuration of the extracellular immunoglobulin (Ig)-like domains.3 The first lineage comprises two Ig domain-containing KIRs with D0-D2 configuration (KIR2DL4 and 2DL5), the second lineage comprises three Ig domain containing KIRs with D0-D1-D2 configuration (KIR3DL1-3 and 3DS1) and the third lineage comprises two Ig domain containing KIRs with D1-D2 configuration (KIR2DL1-3 and 2DS1-5). Lineage-1 has been conserved among rhesus monkeys, gorillas, chimpanzees and humans, whereas the other two lineages revealed extensive diversity within and between species.4 Despite clustering together into a discrete lineage with high structural homologies, the KIR2DL5 and 2DL4 differ substantially in their amino-acid sequences, genomic locations, population distributions, level of transcriptions, cell-surface expressions, ligand specificities and signaling functions.5, 6, 7, 8, 9

The KIR2DL4 gene is present on most KIR haplotypes and occurs at a frequency of 100% in most populations, whereas KIR2DL5 is variable among KIR haplotypes and thus differs considerably between populations in its frequency.10, 11, 12 Two copies of the KIR2DL5 genes have been characterized, KIR2DL5A and KIR2DL5B, that show 99.5–99.7% identity in their coding sequences.5 KIR2DL5A is located in the telomeric half the KIR gene complex whereas the KIR2DL5B is located in the centromeric half.10, 13 Haplotypes carrying both 2DL5A and B have been described, and thus individuals homozygous for these haplotypes may carry four copies of KIR2DL5 sequences.14 KIR2DL5 displays a variegated distribution on the surface of CD56dim NK cells, whereas the surface expression of KIR2DL4 appears to be restricted to the minority subset of KIRneg CD56bright NK cells.8, 15 Although KIR2DL4 has been implicated in both inhibitory and activating functions,6, 16, 17, 18 KIR2DL5 appears to be solely an inhibitory receptor.7

Multiple sequences for both KIR2DL5A and KIR2DL5B loci have been characterized from individuals of different ethnic origins.13 However, the nature of KIR2DL5 sequence polymorphism within distinct ethnic populations is not known. Here, we have developed a direct DNA sequencing method and characterized the KIR2DL5 gene polymorphism in 248 unrelated individuals carrying this gene from four distinct ethnic populations. Further, we determined the link between KIR2DL5 alleles and presence and absence of other KIR genes.

Results

Discovery of nine novel KIR2DL5 sequences

To determine the nature of KIR2DL5 gene polymorphism in four distinct ethnic populations, we developed a direct DNA-sequencing method (Figure 1, Table 1). We detected all known KIR2DL5 sequences in this study of 248 KIR2DL5-positive unrelated individuals with the exception of KIR2DL5B*003, B*007 and B*009. Furthermore, we discovered nine novel KIR2DL5 sequences in this study (Figure 2a and b). Four of the novel sequences (2DL5A*00102, *00103, *00104 and *00105) differed from one another by a single synonymous substitution located either in exon-3 (D0 domain) or exon-4 (D2 Domain), and their predicted amino-acid sequences were identical. Except for 2DL5A*00103 that differed by a single nucleotide at position -177, the three other new 2DL5A*001 variants were identical to 2DL5A*0010101 in the promoter and intron-1 regions (Figure 2b).

Figure 1
figure1

Schematic representation of the strategy used for sequencing the KIR2DL5 gene. The exon (dark boxes) and intron (lines connecting the dark boxes) organization of the KIR2DL5 gene is depicted at the top. The size of each exon and intron is provided in parenthesis; only three introns (1, 4 and 5) differ between KIR2DL5A and B. The complete KIR2DL5 gene was PCR amplified using a forward primer 2DL5PF1 (anneals at 5′UTR, 670 bp upstream of the start codon) and a reverse primer 2DL5C2R1 (anneals at 3′UTR, 262 bp downstream of the stop codon). The amplification yielded products of 9872 bp (2DL5A) or 9950 bp (2DL5B). The annealing location and direction of the sequencing primers is depicted by solid arrows at the bottom, and their sequences are listed in Table 1.

Table 1 Oligonucleotide primers used to analyze KIR2DL5 polymorphism
Figure 2
figure2

KIR2DL5 gene polymorphism. (a) Polymorphic nucleotides and codons of KIR2DL5 sequences. The predicted amino acid changes are marked in parentheses. (b) Polymorphic nucleotides of promoter and intron-1 regions of KIR2DL5 alleles. A dash denotes positional identity with 2DL5A*0010101 sequence. The new sequences characterized in this study are shown in bold type. Adenine substitution at position-97 mutates the acute myeloid leukemia gene 1 (AML1) site ‘tgtggt’ into ‘tgtagt’, which is implicated as the factor that stops the transcription of certain 2DL5B alleles.13 # Indicates a 58 bp (AAAAAATACATGAAAAGTCTTTCATGTTAGCACAGATTTTAGGCCATCTCGTGTTCGGA) insertion; @ indicates a 58 bp (TAAAAATACATGAAAAGTCTTTCATGTTAGCACAGATTTTACGCATCTCGTGTTCGGA) insertion; x indicates a 20 bp (CTGGGTGTGGAGATATGGGC) insertion. $ indicates a 117 bp (AGGTGGAGATATGGGCCTGGAGGTGGAGATATGGGCCTAGAGGTGGATATCTGGGCCTGGAGTGGACATATGGGCCTAGGATGGAGATATGGGCTTGGGGTGGAGATATGGGCCTGG) insertion. Asterisks (*) indicate the absence of these insertions. Periods (.) represent the sequence is not available. KIR2DL2A*0010101 is identical to 2DL5A*0010102 in promoter, intron-1 and exons 1–8 regions, but differed by two nucleotide substitutions in intron-6 (not shown).

The remaining five novel sequences belong to 2DL5B types. KIR2DL5B*00801 differs from *00802 by a single synonymous substitution at nucleotide position 582, and thus amino-acid sequences of these alleles are identical, and differ from their closest sequence 2DL5A*001 by a single amino-acid valine residue at position-16 in the leader sequence, which is conserved in all 2DL5B sequences (Figure 2a). KIR2DL5B*00801 also differs from *00802 at position 882 in the intron-1 region. Both of these alleles differ substantially from the corresponding regions of 2DL5A*001 (Figure 2b). The new allele 2DL5B*00602 differs from the known 2DL5B*00601 sequence by two synonymous substitutions located in exon-5 (stem) and exon-7 (cytoplasmic tail). However, within the promoter and intron-1 regions, the 2DL5B*00602 differs substantially from 2DL5B*00601 and displays the highest homology with the expressed allele 2DL5B*003 (Figure 2b). As seen in all 2DL5A sequences and 2DL5B*003, an acute myeloid leukemia gene 1 (AML1) site in the promoter region (also known as CBP, CBFα, PEBP2 or RUNX),19, 20 the factor that has been implicated for KIR2DL5 expression is intact in 2DL5B*00602 alleles, and therefore this allele is likely to be expressed on the cell surface. As the 2DL5B*00602 is a rare allele (identified in just one of the 248 KIR2DL5-positive individuals) and lymphocytes from this individual were not available, we could not confirm the cell surface expression of 2DL5B*00602.

The 2DL5B*011 differs from its closest sequence 2DL5B*00601 by a novel nonsynonymous substitution at amino-acid position 284 located in the cytoplasmic tail, and by a single nucleotide in the intron-1 region. The 2DL5B*010 differs from its closest sequence 2DL5B*002 by a nonsynonymous substitution at amino-acid position-1 located in the leader peptide, and by nine nucleotides in the promoter and intron-1 regions. Three samples carrying both the 2DL5A and B were found to carry more than two KIR2DL5 sequences, and potentially carrying some novel substitutions indicating the existence of additional new 2DL5 sequences (N5, N10 and N12). However, we were unable to separate 2DL5 sequences from these samples.

It is interesting to note that the amino-acid sequences of 2DL5A*001, 2DL5B*006, 2DL5B*008 and 2DL5B*011 are identical in the extracellular segment that comprise the D0-domain, D2-domain and stem region (Figure 2a). Similarly, 2DL5A*005, 2DL5B*002, 2DL5B*009 and 2DL5*010 are identical in their extracellular segments. KIR2DL5B*003 and 2DL5B*007 encode identical extracellular segments, and 2DL5B*004 encodes a unique extracellular segment. Therefore, all known KIR2DL5 sequences produce only four types of D0-D2-stem domains (termed ectotypes) that differ from one another by one or two amino-acid substitutions (Figure 2a).

Three distinct lineages of KIR2DL5 sequences

To assess the structural relationship between different KIR2DL5 sequences, we constructed a phylogenetic tree from a nucleotide sequence alignment of all KIR2DL5 alleles covering the regions of promoter, exons 1 to 8, and intron-1. The phylogenetic tree clustered KIR2DL5 sequences into three distinct lineages (Figure 3). Substantial sequence variations observed in the promoter and intron-1 regions potentially contributed to the split of these lineages. Trees constructed on these three distinct regions (promoter, intron-1, coding regions) are provided in Supplementary Figure 1a–c. One of the lineages comprises two 2DL5B sequences (2DL5B*003 and *00602), another lineage comprises the remainder of the 12 KIR2DL5B sequences, and the third lineage comprises all eight 2DL5A sequences. These three lineages also differ in frequency and in their capacity to be transcribed. The KIR2DL5B*003/00602 lineage occurred only in African Americans at low frequency. This lineage and the lineage comprising all KIR2DL5A sequences carry an AML1 motif in the promoter region, suggesting that these two lineages are expressed on the cell surface, whereas the other 2DL5B-lineage is non-expressed.

Figure 3
figure3

Unrooted neighbor-joining phylogenic tree of KIR2DL5 sequences. The tree was constructed by the DNA Maximum Likelihood method with molecular clock (DNAMLK), version 3.5c.21 The alignment used to construct this tree included sequences covering the region 670 bp upstream of the start codon, all exons and intron-1. The unique insertion of 117 bp in intron-1 region of KIR2DL5B*00601 was removed for this tree analysis. The new sequences characterized from this study are shown in bold type. The trees for individual regions (promoter, intron-1 and coding regions) are shown in the Supplementary Figure 2.

Differential distribution of KIR2DL5 alleles in populations

Only KIR2DL5A*001, A*005, B*002 and B*008 were detected in all four ethnic populations studied (Table 2). KIR2DL5B*003, 2DL5B*007 and 2DL5B*009 were not detected in this study. Eight sequences (A*00102, A*00104, A*00105, B*00802, B*004, B*00602, B*010 and B*011) were encountered just once, and the latter four were found only in African Americans. The highest number of 2DL5 alleles were detected in African Americans (two alleles of 2DL5A and seven alleles of 2DL5B), whereas the lowest number was detected in Asians (three of 2DL5A and two of 2DL5B). Caucasians and Asian Indians displayed seven alleles each with different allelic components (five of 2DL5A and two of 2DL5B in Caucasians; three of 2DL5A and four of 2DL5B in Asian Indians). The most common allele in Asian Indians, Asians and Caucasians was KIR2DL5A*00101 that occurs at frequencies of 59.4, 28.6 and 25.2% respectively, whereas it occurs only in 6.3% of African Americans. The most common allele in African Americans was 2DL5B*00601 occurring at a frequency of 18.8%. This allele was totally absent in Caucasians and Asians, but detected in two (2.1%) Asian Indians.

Table 2 Frequency of KIR2DL5 alleles in ethnic populations

Comparative analysis of KIR profiles published in the literature revealed that the frequency of KIR2DL5 differs substantially among ethnic populations (Figure 4a). This ethnic deviation is also seen in the distribution of KIR2DL5A and KIR2DL5B subtypes (Figure 4b). Although the African Americans and Asians carry similar frequencies of the KIR2DL5 gene (57%), the 2DL5B gene was seen most frequently in African Americans whereas 2DL5A was most common in Asians. In contrast, both the 2DL5A and 2DL5B loci were equally distributed in Caucasians and Asian Indians.

Figure 4
figure4

Ethnic diversity in the distribution of KIR2DL5 and its variants. (a) Frequency of individuals carrying KIR2DL5 in world populations published in the literature. (b) Frequency of KIR2DL5A and KIR2DL5B in four distinct populations determined in the present study. Only a single African American carried the expressed 2DL5B*00602 sequence and further, had an additional expressed 2DL5A*001 sequence and thus the frequency 2DL5A is identical to the frequency of individuals carrying the expressed gene (carrying at least one of the expressed alleles 2DL5A*001, A*005 and B*00602). Similarly, the frequency of 2DL5B corresponds to the frequency of individuals carrying the unexpressed KIR2DL5 gene. Only the significant p-values compared to Caucasians are provided: a=0.041; b=0.015; c=0.0000042; d=1.4 × 10−8; e=6.2 × 10−6.

KIR2DL5 and its subtypes identify certain combinations of KIR genes

To assess the link between KIR2DL5 and other KIR genes, we compared the frequency of distinct KIR genes between the groups that differ in the presence of the KIR2DL5 gene (Figure 5). Overall, the KIR genes associated with group-B haplotypes are more frequently encountered in the 2DL5-positive group compared to the 2DL5-negative group. Particularly, the KIR3DS1, 2DS3 and 2DS5 genes are present only in 2DL5-positive individuals. KIR2DS1, 2DL2 and 2DS2 occur more frequently in the 2DL5-positive group than in 2DL5-negative group. In contrast, the genes associated with the group-A haplotype (KIR3DL1, 2DL3 and 2DS4) are significantly decreased in the 2DL5-positive group as compared with the 2DL5-negative group.

Figure 5
figure5

Link between KIR2DL5 and other KIR gene content. Frequency (%F) of each genotype is expressed as a percentage and defined as the number of individuals having the genotype (N+) divided by the number of individuals studied (n) in the group. The framework genes and pseudogenes are depicted in black bars; the inhibitory KIRs are shown in white bars, whereas the activating KIRs are shown in gray bars.

To refine the association with KIR2DL5-subtypes, we compared the KIR gene frequencies between the KIR2DL5A+ and KIR2DL5B+ groups (Figure 5). Although, none of the KIR genes were restricted to a particular group, the frequency of individual KIR genes differed among these two groups. KIR2DL3, 3DS1, 2DS5 and 2DS1 genes more frequently occurred in the 2DL5A+ group than in the 2DL5B+ group. Conversely, KIR2DS2, 2DL2, 2DS3, 3DL1 and 2DS4 occurred more frequently in the 2DL5B+ group than in 2DL5A+ group. Individuals positive for both KIR2DL5A and B genes carry most KIR genes, and their KIR gene profile markedly differs from that of KIR2DL5-negative subjects.

Association between particular alleles of KIR2DL5A/B and the presence and absence of certain KIR genes was also observed (Figure 6a). At least three linked clusters were identified occurring at variable frequencies in all ethnic groups studied (Figure 6b). Except one Asian Indian sample (genotype 5, Figure 6a), all individuals carrying the KIR2DL5A*001 allele were also found to carry KIR3DS1, 2DS5 and 2DS1 genes (genotypes 1–4, 6–15, 21–24 and 31–41). The KIR2DS3 gene was always found in individuals carrying either KIR2DL5A*005 (genotypes 16–24 and 42–47) or KIR2DL5B*002 (genotypes 25–36, 42–45 and 48–49). Majority of the individuals carrying 2LD5A*005 allele were found to carry KIR3DS1, 2DS3 and 2DS1 genes.

Figure 6
figure6

Link between KIR2DL5-alleles and other KIR gene content. (a) The KIR genotypes and their population frequencies. A shaded box indicates the presence of a gene and an unshaded box indicates the absence of a gene. The allele types are provided within the shaded boxes. Frequency (%F) of each genotype is expressed as a percentage and defined as number of individuals having the genotype (N+) divided by the number of individuals studied (n) in the population group. The data from eight KIR2DL5-positive Hispanic individuals is not listed separately, but has been included in the ‘all’ group. The framework genes are marked in dark boxes. Owing to shared polymorphism among A*001, A*005 and B*002 alleles, the present typing method does not distinguish an individual carrying three alleles (A*001, A*005 and B*002) from those carrying two alleles (A*001 and B*002), and thus the genotypes positive for A*001 and B*002 may further carry a third allele, A*005. (b) Three prominent KIR2DL5-linked gene clusters and their population frequencies are provided. Only the significant P-values compared to Caucasians are provided: a=0.014; b=0.00018; c=5.6 × 10−8. #The significance of linkage disequilibrium (LD) estimated by two-tailed Fisher Exact probabilities for each cluster is given.

Discussion

The direct DNA sequencing method developed here elucidates the sequence polymorphism of the entire KIR2DL5 gene from its promoter region to 3′UTR region, and identifies all known as well as new alleles. However, this method will not distinguish an individual carrying three alleles (A*001, A*005 and B*002) from those carrying two alleles (A*001 and B*002) due to shared polymorphisms among these alleles. Additional cloning of the long-template PCR products is necessary to separate three alleles. This is a simple and robust method that can be easily adopted in any laboratory. Within our study panel of 248 KIR2DL5-positive unrelated individuals representing four ethnic populations, we found only 14 KIR2DL5 sequences that differ from each other within the coding region, suggesting that KIR2DL5 has limited polymorphism. Although the African-American group was small, comprising only 18 KIR2DL5-positive individuals, more KIR2DL5 alleles were detected in this group than in other population groups. This suggests that more KIR2DL5 polymorphisms are likely to be discovered in Africans. Consistent with this finding, extensive polymorphism was also observed at the KIR3DL1/S1 locus in African populations22 indicating that a higher level of KIR sequence diversity is a characteristic feature of African populations and is consistent to that seen in other genetic loci.23, 24

Differences between KIR2DL5 sequences were only seen at 14 nucleotide positions within the 1128 bp long coding region (Figure 2a), of which only seven were nonsynonymous substitutions causing amino acid change. The substitutions are scattered over the coding regions; none affected the predicted ligand-binding loops, stem/transmembrane regions, or ITIM motifs (Supplementary Figure 2). Moreover, all KIR2DL5 sequences encoded only four distinct ‘ectotypes’ that differ from each other by just 1–2 amino-acid substitutions in the extracellular Ig-like domains and stem region. This is very different from the scenario seen in KIR3DL1, which has been shown to be highly polymorphic with enriched amino-acid substitutions in the ligand-binding loops.22, 25 Confined variations in the ligand-binding sites of KIR3DL1 have been considered to be driven by coevolving polymorphic HLA-B and HLA-A ligands.22, 26 The conserved nature of KIR2DL5 suggests the possibility that it recognizes an invariant determinant. It is interesting to note that KIR2DL4 that displays limited polymorphism,27, 28, 29 and shares high structural homologies to KIR2DL5, binds to the conserved non-classical HLA-G molecule.6, 9

The known regulatory elements in the promoter region are conserved in all KIR2DL5 sequences.13 Of the 21 distinct KIR2DL5 sequences, eight belong to 2DL5A and the remaining 13 belong to 2DL5B. Eight KIR2DL5A alleles encode only two distinct proteins (2DL5A*001 and 2DL5A*005). Although 13 KIR2DL5B alleles are predicted to encode nine distinct proteins, the mutation in the AML1 motif causes most alleles to be untranscribed. Thus only 2DL5B*003 and 2DL5B*00602 are likely to be expressed on the cell surface. KIR3DL3, another unexpressed gene, is also highly polymorphic.30, 31 KIR3DL3 and KIR2DL5B share several common features including their location in the centromeric half of the KIR gene complex, conservation in hominoids and they are predicted to encode inhibitory receptors of unknown ligand specificity.4, 10 However, it is not clear what drives the sequence polymorphism of these unexpressed loci. One possibility is that these null-loci may be expressed in certain physiological or pathological conditions, and thus are subjected to natural selection.32

Individuals carrying the KIR2DL5 gene vary substantially among populations ranging in frequency from 35 to 85% (Figure 4a). Owing to the allelic variations, only a subset of these individuals carries a functional KIR2DL5 gene (Figure 4b). Notably, 83% of the African Americans, who carry a 2DL5 gene do not express this inhibitory receptor as they carry only the unexpressed 2DL5B variants. Analogous to this scenario, KIR3DL1*00426, 33 and KIR2DL2*004,34 alleles of other inhibitory KIR genes lacking cell surface expression, are reported at high frequencies in African populations indicating that some inhibitory KIR genes may be negatively selected in Africans. In contrast, the majority of the KIR2DL5-positive Asian individuals carry an expressed variant.

A stretch of 14 kb enriched with L1 repeats at the upstream of KIR2DL4 divides the KIR haplotype into two halves.10 KIR3DL3 at the 5′-end and KIR3DP1 at the 3′-end mark the centromeric half, whereas KIR2DL4 at the 5′-end and KIR3DL2 at the 3′-end mark the telomeric half. These four end-marking framework genes are present on all KIR haplotypes and thus occur 100% in all populations.11 KIR2DL5A and 2DL5B genes are located in the telomeric and centromeric halves respectively, and their alleles display strong linkage with certain activating KIR genes positioned in close proximity. At least three “linked-clusters” were observed in all ethnic groups but at different frequencies, indicating that natural selection is probably affecting the entire group of KIR genes rather than the individual loci involved in these clusters. Two of the linked clusters carry a KIR2DS3 gene in combination with either 2DL5A*005 in the telomeric half or 2DL5B*002 in the centromeric half, and thus two copies of the KIR2DS3 gene were possibly present on the same haplotype, a situation previously observed by family segregation analysis and sequencing the inter-loci PCR amplicons.35, 36

By simple subtyping of KIR2DL5A and 2DL5B loci, one can predict the content of activating KIR genes. For instance, individuals carrying 2DL5A (in the absence of 2DL5B) will most likely carry KIR3DS1, 2DS1 and 2DS5 genes. Individuals carrying 2DL5B (in the absence of 2DL5A) will most likely carry KIR2DS3 and 2DS2. Individuals carrying both KIR2DL5A and 2DL5B will carry all five of these activating KIR genes. Conversely, individuals negative for 2DL5 will lack these five activating KIR loci. Consequently, a simple typing system distinguishing 2DL5A (particularly the common allele A*001) and 2DL5B (particularly the common allele B*002) can be a powerful screening test to assess the content of most variable activating KIR genes that have been implicated in human disease37, 38, 39 and in the outcome of hematopoietic stem cell transplantation.40, 41, 42

Materials and methods

Samples

Genomic DNA samples from 250 Caucasian blood donors from the National Marrow Donor Program (NMDP), 96 Asian Indians from the All India Institute of Medical Sciences, New Delhi, 32 African Americans and 35 Asians (Korean, Vietnamese, Japanese and Filipino) from the UCLA International DNA exchange program were included in this study. The study was reviewed and approved by appropriate Institutional Review Boards. The DNA samples were isolated from peripheral blood samples using the QIAamp blood kit (Qiagen, Valencia, CA). Quality and quantity of DNA was determined by UV spectrophotometry and the concentration was adjusted to 100 ng/μl.

The presence and absence of known KIR genes was determined using our recently described gene-specific PCR typing system.43 A total of 240 individuals (121 Caucasians, 81 Asian Indians, 18 African Americans and 20 Asians) identified as KIR2DL5-positive were further characterized for sequence polymorphism of the KIR2DL5 gene. Furthermore, eight Hispanic individuals carrying the KIR2DL5 gene were included in the KIR2DL5-sequencing analysis. The DNA samples from blood donors RR and WC in whom the KIR2DL5B*002 and *003 were originally isolated,5, 13 were included as controls for the direct sequencing method.

Direct DNA sequencing method for KIR2DL5 gene

To determine the nature of KIR2DL5 gene polymorphism, we developed a direct DNA-sequencing method. The strategy includes the amplification of the complete KIR2DL5 gene using gene-specific primers and direct sequencing of the PCR amplicons (without cloning) following enzymatic purification. We have recently used a similar approach successfully to determine the polymorphism of KIR3DS1 and 2DS3 genes.44

KIR2DL5 gene was amplified from the promoter region to 3′untranslated region (3′UTR) using a high fidelity Expand Long Template PCR system (Roche Applied Science, Indianapolis, IN). A KIR2DL5-specific forward primer 2DL5PF1 recognizing the promoter region (at 670 bp upstream of the translation-start codon) and a reverse primer 2DL5C2R1 recognizing the 3′UTR (at 262 bp downstream of the translation-stop codon) were used to amplify both KIR2DL5A and B genes. The PCR amplifications were performed in a reaction volume of 30 μl with a final concentration of 1 × Expand Long Template buffer-3 (2.75 mM MgCl2 and detergents, Roche Applied Science), 500 μM of each deoxynucleotide triphosphate (dNTPs) (Applied Biosystems, Foster City, CA), 0.3 μM of each forward and reverse primers, 2.25 unit Expand Long Template enzyme mix (Roche Applied Science) and 200 ng genomic DNA. The following thermal cycling was performed in a ABI 9700 GeneAmp PCR system (Applied Biosystems): initial denaturation for 2 min at 92 °C, 10 cycles at 92 °C for 10 s, 60 °C for 30 s and 68 °C for 10 min, 22 cycles at 92 °C for 15 s, 58 °C for 30 s and 68 °C for 10 min, and a final extension at 68 °C for 20 min. Two μl of PCR amplified products were electrophoresed on a 1% agarose gel supplemented with 0.1 μg/ml ethidium bromide, and examined for the single band of 10 kb size.

The KIR2DL5 gene amplicons were purified from unincorporated primers and dNTPs by digesting with ExoSAP-IT Exonuclease-I according to the manufacturer's instructions (USB Corporation, Cleveland, OH). The purified PCR products were used as template in the sequencing reactions. Sequencing was performed using BigDye terminator V1.1 cycle sequencing kit (Applied Biosystems) and ABI PRISIMTM 3100 capillary sequencer (Applied Biosystems) as we described recently.44 All coding exons were sequenced in both directions using primers that were generally annealed at the intron regions (Figure 1). The promoter region and intron-1 were sequenced to determine KIR2DL5A and B types based on two unique insertions in the 2DL5B gene, a 58 bp insertion in the promoter region and a 20 bp insertion in the intron-1 region.

Cloning of KIR2DL5 gene

The samples indicative of carrying novel mutations on direct sequencing analysis of KIR2DL5 gene were subjected to cloning to separate the novel alleles from the known sequences. The KIR2DL5 gene amplicons were purified by High Pure PCR template preparation kit (Roche Applied Science). The purified PCR fragments were polished, phosphorylated and then ligated into the cosmid vector (Expand vector I) by the blunt-end cloning method according to the manufacturer's instructions (Roche Applied Science). The vectors were packaged into λ bacteriophages, and then infected into E. Coli DH5α. The positive clones selected by ampicillin resistance were used to isolate 2DL5-carrying vectors using Qiaprep Spin Miniprep kit (Qiagen). Nucleotide sequences were determined using the BigDye terminator V1.1 cycle sequencing kit (Applied Biosystems) and ABI PRISIMTM 3100 capillary sequencer (Applied Biosystems). For each variant, at least five clones derived from two different PCR amplifications were characterized, a strategy adopted to eliminate the PCR-artifacts and errors.

Sequence analysis and statistical methods

The Assign SBT v3.5.1 software (Conexio Genomics, Australia) was used to combine both forward and reverse sequence files to inspect and edit the electropherograms. The Assign program assigned the alleles by comparing the test sequences with a library of known sequences downloaded from the Immuno Polymorphism Database (IPD) (http://www.ebi.ac.uk/ipd/kir). Sequence alignment and comparison were performed using ClustalX v1.8345 and BioEdit v7.0.5.3 (by Tom Hall: http://www.mbio.ncsu.edu/BioEdit/page2.html) software. New sequences were submitted to the GenBank and IPD databases,46 and were assigned the following accession numbers and official names: KIR2DL5A*00102 ( EF473257 ), KIR2DL5A*00103 ( EF473258 ), KIR2DL5A*00104 ( EF473261 ), KIR2DL5A*00105 ( EF473264 ), KIR2DL5B*00602 ( EF473266 ), KIR2DL5B*00801 ( EF473256 ), KIR2DL5B*00802 ( EF473262 ), KIR2DL5B*010 ( EF473259 ) and KIR2DL5B*011 ( EF473263 ). The complete sequences of promoter and intron-1 regions for four known alleles were further submitted to GenBank and were assigned the following accession numbers: 2DL5B*003 ( EU450878 ), 2DL5B*004 ( EU450879 ), 2DL5B*0050101 ( EU489567 ) and 2DL5B*0050102 ( EU489568 ). Three heterozygous sequences comprising novel substitutions (indicative of additional new 2DL5 alleles) were deposited to GenBank under the accession numbers: EF473260 (2DL5-New5), EF473265 (2DL5-New10) and EF473267 (2DL5-New12). KIR2DL5A*00103 appears to be identical to a recently characterized sequence.47 The complete KIR genotyping, ethnic background, and source of the DNA from which the new alleles were isolated are available at the IPD databases.46 The KIR genotyping of these DNA samples are also provided in Figure 6a.

The frequencies of KIR2DL5 alleles in the study populations were determined by direct counting. Differences in the distribution of KIR2DL5 variants and the significance of linkage disequilibrium were estimated by two-tailed Fisher's Exact probabilities (p), where P<0.05 is considered to be statistically significant. A phylogenetic tree of KIR2DL5 sequences was constructed by the DNA Maximum Likelihood method with molecular clock (DNAMLK) version 3.5c21 and TREEVIEW48 programs.

Accession codes

Accessions

GenBank/EMBL/DDBJ

References

  1. 1

    Biron CA, Nguyen KB, Pien GC, Cousens LP, Salazar-Mather TP . Natural killer cells in antiviral defense: function and regulation by innate cytokines. Annu Rev Immunol 1999; 17: 189–220.

    CAS  PubMed  PubMed Central  Google Scholar 

  2. 2

    Cerwenka A, Lanier LL . Natural killer cells, viruses and cancer. Nat Rev Immunol 2001; 1: 41–49.

    CAS  PubMed  PubMed Central  Google Scholar 

  3. 3

    Khakoo SI, Rajalingam R, Shum BP, Weidenbach K, Flodin L, Muir DG et al. Rapid evolution of NK cell receptor systems demonstrated by comparison of chimpanzees and humans. Immunity 2000; 12: 687–698.

    CAS  Article  Google Scholar 

  4. 4

    Rajalingam R, Parham P, Abi-Rached L . Domain shuffling has been the main mechanism forming new hominoid killer cell Ig-like receptors. J Immunol 2004; 172: 356–369.

    CAS  Article  Google Scholar 

  5. 5

    Vilches C, Rajalingam R, Uhrberg M, Gardiner CM, Young NT, Parham P . KIR2DL5, a novel killer-cell receptor with a D0-D2 configuration of Ig-like domains. J Immunol 2000; 164: 5797–5804.

    CAS  Article  Google Scholar 

  6. 6

    Rajagopalan S, Bryceson YT, Kuppusamy SP, Geraghty DE, van der Meer A, Joosten I et al. Activation of NK cells by an endocytosed receptor for soluble HLA-G. PLoS Biol 2006; 4: e9.

    Article  Google Scholar 

  7. 7

    Yusa S, Catina TL, Campbell KS . KIR2DL5 can inhibit human NK cell activation via recruitment of Src homology region 2-containing protein tyrosine phosphatase-2 (SHP-2). J Immunol 2004; 172: 7385–7392.

    CAS  Article  Google Scholar 

  8. 8

    Estefania E, Flores R, Gomez-Lozano N, Aguilar H, Lopez-Botet M, Vilches C . Human KIR2DL5 is an inhibitory receptor expressed on the surface of NK and T lymphocyte subsets. J Immunol 2007; 178: 4402–4410.

    CAS  Article  Google Scholar 

  9. 9

    Selvakumar A, Steffens U, Dupont B . NK cell receptor gene of the KIR family with two IG domains but highest homology to KIR receptors with three IG domains. Tissue Antigens 1996; 48: 285–294.

    CAS  Article  Google Scholar 

  10. 10

    Wilson MJ, Torkar M, Haude A, Milne S, Jones T, Sheer D et al. Plasticity in the organization and sequences of human KIR/ILT gene families. Proc Natl Acad Sci USA 2000; 97: 4778–4783.

    CAS  Article  Google Scholar 

  11. 11

    Yawata M, Yawata N, Abi-Rached L, Parham P . Variation within the human killer cell immunoglobulin-like receptor (KIR) gene family. Crit Rev Immunol 2002; 22: 463–482.

    CAS  Article  Google Scholar 

  12. 12

    Kulkarni S, Single RM, Martin MP, Rajalingam R, Badwe R, Joshi N et al. Comparison of the rapidly evolving KIR locus in Parsis and natives of India. Immunogenetics 2008 (in press).

  13. 13

    Vilches C, Gardiner CM, Parham P . Gene structure and promoter variation of expressed and nonexpressed variants of the KIR2DL5 gene. J Immunol 2000; 165: 6416–6421.

    CAS  Article  Google Scholar 

  14. 14

    Gomez-Lozano N, Gardiner CM, Parham P, Vilches C . Some human KIR haplotypes contain two KIR2DL5 genes: KIR2DL5A and KIR2DL5B. Immunogenetics 2002; 54: 314–319.

    CAS  Article  Google Scholar 

  15. 15

    Jacobs R, Hintzen G, Kemper A, Beul K, Kempf S, Behrens G et al. CD56bright cells differ in their KIR repertoire and cytotoxic features from CD56dim NK cells. Eur J Immunol 2001; 31: 3121–3127.

    CAS  Article  Google Scholar 

  16. 16

    Kikuchi-Maki A, Yusa S, Catina TL, Campbell KS . KIR2DL4 is an IL-2-regulated NK cell receptor that exhibits limited expression in humans but triggers strong IFN-gamma production. J Immunol 2003; 171: 3415–3425.

    CAS  Article  Google Scholar 

  17. 17

    Faure M, Long EO . KIR2DL4 (CD158d), an NK cell-activating receptor with inhibitory potential. J Immunol 2002; 168: 6208–6214.

    CAS  Article  Google Scholar 

  18. 18

    Kikuchi-Maki A, Catina TL, Campbell KS . Cutting edge: KIR2DL4 transduces signals into human NK cells through association with the Fc receptor gamma protein. J Immunol 2005; 174: 3859–3863.

    CAS  Article  Google Scholar 

  19. 19

    Meyers S, Downing JR, Hiebert SW . Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions. Mol Cell Biol 1993; 13: 6336–6345.

    CAS  Article  Google Scholar 

  20. 20

    Levanon D, Groner Y . Structure and regulated expression of mammalian RUNX genes. Oncogene 2004; 23: 4211–4219.

    CAS  Article  Google Scholar 

  21. 21

    Felsenstein J . Evolutionary trees from DNA sequences: a maximum likelihood approach. J Mol Evol 1981; 17: 368–376.

    CAS  Article  Google Scholar 

  22. 22

    Norman PJ, Abi-Rached L, Gendzekhadze K, Korbel D, Gleimer M, Rowley D et al. Unusual selection on the KIR3DL1/S1 natural killer cell receptor in Africans. Nat Genet 2007; 39: 1092–1099.

    CAS  Article  Google Scholar 

  23. 23

    Tishkoff SA, Verrelli BC . Patterns of human genetic diversity: implications for human evolutionary history and disease. Annu Rev Genomics Hum Genet 2003; 4: 293–340.

    CAS  Article  Google Scholar 

  24. 24

    Marth GT, Czabarka E, Murvai J, Sherry ST . The allele frequency spectrum in genome-wide human variation data reveals signals of differential demographic history in three large world populations. Genetics 2004; 166: 351–372.

    CAS  Article  Google Scholar 

  25. 25

    Gardiner CM, Guethlein LA, Shilling HG, Pando M, Carr WH, Rajalingam R et al. Different NK cell surface phenotypes defined by the DX9 antibody are due to KIR3DL1 gene polymorphism. J Immunol 2001; 166: 2992–3001.

    CAS  Article  Google Scholar 

  26. 26

    Single RM, Martin MP, Gao X, Meyer D, Yeager M, Kidd JR et al. Global diversity and evidence for coevolution of KIR and HLA. Nat Genet 2007; 39: 1114–1119.

    CAS  Article  Google Scholar 

  27. 27

    Schellekens J, Tilanus MG, Rozemuller EH . The elucidation of KIR2DL4 gene polymorphism. Mol Immunol 2008; 45: 1900–1906.

    CAS  Article  Google Scholar 

  28. 28

    Zhu FM, Jiang K, Lv QF, He J, Yan LX . Investigation of killer cell immunoglobulin-like receptor KIR2DL4 diversity by sequence-based typing in Chinese population. Tissue Antigens 2006; 67: 214–221.

    CAS  Article  Google Scholar 

  29. 29

    Shulse C, Steiner NK, Hurley CK . Allelic diversity in KIR2DL4 in a bone marrow transplant population: description of three novel alleles. Tissue Antigens 2007; 70: 157–159.

    CAS  Article  Google Scholar 

  30. 30

    Hou L, Chen M, Steiner NK, Belle I, Turino C, Ng J et al. Seventeen novel alleles add to the already extensive KIR3DL3 diversity. Tissue Antigens 2007; 70: 449–454.

    CAS  Article  Google Scholar 

  31. 31

    Jones DC, Hiby SE, Moffett A, Trowsdale J, Young NT . Nature of allelic sequence polymorphism at the KIR3DL3 locus. Immunogenetics 2006; 58: 614–627.

    CAS  Article  Google Scholar 

  32. 32

    Trundley AE, Hiby SE, Chang C, Sharkey AM, Santourlidis S, Uhrberg M et al. Molecular characterization of KIR3DL3. Immunogenetics 2006; 57: 904–916.

    CAS  Article  Google Scholar 

  33. 33

    Pando MJ, Gardiner CM, Gleimer M, McQueen KL, Parham P . The protein made from a common allele of KIR3DL1 (3DL1*004) is poorly expressed at cell surfaces due to substitution at positions 86 in Ig domain 0 and 182 in Ig domain 1. J Immunol 2003; 171: 6640–6649.

    CAS  Article  Google Scholar 

  34. 34

    VandenBussche CJ, Dakshanamurthy S, Posch PE, Hurley CK . A single polymorphism disrupts the killer Ig-like receptor 2DL2/2DL3 D1 domain. J Immunol 2006; 177: 5347–5357.

    CAS  Article  Google Scholar 

  35. 35

    Hsu KC, Chida S, Geraghty DE, Dupont B . The killer cell immunoglobulin-like receptor (KIR) genomic region: gene-order, haplotypes and allelic polymorphism. Immunol Rev 2002; 190: 40–52.

    CAS  Article  Google Scholar 

  36. 36

    Hsu KC, Liu XR, Selvakumar A, Mickelson E, O'Reilly RJ, Dupont B . Killer Ig-like receptor haplotype analysis by gene content: evidence for genomic diversity with a minimum of six basic framework haplotypes, each with multiple subsets. J Immunol 2002; 169: 5118–5129.

    Article  Google Scholar 

  37. 37

    Khakoo SI, Carrington M . KIR and disease: a model system or system of models? Immunol Rev 2006; 214: 186–201.

    CAS  Article  Google Scholar 

  38. 38

    Arnheim L, Dillner J, Sanjeevi CB . A population-based cohort study of KIR genes and genotypes in relation to cervical intraepithelial neoplasia. Tissue Antigens 2005; 65: 252–259.

    CAS  Article  Google Scholar 

  39. 39

    Scquizzato E, Teramo A, Miorin M, Facco M, Piazza F, Noventa F et al. Genotypic evaluation of killer immunoglobulin-like receptors in NK-type lymphoproliferative disease of granular lymphocytes. Leukemia 2007; 21: 1060–1069.

    CAS  Article  Google Scholar 

  40. 40

    Chewning JH, Gudme CN, Hsu KC, Selvakumar A, Dupont B . KIR2DS1-positive NK cells mediate alloresponse against the C2 HLA-KIR ligand group in vitro. J Immunol 2007; 179: 854–868.

    CAS  Article  Google Scholar 

  41. 41

    McQueen KL, Dorighi KM, Guethlein LA, Wong R, Sanjanwala B, Parham P . Donor-recipient combinations of group A and B KIR haplotypes and HLA class I ligand affect the outcome of HLA-matched, sibling donor hematopoietic cell transplantation. Hum Immunol 2007; 68: 309–323.

    CAS  Article  Google Scholar 

  42. 42

    Schellekens J, Rozemuller EH, Petersen EJ, van den Tweel JG, Verdonck LF, Tilanus MG . Activating KIRs exert a crucial role on relapse and overall survival after HLA-identical sibling transplantation. Mol Immunol 2008; 45: 2255–2261.

    CAS  Article  Google Scholar 

  43. 43

    Du Z, Gjertson DW, Reed EF, Rajalingam R . Receptor-ligand analyses define minimal killer cell Ig-like receptor (KIR) in humans. Immunogenetics 2007; 59: 1–15.

    CAS  Article  Google Scholar 

  44. 44

    Luo L, Du Z, Sharma SK, Cullen R, Spellman S, Reed EF et al. Chain-terminating natural mutations affect the function of activating KIR receptors 3DS1 and 2DS3. Immunogenetics 2007; 10: 779–792.

    Article  Google Scholar 

  45. 45

    Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG . The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997; 25: 4876–4882.

    CAS  Article  Google Scholar 

  46. 46

    Robinson J, Waller MJ, Stoehr P, Marsh SG . IPD—the immuno polymorphism database. Nucleic Acids Res 2005; 33: D523–D526.

    CAS  Article  Google Scholar 

  47. 47

    Houtchens KA, Nichols RJ, Ladner MB, Boal HE, Sollars C, Geraghty DE et al. High-throughput killer cell immunoglobulin-like receptor genotyping by MALDI-TOF mass spectrometry with discovery of novel alleles. Immunogenetics 2007; 59: 525–537.

    CAS  Article  Google Scholar 

  48. 48

    Page RD . TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 1996; 12: 357–358.

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

This work was supported by start-up funds from the UCLA Department of Pathology and Laboratory Medicine to Dr Rajalingam, and by funding from the National Marrow Donor Program (NMDP) and the Department of the Navy, Office of Naval Research Cooperative Agreement no. N00014-99-2-0006 and Grant no. N00014-05-1-0859 to the NMDP. We thank Damian Goodridge, Conexio Genomics, Western Australia for his help in building and optimizing KIR sequence libraries for the use in Assign software, John Muramoto for providing DNA samples from the UCLA International DNA Exchange Program, and Cynthia Vierra-Green and Rebecca Cullen for providing DNA samples from the NMDP repository. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the Office of Naval Research or the NMDP.

Author information

Affiliations

Authors

Corresponding author

Correspondence to R Rajalingam.

Additional information

Conflict of interest

The authors declare no financial or commercial conflict of interest.

Supplementary Information accompanies the paper on Genes and Immunity website (http://www.nature.com/gene)

Supplementary information

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Du, Z., Sharma, S., Spellman, S. et al. KIR2DL5 alleles mark certain combination of activating KIR genes. Genes Immun 9, 470–480 (2008). https://doi.org/10.1038/gene.2008.39

Download citation

Keywords

  • killer cell immunoglobulin-like receptor
  • KIR2DL5
  • NK cell receptors
  • polymorphism
  • population diversity

Further reading

Search

Quick links