Gemcitabine synergistically enhances the effect of adenovirus gene therapy through activation of the CMV promoter in pancreatic cancer cells

Abstract

Adenovirus-mediated gene therapy shows remarkable promise as a new strategy for advanced pancreatic cancer, but satisfactory clinical results have not yet been obtained. To improve this gene therapy, we investigated the effects of gemcitabine (GEM) on transgene expression by adenoviral vectors and their biological effects. We used Ad-lacZ and adenoviral vector-expressing NK4 (Ad-NK4) as representative adenoviral vectors. These vectors express β-galactosidase (β-gal) and NK4 (which inhibits the invasion of cancer cells), respectively, under the control of the CMV promoter. Cells were infected with the individual adenoviruses and then treated with GEM. GEM increased β-gal mRNA expression and β-gal activity, and increased NK4 expression in both culture media and within infected cells, in dose-dependent manners. The increased expression of NK4 delivered by Ad-NK4 had biological effects by inhibiting the invasion of cancer cells. GEM also enhanced NK4 expression in SUIT-2 cells transfected with an NK4-expressing plasmid, suggesting that GEM enhanced CMV promoter activity. In in vivo experiments, NK4 expression within subcutaneously implanted tumors was increased in GEM-treated mice compared with control mice. These results suggest that adenovirus-mediated gene therapy with GEM may be a promising approach for treating pancreatic cancer, and that this combination therapy may decrease the risks of side effects.

Introduction

Pancreatic cancer is highly lethal, and associated with an annual incidence almost equal to its annual death rate owing to late diagnosis, aggressive tumor growth, invasion and metastasis, and a high rate of relapse after adjuvant therapy.1, 2, 3 Even among patients with resectable pancreatic cancer, nearly all die from the disease within 7 years after surgery, and conventional chemotherapy and radiotherapy show limited effectiveness.4, 5 Therefore, new strategies for pancreatic cancer, such as molecular target therapies and gene therapies, are needed and beginning to show remarkable promise.6, 7

Although adenovirus-mediated gene therapy is one of the promising approaches for cancer treatment because of the high transduction efficiency,8 the great results demonstrated at the laboratory level are not always obtained in clinical settings.9 Therefore, it is still necessary to develop devices for improving the efficiency of the gene introduction.

We earlier reported that gene therapy with an adenoviral vector-expressing NK4 (Ad-NK4), which acts as a hepatocyte growth factor (HGF) antagonist and an angiogenesis inhibitor, inhibited the in vitro invasion and in vivo growth of human pancreatic cancer cells.10 We also reported that Ad-NK4 combined with gemcitabine (GEM), which is now the first-line chemotherapeutic agent for pancreatic cancer, remarkably suppressed the growth and metastasis of human pancreatic cancer cells.11 In the latter study, however, we did not examine the detailed mechanism of the enhanced suppression of tumor growth, such as the interaction between GEM and adenovirus-mediated gene therapy. On the other hand, we recently reported that radiation could enhance adenovirus-mediated gene therapy by increasing adenovirus infectivity and CMV promoter activity, which regulated the expression of target genes.12 In support of these findings, genotoxic stresses, such as chemotherapeutic agents and irradiation, have been reported to enhance the expression of transgenes under the control of the CMV promoter.13, 14, 15 To date, however, the effects of GEM on the adenovirus-mediated transduction of target genes have remained unknown.

In this study, we investigated the effects of GEM on the expression levels of transgenes under the control of the CMV promoter using Ad-lacZ and Ad-NK4 as representative adenoviral vectors. Furthermore, we investigated the effects of GEM on CMV promoter activity. The data obtained suggest that adenovirus-mediated gene therapy combined with GEM may be a promising approach for the treatment of pancreatic cancer, and that this combination therapy may decrease the risks of side effects.

Materials and methods

Cultured cells and reagents

The following three human pancreatic cancer cell lines were used: SUIT-2 and KP-2 (generous gifts from Dr H Iguchi, National Shikoku Cancer Center, Matsuyama, Japan) and MIA PaCa-2 (Japanese Cancer Resource Bank, Tokyo, Japan). The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with streptomycin (100 μg ml–1), penicillin (100 U ml–1), and 10% fetal bovine serum at 37 °C in a humidified atmosphere of 90% air and 10% CO2. GEM (2′,2′-difluorodeoxycytidine) was kindly provided by Eli Lilly and Company (Indianapolis, IN).

Construction of recombinant adenoviruses

A recombinant adenoviral vector-expressing human NK4 was constructed as described earlier.5, 16, 17, 18 A control vector expressing the bacterial β-galactosidase (β-gal) gene (lacZ) was constructed by the same procedure. The recombinant adenoviruses (denoted as Ad-NK4 and Ad-lacZ, respectively) were propagated in HEK293 cells. The adenovirus titers in plaque-forming units (pfu) were determined by plaque-formation assays with HEK293 cells. The multiplicity of infection (MOI) was defined as the ratio of the total number of pfu used in a particular infection to the total number of cells to be infected.

Treatment with adenoviruses in combination with GEM

Cells were seeded in plates and cultured in DMEM supplemented with 10% fetal bovine serum for 24 h. The cells were then infected with Ad-lacZ or Ad-NK4 at various MOIs for 1 h, followed by replacement of the culture media with fresh DMEM supplemented with 10% fetal bovine serum. GEM was dissolved in phosphate-buffered saline and added to the fresh media at various concentrations. After 24 h, the GEM-containing media were replaced with fresh media without GEM.

Quantitative analysis of β-gal mRNA levels by one-step real-time reverse transcription–polymerase chain reaction

Total RNA was extracted from cultured cells using a High Pure RNA Isolation kit (Roche Diagnostics, Mannheim, Germany) with DNaseI (Roche Diagnostics) treatment, according to the manufacturer's instructions. We designed specific primers as follows: β-gal, forward primer, 5′- cacggcacatacacttgctg -3′ and reverse primer, 5′- atcgccatttgaccactacc -3′; 18S rRNA, forward primer, 5′- gtaacccgttgaaccccatt -3′ and reverse primer, 5′- ccatccaatcggtagtagccg -3′. We performed BLAST searches to ensure the specificities of these primers. One-step quantitative reverse transcription–polymerase chain reaction (qRT–PCR) was performed using a QuantiTect SYBR Green Reverse Transcription–PCR kit (Qiagen K.K., Tokyo, Japan) with a Light Cycler Quick System 350S (Roche Applied Science, Mannheim, Germany) as described earlier.19 Each sample was run in triplicate and the expression of each gene was presented as the ratio between the expression of each target gene mRNA and that of 18S rRNA.

Assessment of transgene distributions by evaluation of β-gal expression

After treatment of SUIT-2 cells with Ad-lacZ and GEM as described above, the treated cells were rinsed twice with phosphate-buffered saline and fixed with 0.25% glutaraldehyde in phosphate-buffered saline for 15 min at 4 °C. β-gal activity was detected by immersing the cells in 5-bromo-4-chloro-3-indolyl-β-galactopyranoside (X-gal)-staining solution (5 mM K4FeCN, 5 mM K3FeCN, 2 mM MgCl2, 1 mg ml–1 X-gal) for 12 h at 37 °C.

Extraction of proteins from Ad-NK4-infected cells

SUIT-2 cells were infected with Ad-NK4 and treated with GEM as described above. After these treatments, the cells were lysed in 500 l of ice-cold lysis buffer (20 mM Tris–HCl pH 7.5, 150 mM NaCl, 10 mM EDTA, 5 μg ml–1 leupeptin, 1 mM phenylmethyl sulfonyl fluoride, and 0.5% (v/v) Triton X-100). Cell debris was removed by centrifugation at 14 000 g for 20 min at 4 °C and the supernatants were collected. The protein concentrations of the supernatants were measured by the absorbances at 280 nm using an ND-1000 Spectrophotometer (NanoDrop Technologies, Rockland, DE) and adjusted to 2.0 mg ml–1 with lysis buffer.

Electroporation

pcDNA-3-NK4 (2.5 μg; an NK4-expressing plasmid) was mixed with 5 × 106 SUIT-2 cells and electroporated with Nucleofector (Amaxa Biosystems GmbH, Koln, Germany) according to the manufacturer's instructions.

Measurement of NK4 expression levels

At 24 h after infection of pancreatic cancer cells with Ad-NK4 or transfection with an NK4-expressing plasmid with or without GEM, the media were exchanged for fresh media. The conditioned media and proteins extracted from cells infected with Ad-NK4 were measured using a human HGF ELISA kit (IMMUNIS HGF EIA; Institute of Immunology, Tokyo, Japan), according to the manufacturer's recommendations.

Cell viability assay

Cell viability was evaluated by the fluorescence intensity of propidium iodide (PI) as described earlier.20 Cells were plated at 2 × 104 cells per well in 24-well tissue culture plates (Becton Dickinson Labware, Bedford, MA) and cultured overnight. After determination of the initial cell numbers, the cells were infected with Ad-NK4 at various MOIs for 1 h and then treated with GEM at various concentrations for 24 h as described above. PI (30 μM) and digitonin (600 μM) were added to each well to label all nuclei with PI. The fluorescence intensity, corresponding to the total cells, was measured using a CytoFluor II multi-well plate reader (PerSeptive Viosystems Inc., Framingham, MA) with 530-nm excitation and 645-nm emission filters. Cell viability was defined as the ratio of fluorescence intensity at each time point to that measured at the beginning of the experiment. All experiments were performed in triplicate wells and repeated at least three times.

Invasion assay

SUIT-2 cells were infected with Ad-NK4 at an MOI of 10 and then treated with 0, 1, 10, or 100 nM GEM for 24 h as described above. The conditioned culture media were collected on days 1 and 3. Invasion of tumor cells was measured as the number of cells invading through Matrigel-coated transwell inserts (Becton Dickinson, Franklin Lakes, NJ) as described earlier.21 Briefly, fresh untreated SUIT-2 cells were seeded in 24-well plates at a density of 5 × 104 cells per cm2 in 100 μl of DMEM mixed with 150 μl of conditioned culture media in the inner chamber, and cultured with 150 μl of conditioned culture media in the outer chamber. After 48 h of incubation in the presence of 3 ng ml–1 HGF, cells that had invaded to the lower surface of the Matrigel-coated membrane were fixed with 70% ethanol, stained with hematoxylin and eosin, and counted in five randomly selected fields under a light microscope (Nikon, ECLIPSE TE2000, Tokyo, Japan).

In vivo analysis of NK4 expression levels in tumors

Six-week-old female nude mice were subcutaneously injected with 5 × 106 SUIT-2 cells (200 μl) in the back. Six mice were used in each experimental group. After 7 days (day 0), the mice were administered 2 × 109 pfu Ad-NK4 pertumorally, with intraperitoneal administration of GEM (0, 10, 20, 40, and 80 mg kg–1). At 3 days after the administration, three mice in each group were killed and their tumors were excised for protein extraction. On day 7, the other three mice in each group were administered the same treatment. These mice were killed on day 10, and their tumors were also excised for protein extraction. The tumors were homogenized in ice-cold lysis buffer, and NK4 was measured by ELISA as described above.

Statistical analysis

Statistical significance was evaluated by the nonparametric Mann–Whitney U-test. Statistical significance was defined as values of P<0.05 based on a two-tailed test.

Results

GEM enhances the transgene expression of β-gal delivered by Ad-lacZ

First, to investigate the effects of GEM on the transgene expression of a target gene delivered by an adenoviral vector, we measured the expression levels of β-gal delivered by Ad-lacZ with or without GEM. SUIT-2 cells were infected with Ad-lacZ at an MOI of 10 for 1 h. After the infection, the cells were cultured with or without GEM for 24 h at various concentrations. The culture media were then replaced with fresh DMEM supplemented with 10% fetal bovine serum without GEM. We evaluated the β-gal mRNA levels by qRT–PCR and the β-gal activities by X-gal staining. The β-gal mRNA expression level increased in the GEM-treated cells in a dose-dependent manner (Figure 1a, P=0.002 and 0.008 for 10 and 100 nM GEM, respectively, on day 3), and the number of cells with positive X-gal staining also increased in a dose-dependent manner (Figure 1b, P=0.03, 0.03, and 0.001 for 1, 10, and 100 nM GEM, respectively, on day 3). These results indicate that GEM enhances the expression of β-gal delivered by Ad-lacZ in a dose-dependent manner.

Figure 1
figure1

GEM enhances the transgene expression of β-gal delivered by Ad-lacZ. SUIT-2 cells were infected with Ad-lacZ (MOI of 10) for 1 h and treated with GEM (0, 1, 10, and 100 nM) for 24 h. The culture media were then replaced with fresh media without GEM. (a) Total RNA samples were extracted on the indicated days. The expression levels of β-gal mRNA were measured by qRT–PCR and normalized by the corresponding expression level of 18S rRNA. Bars represent relative expression levels as the fold changes in comparison with untreated cells. Each value represents the mean±s.d. of three independent samples. (b) β-gal activity was assessed by X-gal staining and counted numbers of β-gal-positive cells (magnification, × 100). Each value represents the mean±s.d. of five independent fields. *P<0.05, **P<0.01.

GEM enhances the transgene expression of NK4 delivered by Ad-NK4 in both culture media and within adenovirus-infected cells

Next, we investigated the effects of GEM on the expression levels of NK4 delivered by Ad-NK4. SUIT-2 cells were infected with Ad-NK4 at an MOI of 10 and cultured with or without GEM as described above for Ad-lacZ. After replacement of the GEM-containing media with fresh media without GEM, we measured the NK4 expression levels in culture media and among intracellular proteins extracted from the infected cells on days 1, 2, and 3. GEM significantly increased the NK4 expression level in culture media in a dose-dependent manner (Figure 2a, P=0.045, 0.0014, and <0.0001 for 1, 10, and 100 nM GEM, respectively, on day 3), similar to the case for Ad-lacZ. In particular, the increase in expression was remarkable for 100 nM GEM. GEM also significantly increased the intracellular NK4 expression level in infected cells in a dose-dependent manner (Figure 2b, P<0.001 and 0.001 for 10 and 100 nM GEM, respectively, on day 1). In the presence of 100 nM GEM, the intracellular NK4 expression level peaked on day 1 and then decreased on days 2 and 3. It was possible that NK4 proteins accumulated within Ad-NK4-infected cells were released into the culture media when the cells were killed by the high dose of GEM, thereby leading to the increased NK4 expression level in the culture media. We investigated the viability of GEM-treated SUIT-2 cells, and found that cells treated with 100 nM GEM showed a slight decrease in viability on day 2 and a 18.8±6.9% reduction in viability on day 3 (Figure 2c). Interestingly, the increase in intracellular NK4 expression in SUIT-2 cells began to be notable on day 1 (Figure 2b), although GEM did not kill the cells at any of the concentrations examined on day 1 (Figure 2c). Furthermore, low doses of GEM, such as 10 nM, did not kill SUIT-2 cells even on day 3 (Figure 2c), but still remarkably increased NK4 expression in the culture media (P=0.0014). These data suggest that the increased levels of NK4 in the culture media in the presence of GEM were caused not by release of NK4 from dead cells alone, and also, parental SUIT-2 cells did not express NK4 both in culture media and within cells, even in the presence of GEM. These data suggested that GEM induced only increased expression of the transgene, but not the endogenous expression of NK4. In other pancreatic cancer cell lines, namely KP-2 and MIA PaCa-2 cells, which did not also express NK4, we found similar effects of GEM on the transgene expression of Ad-NK4 in culture media (Figure 3a1, a2, KP-2: P=0.0025 and 0.0018 for 100 nM and 1 μM GEM, respectively, on day 3; Figure 3b1, b2, MIA PaCa-2: P=0.0086 and 0.0002 for 10 and 100 nM GEM, respectively, day 3).

Figure 2
figure2

GEM enhances the transgene expression of NK4 delivered by Ad-NK4 in both the culture media and within adenovirus-infected SUIT-2 cells in vitro. (a, b) SUIT-2 cells were infected with Ad-NK4 (MOI of 10) for 1 h and treated with GEM (0, 1, 10, and 100 nM) for 24 h. The culture media were then replaced with fresh media without GEM. The NK4 expression levels were measured in the culture media (a) and within cells (b) on days 1, 2, and 3. (c) SUIT-2 cells were treated with GEM for 24 h, followed by replacement of the culture media with fresh media without GEM. After 72 h, the cell viabilities were determined by PI assays as the ratio of the fluorescence intensity. ‘n.d.’ in the graphs means ‘not detectable’. Bars represent relative cell viabilities as the fold changes in comparison with control cells. Each value represents the mean±s.d. of three independent samples. *P<0.05, **P<0.01.

Figure 3
figure3

GEM enhances the transgene expression of NK4 delivered by Ad-NK4 in culture media of pancreatic cancer cell lines in vitro. (a1, a2, b1, b2) The pancreatic cancer cell lines KP-2 (a1, a2) and MIA PaCa-2 (b1, b2) were infected with Ad-NK4 (MOI of 10) and cultured with or without GEM (100 nM and 1 μM for KP-2; 10 and 100 nM for MIA PaCa-2). The NK4 expression levels in the culture media were measured. For viability assays, the cells were treated with GEM for 24 h, followed by replacement of the culture media with fresh media without GEM. After 72 h, the cell viabilities were determined by the PI assays as the ratio of the fluorescence intensity. ‘n.d.’ in the graphs means ‘not detectable’. Bars represent relative cell viabilities as the fold changes in comparison with control cells. Each value represents the mean±s.d. of three independent samples. **P<0.01.

GEM synergistically enhances the inhibitory effects of Ad-NK4 on cancer cell invasion in a dose-dependent manner

NK4, which inhibits biological events driven by HGF-Met signaling, inhibits invasion, but has no effects on the proliferation and survival of pancreatic cancer cells.16, 22 As shown in Figure 4, we found that Ad-NK4 alone at an MOI of 10 did not inhibit the proliferation of SUIT-2 cells and that 10 nM GEM alone or in combination with Ad-NK4 at an MOI of 10 did not affect the proliferation for 3 days. Next, we investigated whether the enhanced NK4 expression mediated by GEM had biological effects on cancer cell invasion. Ad-NK4-infected SUIT-2 cells were treated with GEM at various concentrations for 24 h. After replacement of the GEM-containing media with fresh media without GEM, the cells were cultured for 1 or 3 days and the culture media were collected. The culture media were used for invasion assays. The GEM-free culture media derived from the Ad-NK4-infected cells treated with GEM, even if they were collected at the early phase of these treatment, significantly inhibited the number of invading cancer cells in a dose-dependent manner (Figure 5a and b, P=0.017 for 100 nM GEM on day 1, P=0.017 and 0.0002 for 10 and 100 nM GEM, respectively, on day 3). These findings suggest that the enhanced levels of NK4 expression by Ad-NK4 mediated by low doses of GEM have biological effects in a dose-dependent manner.

Figure 4
figure4

GEM does not affect the inhibitory effect of Ad-NK4 on cell proliferation. SUIT-2 cells were infected with Ad-NK4 (MOI of 10) and/or treated with GEM (10 nM). Cell viability was measured by cell numbers on the indicated days. All experiments were performed in triplicate wells and repeated at least three times.

Figure 5
figure5

GEM synergistically enhances the inhibitory effect of Ad-NK4 on cancer cell invasion in a dose-dependent manner. SUIT-2 cells were infected with Ad-NK4 (MOI of 10) and treated with GEM (0, 1, 10, and 100 nM) for 24 h. The culture media were then replaced with fresh media without GEM. The culture media were collected on days 1 and 3. Fresh untreated SUIT-2 cells were seeded in 24-well plates at a density of 5 × 104 cells per cm2 in DMEM mixed with conditioned culture media in the inner chamber and cultured with conditioned culture media in the outer chamber. After 48 h of culture in the presence of 3 ng ml–1 HGF, cells that had invaded to the lower surface of the Matrigel-coated membrane were fixed with 70% ethanol, stained with hematoxylin and eosin, and counted in five randomly selected fields under a light microscope. (a) Photomicrographs of SUIT-2 cells that have invaded to the lower surface of the Matrigel-coated membrane. (b) Numbers of SUIT-2 cells that have invaded to the lower surface of the Matrigel-coated membrane. Each value represents the mean±s.d. of five randomly selected fields. *P<0.05, **P<0.01.

GEM increases CMV promoter activity and leads to increased NK4 expression by Ad-NK4

As shown in Figure 2, we found that the NK4 expression levels within Ad-NK4-infected cells were increased in the early phase after GEM treatment. Ad-NK4 contains the CMV promoter, a strong viral promoter, to drive expression of its target gene, NK4. Several studies have shown that genotoxic stresses, such as those induced by irradiation and chemotherapy, enhance transgene expression under the control of the CMV promoter in cancer cells.12, 13, 14, 15 Therefore, we hypothesized that GEM may also enhance CMV promoter activity. To investigate this hypothesis, we transfected SUIT-2 cells, which did not express NK4 (Figure 2), with a plasmid-expressing NK4 under the control of the CMV promoter, cultured the cells with or without GEM for 24 h, and measured the NK4 expression levels in culture media after 1 and 3 days. As shown in Figure 6, GEM-treated cells showed significantly higher levels of NK4 expression than untreated cells on day 3 (P=0.04 and 0.007 for 10 and 100 nM GEM, respectively). These data suggest that GEM enhances CMV promoter activity, thereby leading to increased expression of the NK4 transgene under the control of the CMV promoter in these pancreatic cancer cells, similar to findings for other chemotherapeutic agents in diverse cell types.

Figure 6
figure6

GEM increases NK4 expression by an NK4-expressing plasmid through enhancement of CMV promoter activity. SUIT-2 cells were transfected with an NK4-expressing plasmid and treated with GEM (0, 1, 10, and 100 nM) for 24 h. The culture media were then replaced with fresh media without GEM. The NK4 expression levels in the culture media were measured on the indicated days. Each value represents the mean±s.d. of three independent samples. *P<0.05, **P<0.01.

Earlier studies have reported that several chemotherapeutic agents and irradiation enhance NF-κB activity and the MAPK pathway,23, 24 and that the CMV promoter contains binding sites for NF-κB in its enhancer region.25, 26, 27 Therefore, we investigated the effects of GEM on NF-κB activity by measuring the NF-κB protein levels in the nuclei of GEM-treated cells. GEM-treated cells expressed significantly higher levels of NF-κB in their nuclei than untreated cells (P=0.03), but the difference was small (data not shown). These data suggest that GEM enhances CMV promoter activity partially through activation of some transcriptional factors, including NF-κB.

GEM enhances the expression levels of NK4 delivered by Ad-NK4 in tumors in vivo

We have shown that GEM enhances transgene expression of NK4 delivered by Ad-NK4, thereby leading to inhibitory effects of Ad-NK4 on cancer cell invasion in vitro. We earlier showed that peritumoral injection of Ad-NK4 combined with GEM suppressed the growth of pancreatic cancer cells implanted orthotopically into nude mice,11 but did not examine the effects of GEM on the expression levels of NK4 in vivo. Therefore, we investigated whether the enhanced effects of the combination therapy were partly due to increased levels of NK4 expression within the tumors. We administered Ad-NK4 peritumorally, with or without GEM intraperitoneally at the same time on days 0 and 7. The subcutaneously implanted tumors were excised and measured for their NK4 expression levels on days 3 and 10. As shown in Figure 7, the levels of NK4 expression in the tumors did not show significant differences among the mice on day 3, whereas the levels of NK4 expression in GEM-treated mice were significantly increased in comparison with untreated control mice on day 10 (P<0.03, 0.06, 0.01, and 0.02 for 10, 20, 40, and 80 mg kg–1 GEM, respectively). These results strongly suggest that GEM enhances the effects of Ad-NK4-mediated gene therapy by increasing the expression of its NK4 transgene.

Figure 7
figure7

GEM enhances the transgene expression levels of NK4 delivered by Ad-NK4 within tumors in vivo. Six-week-old female nude mice were subcutaneously injected with SUIT-2 cells. After 7 days (day 0), the mice were administered 2 × 109 pfu of Ad-NK4 peritumorally, with intraperitoneal administration of GEM (0, 10, 20, 40, and 80 mg kg–1). At 3 days after the administration, three mice in each group were killed and their tumors were excised. On day 7, the other three mice in each group were administered the same treatment and were killed on day 10, and their tumors were also excised for protein extraction. NK4 was measured by ELISA. Each value represents the mean±s.d. of three independent samples. *P<0.05.

Discussion

In this study, we have shown that GEM enhanced adenovirus-delivered transgene expression of β-gal within infected cells and NK4 in culture media as well as within infected cells in vitro. In addition, GEM increased adenovirus-mediated NK4 expression within subcutaneously implanted tumors in nude mice in vivo. Furthermore, these increases in NK4 enhanced the inhibitory effects of Ad-NK4 on cancer cell invasion in vitro. These data indicate that GEM enhances the transgene expression of target genes delivered by adenoviral vectors as well as the biological effects of the transgenes.

Ad-NK4-infected cells produce NK4 in their cytoplasm and then secrete it. When high doses of GEM kill Ad-NK4-infected cells, the NK4 proteins within these cells may be released after cell lysis, leading to increased levels of NK4 in the culture media. Interestingly, however, we found that even low doses of GEM without cytotoxic effects enhanced adenovirus-mediated NK4 expression in both culture media and within infected cells at the early phase after the GEM treatment. These findings suggest that there are some mechanisms by which GEM enhances adenovirus-mediated transgene expression. Earlier studies have reported that several chemotherapeutic agents and irradiation can enhance the expression of transgenes under the control of the CMV promoter by increasing CMV promoter activity.13, 14 In this study, we also found that GEM increased CMV promoter activity, leading to increased levels of adenovirus-mediated transgene expression. Nevertheless, despite the fact that the GEM-enhanced transgene expression was increased by factors of tens to hundreds, the CMV promoter activity was only increased by 1.2–2.0-fold by GEM compared with controls, suggesting that other mechanisms may exist. Further studies are, therefore, required to clarify the more detailed mechanisms of the GEM-induced enhancement of adenovirus-mediated gene transfer.

Adenovirus-mediated gene therapy has some problems in clinical settings.28, 29, 30 The main problems are considered to be poor induction of target genes in clinical settings and poor penetration within tumors compared with those expected based on laboratory experiments.31 In this study, we found that GEM enhanced the expression levels of transgenes within tumors in vivo as well as in vitro. We earlier reported that Ad-NK4 combined with GEM suppressed the growth and metastasis of human pancreatic cancer cells implanted orthotopically into nude mice.11 In the study, we did not examine the detailed mechanism of the enhanced suppression of tumor growth and metastasis, because we considered that the suppression effect of the combination therapy was simply induced by the combined effects of GEM-mediated growth inhibition and NK4-mediated invasion inhibition. However, our earlier data also revealed remarkable inhibitory effects on the invasive potential of cells, such as tumor invasive growth and metastasis. Therefore, in this study, we focused on the effects of GEM on adenovirus-mediated expression of NK4, which inhibits cancer cell invasion.

The present data suggest that the remarkable inhibitory effects of the combination of GEM and Ad-NK4 may be partially due to GEM-enhanced expression of the NK4 transgene delivered by Ad-NK4. In addition, we found that adenovirus-mediated gene therapy might have other two advantages in clinical use when we use with GEM. One advantage is due to the cell killing effect of GEM. We found that GEM-treated mice did not show any significant increases in intratumoral NK4 expression at 3 days after the first administration of GEM and Ad-NK4, but showed significant increases in its expression compared with untreated mice after the second administration. These findings suggest that Ad-NK4 functions more effectively after treatment with GEM than during simultaneous treatment with GEM. Nagano et al.31 reported that cancer cell death enhances the penetration and efficacy of oncolytic adenoviruses in tumors.32 Therefore, pretreatment with GEM may be advantageous for improving the effects of adenoviral vectors in vivo. The other advantage is that we can reduce the doses of adenovirus administered when we use with GEM. Some studies have reported that the reduction of the amount of adenovirus decreased the risks of adenovirus-related side effects such as hepatotoxicity.33 In this study, we found that even low doses of GEM enhanced adenovirus-mediated NK4 expression. Therefore, when we use adenovirus with low doses of GEM, we can decrease the side effects of both treatments while maintaining the antitumor effect of adenovirus gene therapy, especially for the patients suffering from fatal diseases such as advanced pancreatic cancer.

In conclusion, the present data suggest that GEM enhances the effects of adenovirus-mediated gene therapy partially through enhancement of CMV promoter activity. Therefore, adenovirus-mediated gene therapy with GEM may be a promising approach for advanced pancreatic cancer, and this combination therapy may be a tolerable and suitable treatment for the patients of advanced pancreatic cancer.

References

  1. 1

    Ghaneh P, Costello E, Neoptolemos JP . Biology and management of pancreatic cancer. Gut 2007; 56: 1134–1152.

  2. 2

    Tanaka T, Ikeda M, Okusaka T, Ueno H, Morizane C, Hagihara A et al. Prognostic factors in Japanese patients with advanced pancreatic cancer treated with single-agent gemcitabine as first-line therapy. Jpn J Clin Oncol 2008; 38: 755–761.

  3. 3

    Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ . Cancer statistics, 2007. CA Cancer J Clin 2007; 57: 43–66.

  4. 4

    Sener SF, Fremgen A, Menck HR, Winchester DP . Pancreatic cancer: a report of treatment and survival trends for 100,313 patients diagnosed from 1985–1995, using the national cancer database. J Am Coll Surg 1999; 189: 1–7.

  5. 5

    Mancuso A, Calabro F, Sternberg CN . Current therapies and advances in the treatment of pancreatic cancer. Crit Rev Oncol Hematol 2006; 58: 231–241.

  6. 6

    Kang SP, Saif MW . Pharmacogenomics and pancreatic cancer treatment. Optimizing current therapy and individualizing future therapy. JOP 2008; 9: 251–266.

  7. 7

    Bhattacharyya M, Lemoine NR . Gene therapy developments for pancreatic cancer. Best Pract Res Clin Gastroenterol 2006; 20: 285–298.

  8. 8

    St George JA . Gene therapy progress and prospects: adenoviral vectors. Gene Ther 2003; 10: 1135–1141.

  9. 9

    Crystal RG . Transfer of genes to humans: early lessons and obstacles to success. Science 1995; 270: 404–410.

  10. 10

    Maehara N, Nagai E, Mizumoto K, Sato N, Matsumoto K, Nakamura T et al. Gene transduction of NK4, HGF antagonist, inhibits in vitro invasion and in vivo growth of human pancreatic cancer. Clin Exp Metastasis 2002; 19: 417–426.

  11. 11

    Ogura Y, Mizumoto K, Nagai E, Murakami M, Inadome N, Saimura M et al. Peritumoral injection of adenovirus vector expressing NK4 combined with gemcitabine treatment suppresses growth and metastasis of human pancreatic cancer cells implanted orthotopically in nude mice and prolongs survival. Cancer Gene Ther 2006; 13: 520–529.

  12. 12

    Egami T, Ohuchida K, Mizumoto K, Onimaru M, Toma H, Nishio S et al. Radiation enhances adenoviral gene therapy in pancreatic cancer via activation of cytomegalovirus promoter and increased adenovirus uptake. Clin Cancer Res 2008; 14: 1859–1867.

  13. 13

    Svensson RU, Barnes JM, Rokhlin OW, Cohen MB, Henry MD . Chemotherapeutic agents up-regulate the cytomegalovirus promoter: implications for bioluminescence imaging of tumor response to therapy. Cancer Res 2007; 67: 10445–10454.

  14. 14

    Kim KI, Kang JH, Chung JK, Lee YJ, Jeong JM, Lee DS et al. Doxorubicin enhances the expression of transgene under control of the CMV promoter in anaplastic thyroid carcinoma cells. J Nucl Med 2007; 48: 1553–1561.

  15. 15

    Vereecque R, Saudemont A, Wickham TJ, Gonzalez R, Hetuin D, Fenaux P et al. Gamma-irradiation enhances transgene expression in leukemic cells. Gene Ther 2003; 10: 227–233.

  16. 16

    Date K, Matsumoto K, Shimura H, Tanaka M, Nakamura T . HGF/NK4 is a specific antagonist for pleiotrophic actions of hepatocyte growth factor. FEBS Lett 1997; 420: 1–6.

  17. 17

    Maemondo M, Narumi K, Saijo Y, Usui K, Tahara M, Tazawa R et al. Targeting angiogenesis and HGF function using an adenoviral vector expressing the HGF antagonist NK4 for cancer therapy. Mol Ther 2002; 5: 177–185.

  18. 18

    Korst RJ, Bewig B, Crystal RG . In vitro and in vivo transfer and expression of human surfactant SP-A- and SP-B-associated protein cDNAs mediated by replication-deficient, recombinant adenoviral vectors. Hum Gene Ther 1995; 6: 277–287.

  19. 19

    Ohuchida K, Mizumoto K, Ogura Y, Ishikawa N, Nagai E, Yamaguchi K et al. Quantitative assessment of telomerase activity and human telomerase reverse transcriptase messenger RNA levels in pancreatic juice samples for the diagnosis of pancreatic cancer. Clin Cancer Res 2005; 11: 2285–2292.

  20. 20

    Zhang L, Mizumoto K, Sato N, Ogawa T, Kusumoto M, Niiyama H et al. Quantitative determination of apoptotic death in cultured human pancreatic cancer cells by propidium iodide and digitonin. Cancer Lett 1999; 142: 129–137.

  21. 21

    Sato N, Maehara N, Mizumoto K, Nagai E, Yasoshima T, Hirata K et al. Telomerase activity of cultured human pancreatic carcinoma cell lines correlates with their potential for migration and invasion. Cancer 2001; 91: 496–504.

  22. 22

    Date K, Matsumoto K, Kuba K, Shimura H, Tanaka M, Nakamura T . Inhibition of tumor growth and invasion by a four-kringle antagonist (HGF/NK4) for hepatocyte growth factor. Oncogene 1998; 17: 3045–3054.

  23. 23

    Das KC, White CW . Activation of NF-kappaB by antineoplastic agents. Role of protein kinase C. J Biol Chem 1997; 272: 14914–14920.

  24. 24

    Bruening W, Giasson B, Mushynski W, Durham HD . Activation of stress-activated MAP protein kinases up-regulates expression of transgenes driven by the cytomegalovirus immediate/early promoter. Nucleic Acids Res 1998; 26: 486–489.

  25. 25

    Lee Y, Sohn WJ, Kim DS, Kwon HJ . NF-kappaB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene enhancer/promoter in response to lipopolysaccharide and bacterial CpG-oligodeoxynucleotides in macrophage cell line RAW 264.7. Eur J Biochem 2004; 271: 1094–1105.

  26. 26

    Benedict CA, Angulo A, Patterson G, Ha S, Huang H, Messerle M et al. Neutrality of the canonical NF-kappaB-dependent pathway for human and murine cytomegalovirus transcription and replication in vitro. J Virol 2004; 78: 741–750.

  27. 27

    Sambucetti LC, Cherrington JM, Wilkinson GW, Mocarski ES . NF-kappa B activation of the cytomegalovirus enhancer is mediated by a viral transactivator and by T cell stimulation. EMBO J 1989; 8: 4251–4258.

  28. 28

    Alemany R, Balague C, Curiel DT . Replicative adenoviruses for cancer therapy. Nat Biotechnol 2000; 18: 723–727.

  29. 29

    Jain RK . Delivery of novel therapeutic agents in tumors: physiological barriers and strategies. J Natl Cancer Inst 1989; 81: 570–576.

  30. 30

    Yuan F . Transvascular drug delivery in solid tumors. Semin Radiat Oncol 1998; 8: 164–175.

  31. 31

    Nagano S, Perentes JY, Jain RK, Boucher Y . Cancer cell death enhances the penetration and efficacy of oncolytic herpes simplex virus in tumors. Cancer Res 2008; 68: 3795–3802.

  32. 32

    Yun CO . Overcoming the extracellular matrix barrier to improve intratumoral spread and therapeutic potential of oncolytic virotherapy. Curr Opin Mol Ther 2008; 10: 356–361.

  33. 33

    Yao X, Yoshioka Y, Eto Y, Morishige T, Okada Y, Mizuguchi H et al. TERT promoter-driven adenovirus vector for cancer gene therapy via systemic injection. Biochem Biophys Res Commun 2007; 362: 419–424.

Download references

Acknowledgements

We are grateful to Mrs Shoko Sadatomi for her outstanding technical support. This study was supported in part by a Grant-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

Author information

Correspondence to K Ohuchida or K Mizumoto.

Ethics declarations

Competing interests

The authors declare no conflict of interest.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Onimaru, M., Ohuchida, K., Egami, T. et al. Gemcitabine synergistically enhances the effect of adenovirus gene therapy through activation of the CMV promoter in pancreatic cancer cells. Cancer Gene Ther 17, 541–549 (2010). https://doi.org/10.1038/cgt.2010.9

Download citation

Keywords

  • gemcitabine
  • pancreatic cancer
  • CMV promoter
  • NK4

Further reading