Table 1 Gene positions and PCR primer and probe sequences for nine SNPs genoytped in the SDF-1 gene

From: Haplotype analysis of the SDF-1 (CXCL12) gene in a longitudinal HIV-1/AIDS cohort study

dbSNP Position relative to ATG codon Chromosome 10 position   Inter-SNP distance (bp) Genotyping assay PCR primer sequences Taq-Man (T-M) probe sequences
rs754618 −5753, promoter 44206212   T–M TGGTAGTCCGACAGTC VIC-CCAACTGTGCTATTG
       TGGTAGTCCGACAGTC FAM-ACCAACTATGCTATTGTG
rs17156287 −541, 5′ UTR 44201000   5212 T–M ACCCCCTCGGTTGCCTT VIC-CCACCGCCAGCAG
       ATGAGAACCAATGAAAAGCAAACA FAM-CCACCGCGAGCAG
ss46566436 +4615, intron 2 44195845   5155 T–M Assay on demand, ABI Assay on demand, ABI
rs2839693 +5887, intron 2 44194573   1272 KpnI RFLP CTTCCTCATGCCCATCCTTA None
       GGGGTCATCAAAGCATACAGA  
rs266085 +6201, intron 2 44194259   314 BslI RFLP GCAATGGAACTTCCTGCACT None
       TGTGAAAACAGAATGGCAACA  
rs2297630 +8906, intron 3 44191554   2705 T–M Assay on demand, ABI Assay on demand, ABI
rs1801157 +12 197,3′ UTR 44188263   3291 MspI RFLP CTGGGCAAAGCCTAGTGAAG None
       AGGGCTGGGTCTCACTCTG  
rs2522 +13 150, 3′UTR 44187310   953 T–M GCCACTTAAAATGTTCACTTTTGACA VIC-AGCACTTGTGGGTTT
       GGGCAAAAGTATTCGTAAGACTGAA FAM-AAGCACTTGCGGGTT
rs1065297 +14 478, 3′ UTR 44185982   1328 HinfI RFLP GAATTTGAGTGCTCTGATCCCTCTA None
    Total 20 230   GGGATTTGGAAGTTTCTAGGGAAT