Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells

Abstract

Mutation of the XRCC4 gene in mammalian cells1,2 prevents the formation of the signal and coding joints in the V(D)J recombination reaction3, which is necessary for production of a functional immunoglobulin gene, and renders the cells highly sensitive to ionizing radiation4. However, XRCC4 shares no sequence homology with other proteins, nor does it have a biochemical activity to indicate what its function might be2. Here we show that DNA ligase IV (ref. 5) co-immunoprecipitates with XRCC4 and that these two proteins specifically interact with one another in a yeast two-hybrid system. Ligation of DNA double-strand breaks in a cell-free system by DNA ligase IV is increased fivefold by purified XRCC4 and seven- to eightfold when XRCC4 is co-expressed with DNA ligase IV. We conclude that the biological consequences of mutating XRCC4 are primarily due to the loss of its stimulatory effect on DNA ligase IV: the function of the XRCC4–DNA ligase IV complex may be to carry out the final steps of V(D)J recombination and joining of DNA ends.

Main

We immunoprecipitated XRCC4 from mammalian cells in order to identify factors that might be associated with it. We used the XRCC4-deficient Chinese hamster ovary cell line XR-1 (ref. 1), which has been stably transfected with an expression vector encoding human XRCC4 fused to a 9× histidine tag and a 3× Myc epitope at the carboxy terminus. The tagged XRCC4 protein was detectable by anti-Myc western blotting as a double band, with the apparent relative molecular mass (Mr) of each band being 60K and 65K (Fig.1). The existence of a double band of this size for XRCC4 suggests that there must be extensive post-translational modification, because the calculated Mr of the tagged XRCC4 protein is 44K. Four different stable XRCC4 transfectants showed full reconstitution to wild-type V(D)J recombination (not shown) and resistance to X-rays (Fig. 1), indicating that human XRCC4 complementary DNA functionally compensates for the deleted hamster XRCC4 gene.

Figure 1: Functional characterization of stable XRCC4 transfectants.
figure 1

Stable XRCC4–His9/Myc3 transfectants were generated in the CHO cell line XR-1, which is deficient for XRCC4 (ref. 2). X-ray sensitivity for four different stable XRCC4 transfectants (designated (TF) 1-1, 1–17, 3-2, 3-23) as well as the wild-type parental cell line of XR-1, 4364A, are shown. Expression of the stably transfected XRCC4 protein assayed by anti-Myc western blotting is shown in the insert.

Immunoprecipitation of each of the four stable XRCC4 transfectants gave a protein band of Mr 95K that co-immunoprecipitated with epitope-tagged XRCC4 protein (Fig. 2: XAP is XRCC4-associated protein). This XAP band was not co-immunoprecipitated using XR-1 cell lysates or other His/Myc tagged proteins (such as Rag-1 and -2; data not shown). The XRCC4/XAP protein complex remained stable up to a salt concentration of 1.2 M KCl, indicating that this protein–protein interaction was very stable.

Figure 2: Immunoprecipitation (IP) of epitope-tagged XRCC4.
figure 2

Preparative anti-Myc IPs from total cell lysates (108 cells per lane) using XR-1 and XRCC4 transfectant cell line 3-2. Immunoprecipitated proteins were visualized using SYPRO orange stain. IPs from XRCC4 transfectant cells show the 60K/65K XRCC4 protein bands and co-immunoprecipitate of one additional band, XAP, migrating at 95K. IP controls were carried out with an IgG1 control antibody (mAb MR5-2, specific for mouse TCR Vβ8). Bands migrating at 50K and 25K–30K are the heavy and light chains of the Myc mAb, respectively.

XAP was isolated from silver-stained gels and microsequenced as described6. The sequences of three tryptic peptides for XAP were determined, which unequivocally identified XAP as DNA ligase IV: one octapeptide originated from the amino terminus (amino acids 2–9), one octapeptide had an identical sequence to that between residues 447–454, and one nonapeptide was from the C-terminal tail (amino acids 771–779). Two of these three regions are not well conserved among ligases I, III and IV (ref. 5), and yet all 25 amino-acid residues were identical to the sequence of human DNA ligase IV, suggesting a high degree of homology between rodent and human DNA ligase IV. Single-strand-nick ligase activity was reproducibly detectable in immunoprecipitates from XRCC4-transfected cells but was absent in immunoprecipitates from XR-1 control cells (data not shown). This activity was independent of the addition of exogenous ATP, which is a feature of human DNA ligase IV (ref. 7).

We next tested whether the interaction between XRCC4 and DNA ligase IV could be reproduced in the yeast two-hybrid system. For this and all further experiments, human DNA ligase IV cDNA was cloned from Reh cDNA using the polymerase chain reaction (PCR). DNA ligase IV was found specifically to interact with XRCC4, but not with two selected control proteins (the 70K and 86K subunits of the DNA-end-binding Ku heterodimer8; Table 1). This finding independently demonstrates that DNA ligase IV interacts with XRCC4 and that this occurs in a eukaryotic cell nucleus.

Table 1 Interaction of XRCC4 with DNA-ligase IV in yeast two-hybrid system

All known eukaryotic DNA ligases form covalent AMP-enzyme adducts upon addition of ATP9. However, in contrast to other DNA ligases DNA ligase IV is pre-adenylated in mammalian cells7. To determine whether XRCC4 participates in this pre-adenylation, human DNA ligase IV was expressed as a His/Myc-tagged protein in XR-1 cells using a vaccinia virus overexpression system. Its adenylation in vitro was compared with that of endogenous DNA ligase IV in complex with XRCC4. Both the recombinant and endogenous ligases could be efficiently adenylated only after pretreatment with inorganic pyrophosphate (PPi), which strips the AMP–ligase adduct (Fig. 3). This indicates that recombinant DNA ligase IV is pre-adenylated as extensively as endogenous DNA ligase IV and that XRCC4 is therefore not needed for pre-adenylation of DNA ligase IV.

Figure 3: Adenylation of recombinant and endogenous DNA ligase IV.
figure 3

Recombinant, 9× His/3 × Myc-tagged human DNA ligase IV was transiently expressed in XR-1 cells using the vaccinia virus expression system. Endogenous DNA ligase IV was isolated by co-immunoprecipitation from stable XRCC4 transfectants. Both the endogenous and recombinant DNA ligase IVs were adenylated with [α-32P]ATP, either with or without pyrophosphate pre-treatment (±PPi, as indicated). In vitro adenylated commercial T4 DNA ligase was used as a positive control.

Purified human DNA ligase IV was previously believed to be able to seal only single-strand DNA breaks and not double-strand breaks7. Using an oligonucleotide-based intramolecular ligation assay (Fig. 4a), we tested the activity of the XRCC4–DNA ligase IV complex under different conditions. Nick-ligation activity (on single-strand breaks) was quite insensitive to variations in salt concentration, divalent cations or temperature. In contrast, duplex ligations required specific conditions that were optimal in 100 mM KCl at 37 °C with Mn2+ present (data not shown). Under these conditions, linearized plasmids with compatible ends could also be religated efficiently (data not shown). Duplex ligation by XRCC4–DNA ligase IV was detectable at blunt DNA ends, but was much more efficient at sticky ends (Fig. 4a). As the repair of DNA double-strand breaks frequently involves short regions of microhomology (as in V(D)J recombination10), our duplex ligation assay with compatible ends should mimic non-homologous DNA-end-joining events in vivo.

Figure 4: XRCC4 stimulates DNA ligase IV activity in vitro.
figure 4

a, DNA oligonucleotide substrates for blunt-end and compatible-end ligations were created by annealing a DNA 80-mer to two short oligomers that were complementary to each end of the long oligomer. One of the short oligomers was 5′-labelled (black dot), resulting in incorporation of the label upon ligation of the two double-stranded arms. Left, analysis by denaturing PAGE of serial 10-fold dilutions of T4 DNA ligase starting at 1U per reaction. Right, ligation with nicked (N), sticky-end (S) or blunt-end (B) substrates catalysed by either 5× 10−3 U T4 DNA ligase or DNA ligase IV/XRCC4 co-immunoprecipitated from 107XRCC4 transfectants. Lanes with no protein indicate the position of each substrate. b, Sticky-end ligation catalysed by DNA ligase IV alone (L4-MYC) or by DNA ligase IV in complex with XRCC4 (L4-MYC/X4-HA, and L4-MYC + rX4), analysed by denaturing PAGE. In one experiment, DNA ligase IV was expressed in XR-1 cells either in the absence (lanes 5–7) or presence (lanes 8–10) of the XRCC4 expression vector. Proteins were isolated by anti-Myc IP. Ligations with serial 5-fold dilutions are shown. In a second experiment, DNA ligase IV expressed in the absence of XRCC4 (lane 11) was supplemented with increasing amounts of recombinant XRCC4 protein (lanes 12–15), ending at a molar ratio at 1:1 (lanes 12–15). Control ligations were carried out with anti-Myc IPs from vaccinia-virus-infected (lane 2) or XRCC4–HA-expressing XR-1 cells (lane 3), as well as with identical amounts of recombinant XRCC4 protein alone (lanes 16–19). A possible nonspecific protein effect on DNA ligase IV activity was assayed by addition of BSA (lanes 20, 21). c, Anti-Myc (top/left) and anti-HA western blot (bottom/left) analysis of serial dilutions of immunoprecipitated proteins used in ligation assays, and SYPRO orange staining of the proteins (right). GST-tagged recombinant XRCC4 from insect cells is designated as GST-X4. Note that HA-tagged XRCC4 migrates close to the heavy chain of the antibody used for IP.

Using this system, we compared DNA ligase IV activity on sticky ends in the presence and absence of XRCC4 (Fig. 4b). Co-expression with XRCC4 reproducibly increased the activity of DNA ligase IV 7–8-fold, as determined by phosphorimager analysis (Fig. 4b). This effect is partly due to a consistent slight increase in the steady-state level of DNA ligase IV (2-fold; data not shown) that carries over in immunoprecipitation (Fig. 4c), but the difference in activity always exceeded the observed differences in DNA ligase IV levels. We therefore tested whether adding purified recombinant XRCC4 could stimulate DNA ligase IV and found that recombinant XRCC4 at a molar ratio of 1 : 1 consistently gave a 5-fold increase in sticky-end ligation (Fig. 4b). XRCC4 protein itself had no ligase activity, and a nonspecific protein (bovine serum albumin) had no effect on DNA ligase IV.

Our results clarify the role of XRCC4 in DNA metabolism. They indicate XRCC4 is needed to stimulate DNA ligase activity, primarily through direct structure interaction with DNA ligase IV. This interaction distinguishes XRCC4 from the DNA-end-binding autoantigen Ku70/Ku86 (refs 11, 12) and from DNA-PK (ref. 13), a kinase that is mutated in severe combined immunodeficiency14,15, because these activities appear to be required earlier on for recognition (Ku70/86) and processing of DNA ends (DNA-PK)16.

A logical extension of this is that DNA ligase IV, in complex with XRCC4, is the joining activity in V(D)J recombination and generally in DNA-end joining. Previous work with mammalian cell lines with deficiencies in DNA ligase I and III indicates that they are entirely normal for V(D)J recombination3,17,18,19. The DNA ligase II cDNA has not been identified, but it may represent an alternatively spliced form of DNA ligase III or a start-codon variant5,20. Thus, DNA ligases I, II and III are unlikely to be the ligases involved in V(D)J recombination and DNA-end joining. Our conclusion that DNA ligase IV is the end-joining activity is supported by results in an accompanying paper21, in which the deletion of the homologue of DNA ligase IV in yeast severely impairs non-homologous DNA-end joining. It is likely that a deficiency in either XRCC4 or DNA ligase IV results not only in an increased sensitivity of cells to X-rays, but may also give rise to immunodeficiency in animals.

Methods

Expression vectors. Human XRCC4 cDNA (gift from F. Alt) was cloned into the mammalian expression vector pCDNA3 and fused to a sequence encoding a C-terminal His9/Myc3 tag (plasmid pUG14). HA-tagged XRCC4 was generated by replacing the Myc epitope in pUG14 with a linker encoding the HA epitope (plasmid pUG23). Human DNA ligase IV was PCR-cloned from Reh cDNA into pCDNA3 also containing a C-terminal His/Myc tag (plasmid pUG19). The XRCC4-His9/Myc3 gene was cloned into baculovirus vector pAcG2T (Pharmingen) from pUG14 in-frame with an N-terminal glutathione-S-transferase (GST) tag (pUG10).

Stable XRCC4 transfectants and XRCC4 baculovirus. Stable puromycin-resistant colonies were generated by co-transfecting plasmid pUG14 with a puromycin-resistance-marker-containing plasmid LXSP. Transfectants were selected at 4 µg ml−1 puromycin. Recombinant XRCC4 baculovirus was generated by co-transfecting pUG10 with Baculo Gold transfection module (Pharmingen), as recommended by the manufacturer.

Immunoprecipitation. Cells were lysed in immunoprecipitation (IP) buffer (25 mM HEPES/KOH, 0.25% Tween-20, 10 mM MgCl2, 300 mM KCl, pH 7.9, supplemented with 1 mM PMSF, 2 µg ml−1 aprotinin, 2 µg −1 leupeptin and 1 µg ml−1 pepstatin A). Immunoprecipitates were prepared with mAb MYC 1-9E10.2 (ATCC CRL1729) and protein G-Sepharose and were washed 5 times with 25 mM HEPES/KOH, 0.1% NP40, 10 mM MgCl2, 650 mM KCl, pH 7.9.

Proteins were fractionated by SDS–PAGE, developed with SYPRO orange stain and analysed on a STORM phosphorimager (Molecular Dynamics). ECL western blots have been described22. Anti-Myc and anti-HA blots were developed with mAb 1-9E10.2 and mAb 3F10 (Boehringer Mannheim), respectively, followed by horseradish-peroxidase-conjugated secondary reagents.

X-ray sensitivity and V(D)J recombination assays. Cells grown to confluency were γ-irradiated and plated into 96-well plates under limiting dilution conditions. The percentage surviving was calculated by dividing the number of colonies at a given dilution of irradiated cells by the number of colonies at the same dilution of non-irradiated cells. Transient cellular V(D)J recombination was assayed as described23,24. Recombination substrates retaining either coding or signal joints upon V(D)J recombination were pGG51 and pGG49, respectively25.

Protein microsequencing. Microsequencing of tryptic peptides from silver-strained protein bands (500–1,000 ng XAP) was done by nano-electrospray tandem mass spectrometry6. From peptide sequences, DNA ligase IV was uniquely identified in a non-redundant database containing more than 200,000 protein sequences without using species or protein size restrictions26.

Ligation assay and in vitro adenylation. Nick ligation and adenylation were done in 60 mM Tris 10 mM MgCl2, 5 mM DTT, 5 µg ml−1 acetylated BSA, pH 7.9. Ligations were done with 0.1 pmol nick-ligation substrate (a 50-nucleotide bottom strand annealed to a complementary 17-mer and a 5′-phosphorylated 33-mer forming the nicked top strand). Ligations were incubated for 30 min at room temperature, denatured at 95 °C in formamide, and fractionated on denaturing 20% polyacrylamide gels. Adenylation was done with 10 µCi [α-32P]ATP for 15 min at room temperature. Pyrophosphate pretreatment was for 15 min at RT with 5 mM Na2P2O7.

Duplex ligations were carried out in 50 mM HEPES, 100 mM KCl, 5 mM MnCl2, 2 mM 2-mercaptoethanol, pH 7.9. Primer sequences for duplex ligation substrates: 80-mer UG301: 5′-GGGTGGATTCGTCCGCTTTCCTTCCCTTT TCTCTCTTTTCCCTTTCTCCTTCCTTCCTTCCCTCCCCTCGTCTAGATCCC-3′, two 15-mers UG302: 5′-CGGACGAATCCACCC-3′ and 5′-[32P]UG303: 5′-GGGATCTAGACGAGG-3′ (for blunt-end substrate) and two 18-mers UG304: 5′-CGGACGAATCCACCCGGG-3′ and 5′-[32P]UG305: 5′-ATCTAGACGAGGGGAGGG-3′ (for sticky-end substrate). Duplex ligations were incubated for 1 h at 37 °C.

Expression and purification of recombinant proteins. Recombinant GST-tagged XRCC4 was purified from Hi-5 insect cells infected with baculovirus bvUG7-3. Cells were lysed in IP buffer containing 20 mM imidazole. Proteins were bound to Ni-NTA agarose (Qiagen) and eluted with buffer containing 100 mM EDTA. Supernatants were then incubated with glutathione–Sepharose 4B (Pharmacia) which was eluted with buffer containing 10 mM reduced glutathione. Proteins were dialysed overnight at 4 °C against 50 mM HEPES, 100 mM KCl, pH7.9.

Recombinant Myc-tagged DNA ligase IV was expressed for 24 h in XR-1 cells by liposome-mediated transfection of the appropriate expression vector (10 µg plasmid per 3× 107 cells) and co-infection with vaccinia virus vTF7-3 (ref. 27).

Yeast-two-hybrid system. Protein interactions were analysed using the yeast-two-hybrid system as described28,29,30. The Ku70 and Ku86 fusion constructs have been reported8.

References

  1. Stamato, T. D., Weinstein, R., Giaccia, A. & Mackenzie, L. Isolation of cell-cycle dependent gamma-ray sensitive Chinese hamster ovary cell. Somat. Cell Mol. Genet. 9, 165–173 (1983).

    CAS  Article  Google Scholar 

  2. Li, Z. et al. The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination. Cell 83, 1079–1089 (1996).

    Article  Google Scholar 

  3. Taccioli, G. E. et al. Impairment of V(D)J recombination in double-strand break repair mutants. Science 260, 207–210 (1993).

    ADS  CAS  Article  Google Scholar 

  4. Giaccia, A. J., Richardson, E., Denko, N. & Stamato, T. D. Genetic analysis of the XR-1 mutation in hamster and human hybrids. Somatic Cell Mol. Genet. 15, 71–79 (1989).

    CAS  Article  Google Scholar 

  5. Wei, Y. -F. et al. Molecular cloning and expression of human cDNAs encoding a novel DNA ligase IV and DNA ligase III, an enzyme active in DNA repair and recombination. Mol. Cell. Biol. 15, 3206–3216 (1995).

    CAS  Article  Google Scholar 

  6. Wilm, M. et al. Femtomole sequencing of proteins from polyacrylamide gels by nano-electrospray mass spectrometry. Nature 379, 466–469 (1996).

    ADS  CAS  Article  Google Scholar 

  7. Robins, P. & Lindahl, T. DNA ligase IV from HeLa cell nuclei. J. Biol. Chem. 271, 24257–24261 (1996).

    CAS  Article  Google Scholar 

  8. Wu, X. & Lieber, M. R. Protein–protein and protein–DNA interaction regions within the DNA end binding protein Ku70–Ku86. Mol. Cell. Biol. 16, 5186–5193 (1996).

    CAS  Article  Google Scholar 

  9. Lindahl, T. & Barnes, D. E. Mammalian DNA ligases. Annu. Rev. Biochem. 61, 251–281 (1992).

    CAS  Article  Google Scholar 

  10. Gerstein, R. M. & Lieber, M. R. Extent to which homology can constrain coding exon junctional diversity in V(D)J recombination. Nature 363, 625–627 (1993).

    ADS  CAS  Article  Google Scholar 

  11. Reeves, W. H. & Sthoeger, Z. M. Molecular cloning of cDNA encoding the p70(Ku) lupus autoantigen. J. Biol. Chem. 264, 5047–5052 (1989).

    CAS  PubMed  Google Scholar 

  12. Mimori, T. et al. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome. Proc. Natl Acad. Sci. USA 87, 1777–1781 (1990).

    ADS  CAS  Article  Google Scholar 

  13. Hartley, K. O. et al. DNA-dependent protein kinase catalytic subunit: A relative of phosphatidylinositol 3-kinase and the ataxia telangiectasia gene product. Cell 82, 849–856 (1995).

    CAS  Article  Google Scholar 

  14. Kirchgessner, C. U. et al. DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect. Science 267, 1178–1183 (1995).

    ADS  CAS  Article  Google Scholar 

  15. Blunt, T. et al. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80, 813–823 (1995).

    CAS  Article  Google Scholar 

  16. Jackson, S. P. & Jeggo, P. A. DNA double-strand break repair and V(D)J recombination: involvement of DNA-PK. Trends Biochem. Sci. 20, 412–415 (1995).

    CAS  Article  Google Scholar 

  17. Hsieh, C. L., Arlett, C. F. & Lieber, M. R. V(D)J recombination in ataxia telangiectasia, Bloom's syndrome, and a DNA ligase I-associated immunodeficiency disorder. J. Biol. Chem. 268, 20105–10109 (1993).

    CAS  PubMed  Google Scholar 

  18. Petrini, J., Donovan, J. W., Dimare, C. & Weaver, D. T. Normal V(D)J coding junction formation in DNA ligase I deficiency syndromes. J. Immunol. 152, 176–183 (1994).

    CAS  PubMed  Google Scholar 

  19. Kemp, L., Sedgwick, S. & Jeggo, P. X-ray sensitive mutants of Chinese hamster ovary cells defective in double-strand rejoining. Mut. Res. 132, 189–196 (1984).

    CAS  Google Scholar 

  20. Chen, J. et al. Mammalian DNA ligase III: molecular cloning, chromsomal localization, and expression in spermatocytes undergoing meiotic recombination. Mol. Cell. Biol. 15, 5412–5422 (1995).

    CAS  Article  Google Scholar 

  21. Wilson, T. E., Grawunder, U. & Lieber, M. R. Yeast DNA ligase IV mediates non-homologous DNA end joining. Nature 388, 495–498 (1997).

    ADS  CAS  Article  Google Scholar 

  22. Grawunder, U., Schatz, D. G., Leu, T. M., Rolink, A. & Melchers, F. The half-life of RAG-1 protein in precursor B cells is increased in the absence of RAG-2 expression. J. Exp. Med. 183, 1731–1737 (1996).

    CAS  Article  Google Scholar 

  23. Lieber, M. R. et al. The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination. Cell 55, 7–16 (1988).

    CAS  Article  Google Scholar 

  24. Gauss, G. & Lieber, M. R. DEAE–dextran enhances electroporation of mammalian cells. Nucleic Acids Res. 20, 6739–6740 (1992).

    CAS  Article  Google Scholar 

  25. Miller, R. D. et al. Gene for the catalytic subunit of mouse DNA-PK maps to the scid locus. Proc. Natl Acad. Sci. USA 92, 10792–10795 (1995).

    ADS  CAS  Article  Google Scholar 

  26. Mann, M. & Wilm, M. Error-tolerant identification of peptides in sequence databases by peptide sequence tags. Analyt. Biochem. 66, 4390–4399 (1994).

    CAS  Article  Google Scholar 

  27. Fuerst, T. R., Niles, E. G., Studier, F. W. & Moss, B. Eukaryotic transient expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl Acad. Sci. USA 83, 8122–8126 (1986).

    ADS  CAS  Article  Google Scholar 

  28. Gyuris, J., Golemis, E., Chertkov, H. & Brent, R. Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75, 791–803 (1993).

    CAS  Article  Google Scholar 

  29. Zervos, A., Gyuris, J. & Brent, R. Mxi1, a protein that specifically interacts with Max to bind Myc–Max recognition sites. Cell 72, 223–232 (1993).

    CAS  Article  Google Scholar 

  30. Guarente, L. Yeast promoters and lacZ fusion designed to study expression of cloned genes in yeast. Meth. Enzymol. 101, 181–191 (1983).

    CAS  Article  Google Scholar 

Download references

Acknowledgements

U.G. is a postdoctoral fellow of the Boehringer Ingelheim Foundation. T.E.W. is a Howard Hughes Medical Institute physician postdoctoral fellow. This work was supported by grants to M.R.L. M.R.L. is a Leukemia Society of America scholar. We thank C. Hsieh, A. Kalb and M. Yaneva for comments on the manuscript.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Michael R. Lieber.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Grawunder, U., Wilm, M., Wu, X. et al. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 388, 492–495 (1997). https://doi.org/10.1038/41358

Download citation

  • Received:

  • Accepted:

  • Issue Date:

  • DOI: https://doi.org/10.1038/41358

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing