Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Apolipoprotein D is associated with long-term outcome in patients with schizophrenia

Abstract

Accumulating evidence implicates deficiencies in apolipoprotein D (ApoD) function and arachidonic acid signaling in schizophrenic disorders. We addressed two hypotheses in relation to ApoD: first, polymorphisms in the ApoD gene confer susceptibility to or are markers of disease, and, second, genetic variation in the ApoD is associated with long-term clinical outcome to antipsychotic treatment. We genotyped two single-nucleotide polymorphisms in the ApoD gene in 343 chronic patients with schizophrenia spectrum disorders (ICD-10) and 346 control subjects of Danish origin. We did not find ApoD alleles, genotypes or haplotypes to be associated with disease. However, we did find that long-term clinical outcome was associated with the ApoD polymorphism rs7659 (P=0.041) following adjustment for lifetime clinical global impression, age at first admission and gender.

Introduction

A substantial body of evidence has implicated dysfunction of the fatty acid and phospholipid pathways in psychiatric diseases.1, 2 Numerous studies have examined lipid-carrying and -recruiting proteins expressed in the brain as possible risk factors of schizophrenia. Recently, several studies have shown brain content of these proteins to be altered in schizophrenia.3 The causal relation between brain lipids and the development of schizophrenia is unknown, but membrane proteins – and thus the membrane-associated receptors affected in this disease – are generally regulated by the lipid composition of the surrounding lipid bilayer.4, 5

Apolipoprotein D (ApoD) is such a lipid carrier protein, initially found as a component of high-density lipoproteins in human plasma, in complex with apolipoprotein A-II, and subsequently shown to be highly expressed in the brain.6, 7 Although the function of ApoD is not fully understood, it is known to bind and transport cholesterol,8 steroid hormones9, 10 and arachidonic acid (AA).3, 11, 12, 13 ApoD is structurally similar to the plasma-retinol-binding protein and other members of the alpha-2 microglobulin family.14, 15 Sequence analyses places ApoD as a member of the ancient lipocalin superfamily with no marked similarity to other and more extensively studied apolipoproteins, such as ApoE associated with Alzheimer's disease.16

Like other lipocalins, ApoD is associated with pathological conditions, including developmental and degenerative processes in the brain. For example, elevated plasma levels of ApoD have been found in the brain and cerebrospinal fluid in patients suffering from Alzheimer's disease.17, 18 Similarly, ApoD has been implicated in psychiatric illnesses, where elevated levels of ApoD have been detected in plasma from drug-naive schizophrenic patients.19 Furthermore, analyses of post-mortem brains documented increased expression levels of ApoD in patients with bipolar disorder and schizophrenia.20 Interestingly, the regional patterns of increased ApoD expression differed between the two patient categories (bipolar and schizophrenia), suggesting that ApoD may be a disease marker.21, 22

The notion that ApoD might be implicated in schizophrenia has gained support from expression analyses in rodents demonstrating that antipsychotic drugs regulate ApoD expression in plasma and the brain.23 Interestingly, the atypical antipsychotic clozapine increases ApoD levels in several brain regions both during acute and chronic administration of the drug, whereas the typical antipsychotic drug haloperidol appears to reduce ApoD expression.24 Hence, animal studies suggest that regulation of ApoD might be an important factor relating to the distinct therapeutic effects of antipsychotic medication.19 If so, genetically influenced treatment outcome in psychotic patients (reviewed in Mancama et al.21) might, in part, be defined by gene variants affecting ApoD expression or activity.

The gene encoding ApoD is located on chromosome 3q26.2, a region tightly linked to schizophrenia in genome-scan meta-analysis,25 and is thus consistent with the involvement of ApoD in the etiology of schizophrenia. Further genetic support of an involvement of ApoD in developmental and degenerative brain diseases is provided by the finding that a potential regulatory polymorphism in the ApoD gene is associated with Alzheimer's disease in an Afro-American sample, although the associated polymorphisms are not present in Caucasians.26

In order to clarify the role of ApoD in schizophrenia, we assessed two hypotheses: first, polymorphisms in the ApoD gene confer susceptibility to schizophrenia, and, second, such polymorphisms are associated with long-term clinical outcome of antipsychotic treatment.

Materials and methods

Subjects and characteristics

This study included 343 schizophrenic in- and outpatients, who had previously been recruited to the Danish Psychiatric Biobank from psychiatric departments at the five hospitals in the Copenhagen area. All patients had a history of psychotic illness (average=13.1 (±8.9) years of treatment since first contact to psychiatric care), and had been clinically diagnosed with schizophrenia (F20, F22 or F25) according to the ICD-10 criteria. The reliability of the clinical diagnoses was confirmed in 100 of these patients by an experienced consultant psychiatrist (KDJ) using the semistructured interview of the OPCRIT instrument27 (positive predictive value >98%).28

Also included in the study were 346 unrelated, anonymous blood donors serving as healthy control subjects. Patients (137 females and 206 males) and controls (139 females and 207 males) were not different with respect to sex ratio (P=0.90), whereas the mean age of patients (42.2±12.1 years) was slightly lower than in the control sample (49.7±12.8 years). Both samples were ethnically highly homogeneous. Most patients (87%) were ethnically Danish (i.e. patient and both parents were born in Denmark), whereas in a minor fraction of cases (13%), one parent was born outside Denmark in another northwestern European country. The healthy control subjects were also Danish and recruited from the same geographical area of Greater Copenhagen as the patients.

Key anamnestic, epidemiological and clinical variables were obtained through a review of case records and hospital discard registers by an experienced consultant psychiatrist (AGW). Estimates were obtained for age at first admission (AFA; n=308), clinical global impression (lifetime CGI29; rated as 1–4 or 5–7; n=227), substance abuse (clinically relevant, consistent with an ICD-10 diagnosis of F1X.2; n=308) and suicidal behavior (presence/absence of documented suicidal attempts; n=228). Long-term outcome was estimated based on medical history of 308 patients. Owing to the extensive time period that elapsed since the first hospital admission, we defined operational criteria of long-term clinical outcome as follows: Good outcome patients were defined as subjects in long-term pharmacotherapy with traditional or atypical antipsychotics and with a satisfactory clinical outcome. Poor outcome patients were defined as individuals (previously treated with standard antipsychotics without satisfactory clinical outcome) in long-term clozapine therapy. The definition of these criteria for long-term outcome status was based on the treatment guidelines from Danish10 and American30 psychiatric associations, which state that clozapine is a late treatment option allowed only in hard-to-treat or treatment-resistant schizophrenic patients. Thus, the responsible clinician has established that the patient has not responded clinically satisfactorily to several distinct classes of antipsychotics in adequate doses, before shifting the patient onto clozapine. Patients who were treated with clozapine owing to side effects from standard antipsychotics and patients in whom clozapine treatment had been discontinued owing to side effects were excluded from the study.

The two long-term outcome groups did not differ with respect to recruiting hospital (P=0.071), gender (P=0.64), age (P=0.16), substance abuse (P=0.53) or suicidal behavior (P=0.055). AFA was significantly lower in the poor outcome group than in individuals with good clinical outcome (P=0.007), as was the CGI score (P<0.0001). These findings confirm the well-established epidemiological knowledge that early onset of illness and a poor CGI score are predictors of poor long-term clinical outcome and thus validate the operational criteria that we have used in this study.31

Ethics

The study was approved by the Danish Scientific–Ethical Committees and the Danish Data Protection Agency. All patients had given written informed consent before inclusion into the project.

Genotyping

The single-nucleotide polymorphisms (SNPs) markers were selected from the NCBI SNP database applying a minor frequency cutoff of 0.2. Two SNPs spanning 4.5 kb of the 5′-end of the ApoD gene fulfilled these criteria in white Caucasians. The relative short distance between SNPs was chosen to evaluate linkage disequilibrium (LD) for the region, which is not available in public databases. The first SNP, rs7659, was positioned in the 3′-untranslated region of the ApoD gene, and was found to be situated in a putative binding site for the human splice factor SR SC35 (SFRS2).32 The second SNP, rs1464505, was located in the 3rd intron and selected in order to span the 3′ portion of the ApoD gene. Other SNPs, as mentioned earlier, have previously been examined in relation to Alzheimer's disease and speculated to be associated with schizophrenia,26 but these polymorphisms have not been detected in Caucasians . An additional SNP located in exon's of the ApoD gene had frequencies below 0.1 and was therefore not assessed in this study.

Total genomic DNA was extracted from venous blood. A TaqMan® system from Applied Biosystems (Foster City, CA, USA) was used to genotype the two SNPs situated in the 3′-untranslated region (rs14644505) and intron 3 (rs7659). The former of these two SNPs was genotyped by Assay-on-Demand® reagents, whereas the analysis of the other was carried out by Assay-by-Design®, using the following primers: forward: gtgtacatttctattactgagggcttct; reverse: ggtgggtaggaaggagctctt; and the probe FAM/VIC: ctttttggatt[a/t]attattg.

Statistical analysis

Chi-square (χ2) analysis was used to assess whether the distribution of genotypes in the control sample corresponded to those expected under conditions of Hardy–Weinberg proportions (HWP) and to compare distributions of genotypes, alleles and haplotypes between study groups. Yates corrections were used whenever appropriate. An EM algorithm was used to estimate the haplotype frequencies, and the extent of LD was determined by calculation of D′ and r2.33 Long-term outcome patient groups were compared by ANOVA analysis and stepwise logistic regression using SYSTAT® (Systat Software Inc., Point Richmound, CA, USA) including P-value of 0.15. To test the goodness of fit of our disease model, we used the program provided by Wittke-Thompson et al.34

Results

The genotype counts and corresponding allele frequencies of the ApoD polymorphisms, rs7659 and rs1464505, are given in Table 1. The allele frequencies among control and schizophrenic subjects of both markers did not deviate significantly from those previously reported in Caucasians and other populations.35 Both polymorphisms were found to be in HWP in the control sample. rs7659 deviated marginally from HWP in the schizophrenic sample (P=0.049).

Table 1 Disease and outcome status vs ApoD genotypes and allelesa

The HWP in the patient group could potentially produce a spurious genotype–disease association owing to genotyping errors, and chance or failure to meet HWP prerequisites. However, a goodness-of-fit test34 was used to challenge this hypothesis and show that the observed departure from HWP was compatible with an underlying genetic model of disease transmission (χ2=1.14, df=1, P=0.29). Furthermore, neither the rs7659 genotype nor allele frequencies were significantly different between control and schizophrenic subjects (Table 1).

A maximum-likelihood procedure was used to estimate the frequencies of haplotype phases of the polymorphic sites in the control and patient samples. LD was found between the two loci (χ2=0.895, df=3, P=0.83; D′=0.66 and r2=0.63), and no significant association was detected between haplotypes and disease status (P=0.95; Table 2). These findings do not provide evidence to support our first hypothesis that ApoD is associated with schizophrenia as such.

Table 2 Disease and outcome status vs two-loci haplotypea (rs7659–rs1464505)

In order to challenge the second hypothesis, that is, polymorphisms are associated with long-term clinical outcome of antipsychotic treatment, 308 patients were stratified according to their long-term clinical outcome (see also Materials and methods for details). Both polymorphisms were in HWP in both long-term outcome groups. The initial analysis of the genotype, allele and haplotype frequencies did not show any statistically significant differences across controls and the two outcome categories of schizophrenic patients (Tables 1 and 2). However, several epidemiological and clinical variables are known to affect long-term outcome and could obscure a putative genetic effect. We therefore performed a forward logistic regression analysis using the demographic and clinical variables described in Materials and methods. CGI, AFA and gender remained in the final model, with CGI being most strongly associated with long-term outcome as shown in Table 3. Interestingly, the rs7659 locus was also included in the model in a manner indicating a recessive effect (OR0.4 for both AA and AG genotypes with respect to the GG genotype; Table 3). Further analysis, in which these two genotypes were combined, supported this notion (AA/AG vs GG: OR0.4, P=0.041; Table 3).

Table 3 Multivariate logistic regression analysis of risk factors for long-term outcomea

Discussion

This study was designed to assess the potential importance of ApoD in schizophrenia spectrum disorders, challenging the hypotheses that alterations in ApoD activity may be related to disease status or long-term outcome.

We failed to provide evidence for the first hypothesis, as the SNP genotype, allele frequencies and the haplotype did not translate into an association with the disease or long-term outcome. This might raise concern for the validity of the operational criteria applied in this study to estimate long-term outcome. However, both the clinical CGI rating and the demographic estimate of age at onset (AFA) are strongly correlated to long-term outcome, confirming the usefulness of this assessment.

This also raised the possibility that differences in CGI or AFA might be used to fine-tune the long-term outcome estimate and uncover a putative association with the genotype. In fact, once these variables are included in a multivariate analysis, the GG genotype at the rs7659 locus does indeed confer risk of poor long-term outcome. In light of effect sizes of well-established genetic risk factors in complex disorders, the OR (2.5) of the ApoD GG genotype represents quite a considerable risk of poor long-term outcome.

We cannot exclude that the signal detected in this study may originate from a nearby functional polymorphism in LD with this ApoD genotype. However, the rs7659 polymorphism is positioned in a putative binding site for the human splicing factor SR SC35 (T Hansen, unpublished observation) and may therefore itself affect processing of the ApoD mRNA and give rise to genotype-specific ApoD activities. This argues that ApoD is involved in the pathology of schizophrenia either as a factor conferring increased risk of illness with poor long-term outcome or as a modulating factor affecting the responsiveness of otherwise identical disease entities.

In summary, our analyses did not indicate that ApoD genotypes were differentially distributed between healthy controls and each of the two disease groups, implying that ApoD does not define an etiologically distinct disease entity of refractory schizophrenia, but rather affects the regulatory potential of antipsychotics in the patient. Thus, it would be highly interesting to compare long-term clinical outcome and ApoD response to antipsychotic treatment in chronic patients. If acute changes in ApoD level are indeed indicative of therapeutic response, one may speculate that monitoring of ApoD may be used to guide pharmacotherapy even in recent onset patients.

Duality of interest

None declared.

References

  1. Mahadik SP, Evans DR . Is schizophrenia a metabolic brain disorder? Membrane phospholipid dysregulation and its therapeutic implications. Psychiatr Clin N Am 2003; 26: 85–102.

    Article  Google Scholar 

  2. Thomas EA, Copolov DL, Sutcliffe JG . From pharmacotherapy to pathophysiology: emerging mechanisms of apolipoprotein D in psychiatric disorders. Curr Mol Med 2003; 3: 408–418.

    CAS  Article  Google Scholar 

  3. Skosnik PD, Yao JK . From membrane phospholipid defects to altered neurotransmission: is arachidonic acid a nexus in the pathophysiology of schizophrenia? Prostaglandins Leukot Essent Fatty Acids 2003; 69: 367–384.

    CAS  Article  Google Scholar 

  4. Lundbaek JA, Andersen OS, Werge T, Nielsen C . Cholesterol-induced protein sorting: an analysis of energetic feasibility. Biophys J 2003; 84: 2080–2089.

    CAS  Article  Google Scholar 

  5. Lundbaek JA, Birn P, Hansen AJ, Sogaard R, Nielsen C, Girshman J et al. Regulation of sodium channel function by bilayer elasticity: the importance of hydrophobic coupling. Effects of Micelle-forming amphiphiles and cholesterol. J Gen Physiol 2004; 123: 599–621.

    CAS  Article  Google Scholar 

  6. Dilley WG, Haagensen DE, Cox CE, Wells Jr SA . Immunologic and steroid binding properties of the GCDFP-24 protein isolated from human breast gross cystic disease fluid. Breast Cancer Res Treat 1990; 16: 253–260.

    CAS  Article  Google Scholar 

  7. Drayna D, Fielding C, McLean J, Baer B, Castro G, Chen E et al. Cloning and expression of human apolipoprotein D cDNA. J Biol Chem 1986; 261: 16535–16539.

    CAS  PubMed  Google Scholar 

  8. Francone OL, Gurakar A, Fielding C . Distribution and functions of lecithin:cholesterol acyltransferase and cholesteryl ester transfer protein in plasma lipoproteins. Evidence for a functional unit containing these activities together with apolipoproteins A-I and D that catalyzes the esterification and transfer of cell-derived cholesterol. J Biol Chem 1989; 264: 7066–7072.

    CAS  PubMed  Google Scholar 

  9. Simard J, Veilleux R, de Launoit Y, Haagensen DE, Labrie F . Stimulation of apolipoprotein D secretion by steroids coincides with inhibition of cell proliferation in human LNCaP prostate cancer cells. Cancer Res 1991; 51: 4336–4341.

    CAS  PubMed  Google Scholar 

  10. Glenthoej B, Gerlach J, Licht R, Gulmann N, Joergensen O . Clearing rapport no.5 treatment with antispychotics. Recommended guidelines. Klarings rapport no. 5. Behandlings med Antopsykotika. Vejledende retningslinier. Danish Psychiatric Association, 1998.

  11. Morais Cabral JH, Atkins GL, Sanchez LM, Lopez-Boado YS, Lopez-Otin C, Sawyer L . Arachidonic acid binds to apolipoprotein D: implications for the protein's function. FEBS Lett 1995; 366: 53–56.

    CAS  Article  Google Scholar 

  12. Thomas EA, George RC, Sutcliffe JG . Apolipoprotein D modulates arachidonic acid signaling in cultured cells: implications for psychiatric disorders. Prostaglandins Leukot Essent Fatty Acids 2003; 69: 421–427.

    CAS  Article  Google Scholar 

  13. Yao JK, Thomas EA, Reddy RD, Keshavan MS . Association of plasma apolipoproteins D with RBC membrane arachidonic acid levels in schizophrenia. Schizophr Res 2005; 72: 259–266.

    Article  Google Scholar 

  14. Rassart E, Bedirian A, Do CS, Guinard O, Sirois J, Terrisse L et al. Apolipoprotein D. Biochim Biophys Acta 2000; 1482: 185–198.

    CAS  Article  Google Scholar 

  15. Yang CY, Gu ZW, Blanco-Vaca F, Gaskell SJ, Yang M, Massey JB et al. Structure of human apolipoprotein D: locations of the intermolecular and intramolecular disulfide links. Biochemistry 1994; 33: 12451–12455.

    CAS  Article  Google Scholar 

  16. Sanchez D, Ganfornina MD, Gutierrez G, Marin A . Exon–intron structure and evolution of the Lipocalin gene family. Mol Biol Evol 2003; 20: 775–783.

    CAS  Article  Google Scholar 

  17. Terrisse L, Poirier J, Bertrand P, Merched A, Visvikis S, Siest G et al. Increased levels of apolipoprotein D in cerebrospinal fluid and hippocampus of Alzheimer's patients. J Neurochem 1998; 71: 1643–1650.

    CAS  Article  Google Scholar 

  18. Navarro A, Del Valle E, Astudillo A, Gonzalez dR, Tolivia J . Immunohistochemical study of distribution of apolipoproteins E and D in human cerebral beta amyloid deposits. Exp Neurol 2003; 184: 697–704.

    CAS  Article  Google Scholar 

  19. Mahadik SP, Khan MM, Evans DR, Parikh VV . Elevated plasma level of apolipoprotein D in schizophrenia and its treatment and outcome. Schizophr Res 2002; 58: 55–62.

    Article  Google Scholar 

  20. Thomas EA, Dean B, Pavey G, Sutcliffe JG . Increased CNS levels of apolipoprotein D in schizophrenic and bipolar subjects: implications for the pathophysiology of psychiatric disorders. Proc Natl Acad Sci USA 2001; 98: 4066–4071.

    CAS  Article  Google Scholar 

  21. Mancama D, Arranz MJ, Kerwin RW . Genetic predictors of therapeutic response to clozapine: current status of research. CNS Drugs 2002; 16: 317–324.

    CAS  Article  Google Scholar 

  22. Masellis M, Basile VS, Ozdemir V, Meltzer HY, Macciardi FM, Kennedy JL . Pharmacogenetics of antipsychotic treatment: lessons learned from clozapine. Biol Psychiatry 2000; 47: 252–266.

    CAS  Article  Google Scholar 

  23. Thomas EA, Danielson PE, Nelson PA, Pribyl TM, Hilbush BS, Hasel KW et al. Clozapine increases apolipoprotein D expression in rodent brain: towards a mechanism for neuroleptic pharmacotherapy. J Neurochem 2001; 76: 789–796.

    CAS  Article  Google Scholar 

  24. Khan MM, Parikh VV, Mahadik SP . Antipsychotic drugs differentially modulate apolipoprotein D in rat brain. J Neurochem 2003; 86: 1089–1100.

    CAS  Article  Google Scholar 

  25. Lewis CM, Levinson DF, Wise LH, DeLisi LE, Straub RE, Hovatta I et al. Genome scan meta-analysis of schizophrenia and bipolar disorder, part II: Schizophrenia. Am J Hum Genet 2003; 73: 34–48.

    CAS  Article  Google Scholar 

  26. Desai PP, Hendrie HC, Evans RM, Murrell JR, DeKosky ST, Kamboh MI . Genetic variation in apolipoprotein D affects the risk of Alzheimer disease in African-Americans. Am J Med Genet 2003; 116B: 98–101.

    Article  Google Scholar 

  27. McGuffin P, Farmer A, Harvey I . A polydiagnostic application of operational criteria in studies of psychotic illness. Development and reliability of the OPCRIT system. Arch Gen Psychiatry 1991; 48: 764–770.

    CAS  Article  Google Scholar 

  28. Jakobsen KD, Frederiksen JN, Hansen T, Jansson LB, Parnas J, Werge T . Reliability of clinical ICD-10 schizophrenia diagnoses. Nordic J Psychiatry 2005; 59: 209–212.

    Article  Google Scholar 

  29. Haro JM, Kamath SA, Ochoa S, Novick D, Rele K, Fargas A et al. The Clinical Global Impression-Schizophrenia scale: a simple instrument to measure the diversity of symptoms present in schizophrenia. Acta Psychiatr Scand Suppl 2003; 416: 16–23.

    Article  Google Scholar 

  30. American Psychiatric Association. Treatment Guidelines. www.Psych Org/Psych_Pract/Treatg/ 2005.

  31. Meltzer HY, Rabinowitz J, Lee MA, Cola PA, Ranjan R, Findling RL et al. Age at onset and gender of schizophrenic patients in relation to neuroleptic resistance. Am J Psychiatry 1997; 154: 475–482.

    CAS  Article  Google Scholar 

  32. Liu HX, Chew SL, Cartegni L, Zhang MQ, Krainer AR . Exonic splicing enhancer motif recognized by human SC35 under splicing conditions. Mol Cell Biol 2000; 20: 1063–1071.

    CAS  Article  Google Scholar 

  33. Tregouet DA, Escolano S, Tiret L, Mallet A, Golmard JL . A new algorithm for haplotype-based association analysis: the stochastic-EM algorithm. Ann Hum Genet 2004; 68 (Part 2): 165–177.

    CAS  Article  Google Scholar 

  34. Wittke-Thompson JK, Pluzhnikov A, Cox NJ . Rational inferences about departures from Hardy–Weinberg equilibrium. Am J Hum Genet 2005; 76: 967–986.

    CAS  Article  Google Scholar 

  35. Packer BR, Yeager M, Staats B, Welch R, Crenshaw A, Kiley M et al. SNP500Cancer: a public resource for sequence validation and assay development for genetic variation in candidate genes. Nucleic Acids Res 2004; 32: D528–D532.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We thank patients who participated in the Danish Psychiatric Biobank and made this study possible. We also acknowledge the help of numerous mental health professionals in the various clinical departments and research technicians. This study was financed through grant to TW from the Danish Research Agency under the Center for Pharmacogenomics and the Danish Psychiatric Research Foundation.

Author information

Affiliations

Authors

Corresponding author

Correspondence to T Werge.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Hansen, T., Hemmingsen, R., Wang, A. et al. Apolipoprotein D is associated with long-term outcome in patients with schizophrenia. Pharmacogenomics J 6, 120–125 (2006). https://doi.org/10.1038/sj.tpj.6500350

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/sj.tpj.6500350

Keywords

  • long-term outcome
  • chronic schizophrenia
  • clozapine
  • treatment refractory
  • lipid metabolism
  • neurodegeneration

Further reading

Search

Quick links