Table 1: Primer sequence

From: IAPP modulates cellular autophagy, apoptosis, and extracellular matrix metabolism in human intervertebral disc cells

Name Primer Sequence Size
Homo b-actin Forward 5′- AGCGAGCATCCCCCAAAGTT-3′ 285 bp
  Reverse 5′- GGGCACGAAGGCTCATCATT-3′  
Homo IAPP Forward 5′- GCTACACCCATTGAAAGTC-3′ 102 bp
  Reverse 5′- GTTGTTGCTGGAATGAACT-3′  
Homo COL2A1 Forward 5′-A GAACTGGTGGAGCAGCAAGA-3′ 142 bp
  Reverse 5′- AGCAGGCGTAGGAAGGTCAT-3′  
Homo COL1A2 Forward 5′- GCGGTGGTGGTTATGACTTTGGT-3′ 176 bp
  Reverse 5′- TGTGCGAGCTGGGTTCTTTCTA-3′  
Homo Aggrecan Forward 5′- TGAGCGGCAGCACTTTGAC-3′ 287 bp
  Reverse 5′- TGAGTACAGGAGGCTTGAGG -3′  
Homo BG Forward 5′- AAGGGTCTCCAGCACCTCTAC-3′ 238 bp
  Reverse 5′- TCTCGATGCAGTTCATGTTCCGG-3′  
Homo casp3 Forward 5′- TGGTTCATCCAGTCGCTTTG-3′ 100 bp
  Reverse 5′- ATTCTGTTGCCACCTTTCG -3′  
Homo calcr Forward 5′- TGATTCATTTCCAGGGCTTCT-3′ 240 bp
  Reverse 5′- TCTCCTCGCCTTGGTTGTT-3′  
Homo bcl2 Forward 5′- TGGTGGAGGAGCTCTT-3′ 152 bp
  Reverse 5′- CCGGTTCAGGTACTCAGTCATC-3′  
Homo bax Forward 5′- TCTGACGGCAACTTCAACTG-3′ 188 bp
  Reverse 5′- TTGAGGAGTCTCACCCAACC-3′  
Homo beclin1 Forward 5′- CAATGGTGGCTTTCCTGGAC-3′ 186 bp
  Reverse 5′- TGAGAGCTTTTGTCCACTGCT-3′  
Homo atg7 Forward 5′- GGTCAAAGGACGAAGATAACA-3′ 148 bp
  Reverse 5′- GGTCACGGAAGCAAACAACT-3′  
Homo atg5 Forward 5′-CACAAGCAACTCTGGATGGGATT-3′ 248 bp
  Reverse 5′- CCATCTTCAGGATCAATAGCAG-3′  
Homo RAMP1 Forward 5′- AATGCAGAGGTGGACAGGTT-3′ 119 bp
  Reverse 5′- ACCACGATGAAGGGGTAGAGG-3′  
Homo RAMP2 Forward 5′-AGAGTTGTTTGACCTGGGCTTCC-3′ 212 bp
  Reverse 5′-CCTGGGCCTCACTGTCTTTAC-3′  
Homo RAMP3 Forward 5′-TTCGCAGACATGATGGGCAAGGT-3′ 258 bp
  Reverse 5′-CAGAACGACGGGTATAACGATCAG-3′  
Homo IL1b Forward 5′- ATGGCTTATTACAGTGGCA-3′ 139 bp
  Reverse 5′- TGTAGTGGTGGTCGGAGA-3′  
Homo TNF-a Forward 5′- GCCTGTAGCCCATGTTGTAGCA-3′ 163 bp
  Reverse 5′- CTTGAAGAGGACCTGGGAGTAG-3′