Table 2 Primers used in the real-time PCR and amplified products

From: Gene and protein expression profiles of prostaglandin E2 receptor subtypes in the human corpus cavernosum

Target Sequence (5′ to 3′ direction) Accession code cDNA location Product size (bp)
EP1     
 Sense GGTATCATGGTGGTGTCGTG NM_000955 1019–1187 169
 Antisense CCTGGCGCAGTAGGATGTA    
EP2     
 Sense AGACGGACCACCTCATTCTC NM_000956 930–1112 183
 Antisense GCCTAAGGATGGCAAAGACC    
EP3     
 Sense GTATGCGAGCCACATGAAGA NM_000957 723–928 206
 Antisense CAGAGGCGAAGAAAAGGTTG    
EP4     
 Sense TGCTCTTCTTCAGCCTGTCC NM_000958 888–1074 187
 Antisense GAGCTACCGAGACCCATGTT    
β-actin     
 Sense GGACTTCGAGCAAGAGATGG X00351 704–937 234
 Antisense AGCACTGTGTTGGCGTACAG