Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Letter
  • Published:

Cyclin-dependent kinases prevent DNA re-replication through multiple mechanisms

Nature volume 411, pages 1068–1073 (2001)Cite this article

Abstract

The stable propagation of genetic information requires that the entire genome of an organism be faithfully replicated once and only once each cell cycle. In eukaryotes, this replication is initiated at hundreds to thousands of replication origins distributed over the genome, each of which must be prohibited from re-initiating DNA replication within every cell cycle. How cells prevent re-initiation has been a long-standing question in cell biology. In several eukaryotes, cyclin-dependent kinases (CDKs) have been implicated in promoting the block to re-initiation1, but exactly how they perform this function is unclear. Here we show that B-type CDKs in Saccharomyces cerevisiae prevent re-initiation through multiple overlapping mechanisms, including phosphorylation of the origin recognition complex (ORC), downregulation of Cdc6 activity, and nuclear exclusion of the Mcm2-7 complex. Only when all three inhibitory pathways are disrupted do origins re-initiate DNA replication in G2/M cells. These studies show that each of these three independent mechanisms of regulation is functionally important.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Clb–Cdc28 phosphorylation of Orc6 and Orc2 in vivo.
Figure 2: Induction of re-replication and re-initiation in G2/M by deregulation of ORC, Mcm2-7 and Cdc6.
Figure 3: Re-replication and re-initiation are induced with physiological levels of ΔntCdc6.
Figure 4: Re-replicating cells remain in G2/M phase.
Figure 5: Model for Clb–Cdc28 inhibition of re-replication through several overlapping mechanisms.

Similar content being viewed by others

References

  1. Kelly, T. J. & Brown, G. W. Regulation of chromosome replication. Annu. Rev. Biochem. 69, 829–880 (2000).

    Article  CAS  PubMed  Google Scholar 

  2. Drury, L. S., Perkins, G. & Diffley, J. F. The Cdc4/34/53 pathway targets Cdc6p for proteolysis in budding yeast. EMBO J. 16, 5966–5976 (1997).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Drury, L. S., Perkins, G. & Diffley, J. F. The cyclin-dependent kinase Cdc28p regulates distinct modes of Cdc6p proteolysis during the budding yeast cell cycle. Curr. Biol. 10, 231–240 (2000).

    Article  CAS  PubMed  Google Scholar 

  4. Elsasser, S., Chi, Y., Yang, P. & Campbell, J. L. Phosphorylation controls timing of Cdc6p destruction: a biochemical analysis. Mol. Biol. Cell 10, 3263–3277 (1999).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Moll, T., Tebb, G., Surana, U., Robitsch, H. & Nasmyth, K. The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae transcription factor SWI5. Cell 66, 743–758 (1991).

    Article  CAS  PubMed  Google Scholar 

  6. Nguyen, V. Q., Co, C., Irie, K. & Li, J. J. Clb/Cdc28 kinases promote nuclear export of the replication initiator proteins Mcm2-7. Curr. Biol. 10, 195–205 (2000).

    Article  CAS  PubMed  Google Scholar 

  7. Labib, K., Diffley, J. F. & Kearsey, S. E. G1-phase and B-type cyclins exclude the DNA-replication factor Mcm4 from the nucleus. Nature Cell Biol. 1, 415–422 (1999).

    Article  CAS  PubMed  Google Scholar 

  8. Schwob, E., Bohm, T., Mendenhall, M. D. & Nasmyth, K. The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae. Cell 79, 233–244 (1994).

    Article  CAS  PubMed  Google Scholar 

  9. Elsasser, S., Lou, F., Wang, B., Campbell, J. L. & Jong, A. Interaction between yeast Cdc6 protein and B-type cyclin/Cdc28 kinases. Mol. Biol. Cell 7, 1723–1735 (1996).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Visintin, R., Prinz, S. & Amon, A. CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis. Science 278, 460–463 (1997).

    Article  ADS  CAS  PubMed  Google Scholar 

  11. Hennessy, K. M., Clark, C. D. & Botstein, D. Subcellular localization of yeast CDC46 varies with the cell cycle. Genes Dev. 4, 2252–2263 (1990).

    Article  CAS  PubMed  Google Scholar 

  12. Newlon, C. S. et al. Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae. Cold Spring Harb. Symp. Quant. Biol. 58, 415–423 (1993).

    Article  CAS  PubMed  Google Scholar 

  13. Brewer, B. J. et al. The topography of chromosome replication in yeast. Cold Spring Harb. Symp. Quant. Biol. 58, 425–434 (1993).

    Article  CAS  PubMed  Google Scholar 

  14. Bell, S. P. & Stillman, B. ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357, 128–134 (1992).

    Article  ADS  CAS  PubMed  Google Scholar 

  15. Jallepalli, P. V., Brown, G. W., Muzi-Falconi, M., Tien, D. & Kelly, T. J. Regulation of the replication initiator protein p65cdc18 by CDK phosphorylation. Genes Dev. 11, 2767–2779 (1997).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Sauer, K., Knoblich, J. A., Richardson, H. & Lehner, C. F. Distinct modes of cyclin E/cdc2c kinase regulation and S-phase control in mitotic and endoreduplication cycles of Drosophila embryogenesis. Genes Dev. 9, 1327–1339 (1995).

    Article  CAS  PubMed  Google Scholar 

  17. Dahmann, C., Diffley, J. F. & Nasmyth, K. A. S-phase-promoting cyclin-dependent kinases prevent re-replication by inhibiting the transition of replication origins to a pre-replicative state. Curr. Biol. 5, 1257–1269 (1995).

    Article  CAS  PubMed  Google Scholar 

  18. Broek, D., Bartlett, R., Crawford, K. & Nurse, P. Involvement of p34cdc2 in establishing the dependency of S phase on mitosis. Nature 349, 388–393 (1991).

    Article  ADS  CAS  PubMed  Google Scholar 

  19. Noton, E. & Diffley, J. F. CDK inactivation is the only essential function of the APC/C and the mitotic exit network proteins for origin resetting during mitosis. Mol. Cell. 5, 85–95 (2000).

    Article  CAS  PubMed  Google Scholar 

  20. Liang, C. & Stillman, B. Persistent initiation of DNA replication and chromatin-bound MCM proteins during the cell cycle in cdc6 mutants. Genes Dev. 11, 3375–3386 (1997).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Muzi-Falconi, M., Brown, G. & Kelly, T. J. cdc18+ regulates initiation of DNA replication in Schizosaccharomyces pombe. Proc. Natl Acad. Sci. USA 93, 1666–1670 (1996).

    Article  Google Scholar 

  22. Nishitani, H. & Nurse, P. p65cdc18 plays a major role controlling the initiation of DNA replication in fission yeast. Cell 83, 397–405 (1995).

    Article  CAS  PubMed  Google Scholar 

  23. Nishitani, H., Lygerou, Z., Nishimoto, T. & Nurse, P. The Cdt1 protein is required to license DNA for replication in fission yeast. Nature 404, 625–628 (2000).

    Article  ADS  CAS  PubMed  Google Scholar 

  24. Vas, A., Mok, W. & Leatherwood, J. Control of DNA re-replication via Cdc2 phosphorylation sites in ORC.. Mol. Cell. Biol. (2001) (in the press).

  25. Petersen, B. O. et al. Cell cycle- and cell growth-regulated proteolysis of mammalian CDC6 is dependent on APC-CDH1. Genes Dev. 14, 2330–2343 (2000).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Pelizon, C., Madine, M. A., Romanowski, P. & Laskey, R. A. Unphosphorylatable mutants of cdc6 disrupt its nuclear export but still support DNA replication once per cell cycle. Genes Dev. 14, 2526–2533 (2000).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Jiang, W., Wells, N. J. & Hunter, T. Multistep regulation of DNA replication by Cdk phosphorylation of HsCdc6. Proc. Natl Acad. Sci. USA 96, 6193–6198 (1999).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  28. Petersen, B. O., Lukas, J., Sorensen, C. S., Bartek, J. & Helin, K. Phosphorylation of mammalian CDC6 by cyclin A/CDK2 regulates its subcellular localization. EMBO J. 18, 396–410 (1999).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Saha, P. et al. Human CDC6/Cdc18 associates with Orc1 and cyclin-cdk and is selectively eliminated from the nucleus at the onset of S phase. Mol. Cell. Biol. 18, 2758–2767 (1998).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Fujita, M. et al. Cell cycle regulation of human CDC6 protein. Intracellular localization, interaction with the human mcm complex, and CDC2 kinase- mediated hyperphosphorylation. J. Biol. Chem. 274, 25927–25932 (1999).

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank T. Wang, S. Chu and J. Whangbo for early observations about Orc2 and Orc6 phosphorylation; U. Tran for analysis of ΔntCdc6 plasmid loss rates; L. Huang and J. Gitschier for aid with the PFGE analysis; B. Stillman, C. Liang, S. Bell, J. Ubersax, A. Rudner, M. K. Raghuraman, F. Uhlman, D. Morgan and D. Toczyski for advice and reagents; and A. Sil, I. Herskowitz, A. Johnson, D. Morgan, P. O'Farrell, E. Blackburn, D. Toczyski, B. Thorner, J. Ubersax and C. Takizawa for critical reading of the manuscript. This work was supported by ACS and NIH (J.J.L.) and an NIH training grant (V.Q.N.). Part of this work was performed when J.J.L. was a Markey, Searle and Rita Allen Foundation Scholar.

Author information

Authors and Affiliations

  1. Department of Biochemistry and Biophysics,

    Van Q. Nguyen & Carl Co

  2. Department of Microbiology and Immunology, University of California, San Francisco, 94143-0414, California, USA

    Joachim J. Li

Authors
  1. Van Q. Nguyen
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Carl Co
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Joachim J. Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Joachim J. Li.

Supplementary information

Methods

Plasmid construction. Plasmid pJL737 (ORC6) contains nucleotides –665 to +1856 (relative to the first coding nucleotide) of ORC6 inserted in the polylinker of pRS3061 flanked by a cut and filled in BamHI site (-665) and an intact SalI site (+1856). Plasmid pJL921 (ORC6-HA3) is identical except (1) the polylinker sites SpeI and NotI were destroyed by religating the cut and filled-in sites to each other, (2) a new NotI site was introduced at the 3’ end of the ORC6 ORF by inserting 5’-AGCGGCCGC-3’ just before the stop codon, and (3) a triple hemagglutinin epitope HA32 was cloned into the NotI site. The resulting construct encodes Orc6 protein fused at its C-terminus to HA3. Plasmid pJL1544 was derived from pJL921 by excising the 5’ portion of ORC6 with BsrG1 and NgoMV, filling-in the two ends, and ligating them together. Loop-in integration of pJL1544 (linearized with BstXI) at the ORC6 locus simultaneously disrupts the endogenous ORC6 gene and introduces ORC6-HA.

Plasmids pMP933 and pMP934 contains ORC2 from the first SacI site 5’ of the ORF to the first SalI site 3’ of the ORF cloned into SacI and SalI of pRS306. In pMP933 (ORC2), SgrAI and NotI sites were introduced at the 5’ end of the ORF by inserting 5’ – ATGGCACCGGTGGGCGGCCGC – 3’ just before the ATG. In pMP934, SgrAI and NotI sites were introduced at the 3’ end of the ORF by inserting 5’ – GGCGGCCGCGCACCGGTG – 3’ just before the stop codon. Insertion of HA3 into the NotI site of pMP934 generated pMP944 (ORC2-HA3), which encodes Orc2 fused at its C-terminus to HA3.

Plasmid pTW000 (orc6-4A-HA3) was derived from pJL921 by introducing mutations that change serine/threonine to alanine in the CDK consensus phosphorylation sites at residues 106, 116, 123, and 146; excision of HA3 from pTW000 generated pJL1096 (orc6-4A). Plasmid pJL1095 (orc2-6A) was generated by similar mutations in ORC2 of pMP934 that change residues 16, 24, 70, 174, 188, and 206 in its consensus CDK phosphorylation sites.

Plasmid pJL806 (pGAL1) contains the GAL1 promoter from –663 to –5 (relative to the first nucleotide of the GAL1 ORF) inserted in the polylinker of pRS3061 flanked by a cut and filled in SpeI site (-663) and an intact BamHI site (-5). Plasmid pJL1489 (pGAL1-?ntcdc6) contains the sequence 5’ – TATGAGCGGCCGC – 3’ followed by CDC6 from +139 to +1983 inserted in the SmaI site of pJL806 downstream of the GAL1 promoter; it expresses a truncated Cdc6p with amino acids 2-47 replaced by amino acids S-G-R. Plasmid pJL1490 (pGAL1-CDC6) contains the sequence 5’ – TATGAGCGGCCGC – 3’ followed by CDC6 from +1 to +1983 inserted in the same SmaI site; it expresses full length Cdc6p with the amino acids M-S-G-R appended to the N-terminus.

pJL1206 (MCM7-NLS), which encodes Mcm7p fused at its C-terminus to two tandem copies of the SV40 NLS, was derived by NotI excision of GFP from pVN151 (MCM7-GFP-NLS)3. pKI1260 (MCM7-nls3A), which encodes Mcm7p fused at its C-terminus to two mutated and nonfunctional copies of the SV40 NLS, was derived by NotI excision of GFP from pVN148 (MCM7-GFP-nls3A)3.

Strain construction. pJL921 was used to construct YJL865 (CDC-wt ORC6-HA3) by a loop-in/loop-out gene replacement in YJL3104. YJL865 was crossed to cdc mutants (previously backcrossed three to four times against YJL310) to generate the following ORC6-HA3 strains used in Fig. 1: YJL929 (cdc25-5), YJL934 (cdc28-4), YJL905 (cdc4-1), YJL926 (cdc34-2), YJL907 (cdc7-4), YJL903 (cdc17-1), YJL922 (cdc9-1). Loop-in integration of pJL1544 (orc6-HA3) into cdc15 and cdc14 generated ORC6-HA3 strains YJL3099 (cdc15-1), and YJL3101 (cdc14-1), respectively. Only YJL19373 (dbf2-2) contains untagged ORC6. All the strains described above were MATa ORC2 bar1::LEU2 ura3-52 leu2-3,112 trp1-289 in the A364a background. pMP944 was used to construct YJL963 (ORC2-HA3) by loop-in/loop-out gene replacement in YJL310. YJL963 was later found to have diploidized (as a MATa/a diploid) during its construction. pTWOOO was used to construct YJL1394 (orc6-4A-HA3) by loop-in/loop-out gene replacement in YJL312, which is a pep4::TRP1 strain congenic to YJL310. Sequential loop-in/loop-out gene replacements with pJL1096 and pJL1095 in the A364a background generated YJL1737 (MATa orc2-6A orc6-4A leu2 ura3-52 trp1-289 ade2 ade3 bar1::LEU2).

Strains in Fig. 2-4 were derived from YJL1737 using various combinations of the following plasmids: pMP933 (ORC2), pJL737 (ORC6), pJL1206 (mcm7-NLS), pKI1260 (MCM7-nls3A), pJL1489 (pGAL1-?ntcdc6), pJL806 (pGAL1) and pMET-CDC205 which replaces the CDC20 promoter with the MET3 promoter. pMP933, pJL737, pJL1206, and pKI1260 were used in loop-in/loop-out gene replacements at their respective chromosomal loci, pMET-CDC20 was used in one-step gene replacements at the CDC20 locus, and pJL1489 and pJL806 were inserted at the URA3 locus by loop-in integration. These genetic manipulations generated YJL3239 (ORC2 ORC6 MCM7-NLS CDC6 ura3-52::{pGAL1-?ntcdc6, URA3} cdc20?::{pMET3-CDC20, TRP1}); YJL3242 (orc2-6A orc6-4A MCM7-nls3A CDC6 ura3-52::{pGAL1-?ntcdc6, URA3} cdc20?::{pMET3-CDC20, TRP1};, YJL3244 (orc2-6A orc6-4A MCM7-NLS CDC6 ura3-52::{pGAL1, URA3} cdc20?::{pMET3-CDC20, TRP1}); and YJL3248 (orc2-6A orc6-4A MCM7-NLS CDC6 ura3-52::{pGAL1-?ntcdc6, URA3} cdc20?::{pMET3-CDC20, TRP1}). All strains are MATa leu2 ura3-52 trp1-289 ade2 ade3 bar1::LEU2.

YJL3122 and YJL3510 are both congenic to the re-replicating strain YJL3248. YJL3122 contains pGAL1-CDC6 instead of pGAL1-?ntcdc6 integrated at the ura3-52 locus. YJL3510 contains an 8 bp linker substitution in the ARS consensus sequence and ORC binding site6 of ARS305 that was introduced by loop-in/loop-out replacement using plasmid pDK-ARS305Lin17.

Protein Analysis. Samples were prepared for immunoblot analysis as described8. The two forms of Orc2p were separated by electrophoresis on a 6-12% SDS-PAGE gradient gel. Primary antibodies used in this paper were: 12CA5 anti-HA mouse monoclonal ascites (1:2000); affinity purified anti-Orc6 rabbit polyclonal antibodies (1:2000); SB679 anti-Orc2 mouse monoclonal cultured supernatant (1:100); SB39 anti-Orc3 mouse monoclonal ascites (1:10000); #289 anti-Mcm2 mouse monoclonal ascites (1:3000); 9H8/510 anti-Cdc6 mouse monoclonal ascites (1:200). Secondary antibodies used were anti-mouse or anti-rabbit IgG conjugated to horseradish peroxidase (1:5000) (Biorad or ProMega). Chemiluminescent detection was performed using Supersignal reagents from Pierce. To prepare the anti-Orc6 antibodies, anti-GST-Orc6 antiserum from rabbit was depleted of anti-GST antibodies by passage over a GST column then purified by elution from a GST-Orc6 column as described11.

For phosphatase analysis of ORC6-HA3 or ORC2-HA3, cells were lysed by bead beating in SDS Lysis Buffer (10 mM Tris-Cl pH7.5, 50 mM NaCl, 5 mM EDTA, 1% (w/v) SDS, 1 mM DTT, 1mM Na3VO4, 50 mM NaF, 50 mM b-glycerophosphate, 0.1 mM PMSF, 1 mM benzamidine, and 1 µg/ml each of leupeptin, pepstatin A, and chymostatin). Lysates were converted to IP Buffer conditions by dilution in four volumes of Triton Dilution Buffer (SDS Lysis Buffer with SDS replaced by 1 % (v/v) Triton X-100 and NaCl at 150 mM). The HA-tagged Orc proteins were immunoprecipitated from 200 µg of diluted lysate with 12CA5 anti-HA monoclonal ascites and protein A sepharose as described12 and immunoprecipitates washed three times in IP Buffer. Phosphatase treatment of the immunoprecipitates with or without phosphatase inhibitors was performed as described13.

H1 Kinase and Replication Assays. H1 kinase assays were performed as described14, except reactions were performed in 20 µl of 50 mM HEPES pH7.4, 2 mM MgCl2, 0.1 mM ATP, 1 mM DTT, containing 5 µg Histone H1 (Upstate Biological) and 5 µCi [g-32P] ATP (NEN, BLU502Z). For flow cytometry, cells were fixed and stained with 1 µM Sytox Green (Molecular Probes) as described15. For pulsed-field gel electrophoresis (PFGE), cells were prepared in agarose plugs as described11 and elecrophoresis was carried out in 1% LE agarose (Seakem) in a CHEF DRII apparatus from Bio-Rad using the following conditions: 14° C, 0.5X TBE, 200 V, 120° field angle, 36 hour run, switch time ramped from 40 to 70 sec. For neutral-neutral 2-D gel electrophoresis, DNA was prepared as described16 and 3 µg digested with EcoRV (for ARS305, ARS307, ARS607+30kb), NciI (for ARS306), EcoRI and BamHI (for ARS121), SacI and ApaLI (for ARS607), XbaI (for ARS501 and ARS1413), or NcoI (for ARS1). The digested DNA was subjected to electrophoresis as described17.

Southern analysis of both PFGE and 2-D gels were performed as described11. For the PFGE southern analysis the ARS1 probe detected both chromosome 4 (ARS1 locus) and 7 (MET3-CDC20 locus marked with TRP1-ARS1). Probes were PCR amplified from yeast genomic DNA with the following primers: for ARS305, OJL1028 5’-ATTCGCCTTCTGACAGGACG-3’ and OJL1029 5’-ATAACGGAGACTGGCGAACC-3’; for ARS306, OJL1033 5’- TGGTTTGGACGACGGATTGG-3’ and OJL1034 5’-TATGGGATGCTGTTGCGAGC-3’; for ARS307, OJL1037 5’- TGTGTTCCACTCAATCTGCGG-3’ and OJL1038 5’-GGGTTCTTGGTCAATGCCTG-3’; for ARS121, OJL1088 5’-AAACCATTCCTGCCTCTGTG-3’ and OJL1089 5’- GAAGCCCTTTGTTGAGAACC-3’; for ARS607, OJL1024 5’- GTCCCAATAGTGGCTCTGTG-3’ and OJL1025 5’- GCTTTCTAGTACCTACTGTGC-3’; for ARS501, OJL1031 5’-TAAGACAGCGTGTGTACTCC-3’ and OJL1032 5’-AATTGAGCCCGATGACTACG-3’; for ARS1413, OJL1039 5’-ATTTCTGAAGTCGTTCCCAGCC-3’ and OJL1040 5’-TCTGTCGCCAAGAGCAATCTAC-3’; for ARS1, OJL1026 5’-TTCCGATGCTGACTTGCTGG-3’ and OJL1027 5’-GACGACTTGAGGCTGATGGT-3’; for 30kb distal to ARS607, OJL1090 5’-GCCGTACAAATTCTTCCTCTAG-3’ and OJL1091 5’-TCTGCTGTTCGCTACATTCC-3’.

Chromatin Association Assay. Chromatin association assays were performed as described9 but with several modifications. Log, alpha factor, and 0 hr samples were spheroplasted in 30 µl of 2 mg/ml Oxalyticase (Enzogenetics, Corvallis, OR); 1, 2, and 3 hr samples were spheroplasted in 40, 45, and 50 µl of 2 mg/ml Oxalyticase, respectively. Lysis was performed in 400 µl extraction buffer and the extracts were underlaid with 200 µl of a 30% sucrose cushion before pelleting the chromatin enriched fraction. The pellets were washed with the same volume of extraction buffer and spun through the same volume of sucrose cushion. The washed pellets were resuspended in 100 µl BE10 (20 mM Hepes pH 7.9, 1.5 mM Magnesium Acetate, 50 mM Potassium Acetate, 10% Glycerol, 0.5 mM DTT, 1 mM PMSF, 0.1 mM Sodium Vanadate, 1 mM Benzamidin, and 1 µg/ml each of Chymostatin, Pepstatin A, and Leupeptin) supplemented with 2 µl (220 U) DNase I (Sigma, D7291) and 150 mM NaCl and incubated at 25°C for 10 min to solubilize chromatin bound proteins. After pelleting insoluble material, the supernatant was collected and immunoblotted as described above.

Figures

Figure 1

(JPG 48 KB)

All chromosomes experience gel retardation as a consequence of re-replication. ORC phosphorylation, Mcm2-7p localization, and Cdc6p expression were deregulated in YJL3239 (ORC2 ORC6 MCM7-2NLS CDC6 pGAL1-?ntcdc6 pMET3-CDC20), YJL3242 (orc2-6A orc6-4A MCM7-2nls3A CDC6 pGAL1-?ntcdc6 pMET3-CDC20), YJL3244 (orc2-6A orc6-4A MCM7-2NLS CDC6 pGAL1 pMET3-CDC20), and YJL3248 (orc2-6A orc6-4A MCM7-2NLS CDC6 pGAL1-?ntcdc6 pMET3-CDC20) as described in the text and summarized at the top of the figure: minus, deregulated; plus, regulated. Deregulation of Cdc6p was conditional and dependent on galactose induction of pGAL1-?ntcdc6. Cells were initially grown in medium lacking methionine and containing raffinose to prevent expression of ?ntCdc6p. They were arrested in G2/M by addition of 2mM methionine (which induced depletion of Cdc6p) followed 2.5 hr later by 15 µg/ml of nocodazole. After another 30 min, galactose was added to induce ?ntCdc6p at time 0 hr. a, Chromosome migration after pulsed-field gel electrophoresis (PFGE) and ethidium bromide staining. b, Southern analysis of PFGE probed for chromosome 4 and 7. Similar results were seen with congenic strains that were wild-type for CDC20 and arrested in G2/M solely with nocodazole (data not shown).

Figure 2

(JPG 56 KB)

Re-initiation occurs at some but not all origins. Induction of re-replication and analysis of replication intermediates by neutral-neutral 2D gel electrophoresis was performed as described in Fig. 2 on congenic re-replicating strains YJL3510 (ars305-lin1) (a) and YJL3248 (ARS305) (b-i). The nonfunctional ars305-lin1 has an eight bp linker substitution disrupting the ORC binding site for ARS3056,7. The origins that were probed for each pair of panels (0 hr and 1-2 hr) are indicated in the figure. 607 + 30kb is a locus 30kb distal to ARS607 that is replicated in S phase by a fork initiated from ARS60718.19. Bottom right schematic shows expected positions of bubble arcs (indicating initiation within fragment), Y arcs (indicating passive replication), and non-replicating DNA. Arc intensities were normalized by selecting exposures that displayed equivalent signal intensities at the position of the non-replicating DNA (as extrapolated from signal intensities observed in very light exposures).

Figure 3

(JPG 37 KB)

Expression of Cdc6p from the GAL1 promoter can induce re-replication. YJL3038 (pGAL1 orc2-6A orc6-4A MCM7-2NLS CDC6), YJL3122 (pGAL1-CDC6 orc2-6A orc6-4A MCM7-2NLS CDC6), YJL2099 (pGAL1-?ntcdc6 orc2-6A orc6-4A MCM7-2NLS CDC6) growing in rich medium containing raffinose were arrested at G2/M phase with nocodazole for 3 hr. Galactose was added (0 hr) to induce expression from the GAL1 promoter and FACS samples were processed every hour.

Reference List

  1. 1.

    Sikorski, R. S. & Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27. (1989).

  2. 2.

    Tyers, M. & Futcher, B. Far1 and Fus3 link the mating pheromone signal transduction pathway to three G1-phase Cdc28 kinase complexes. Mol Cell Biol 13, 5659-5669. (1993).

  3. 3.

    Nguyen, V. Q., Co, C., Irie, K. & Li, J. J. Clb/Cdc28 kinases promote nuclear export of the replication initiator proteins Mcm2-7. Curr Biol 10, 195-205 (2000).

  4. 4.

    Detweiler, C. S. & Li, J. J. Cdc6p establishes and maintains a state of replication competence during G1 phase. J Cell Sci 110, 753-763. (1997).

  5. 5.

    Uhlmann, F., Wernic, D., Puopart, M.-D., Koonin, E.V. & Nasmyth, K. Cleavage of cohesins by the CD clan protease separin triggers anaphase in yeast. Cell 103, 375-386 (2000).

  6. 6.

    Bell, S. P. & Stillman, B. ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357, 128-134 (1992).

  7. 7.

    Huang, R. Y. & Kowalski, D. Multiple DNA elements in ARS305 determine replication origin activity in a yeast chromosome. Nucleic Acids Res 24, 816-823. (1996).

  8. 8.

    Owens, J. C., Detweiler, C. S. & Li, J. J. CDC45 is required in conjunction with CDC7/DBF4 to trigger the initiation of DNA replication. Proc Natl Acad Sci U S A 94, 12521-12526 (1997).

  9. 9.

    Liang, C. & Stillman, B. Persistent initiation of DNA replication and chromatin-bound MCM proteins during the cell cycle in cdc6 mutants. Genes Dev 11, 3375-3386 (1997).

  10. 10.

    Donovan, S., Harwood, J., Drury, L. S. & Diffley, J. F. Cdc6p-dependent loading of Mcm proteins onto pre-replicative chromatin in budding yeast. Proc Natl Acad Sci U S A 94, 5611-5616 (1997).

  11. 11.

    Asubel, F. M. et al. (eds.) Current Protocols in Molecular Biology (John Wiley & Sons, Inc., New York, 2000).

  12. 12.

    Harlow, E. & Lane, D. Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, 1988).

  13. 13.

    Jaspersen, S. L. & Morgan, D. O. Cdc14 activates cdc15 to promote mitotic exit in budding yeast. Curr Biol 10, 615-618 (2000).

  14. 14.

    Rudner, A. D., Hardwick, K. G. & Murray, A. W. Cdc28 activates exit from mitosis in budding yeast. J Cell Biol 149, 1361-1376 (2000).

  15. 15.

    Haase, S. B. & Lew, D. J. Flow cytometric analysis of DNA content in budding yeast. Methods Enzymol 283, 322-332 (1997).

  16. 16.

    Huberman, J. A., Spotila, L. D., Nawotka, K. A., El-Assouli, S. M. & Davis, L. R. The in vivo replication origin of the yeast 2m plasmid. Cell 51, 473-481 (1987).

  17. 17.

    Friedman, K. L. & Brewer, B. J. Analysis of replication intermediates by two-dimensional agarose gel electrophoresis. Methods Enzymol 262, 613-627 (1995).

  18. 18.

    Friedman, K. L., Brewer, B. J. & Fangman, W. L. Replication profile of Saccharomyces cerevisiae chromosome VI. Genes Cells 2, 667-678 (1997).

  19. 19.

    Yamashita, M. et al. The efficiency and timing of initiation of replication of multiple replicons of Saccharomyces cerevisiae chromosome VI. Genes Cells 2, 655-665. (1997).

Rights and permissions

Reprints and permissions

About this article

Cite this article

Nguyen, V., Co, C. & Li, J. Cyclin-dependent kinases prevent DNA re-replication through multiple mechanisms. Nature 411, 1068–1073 (2001). https://doi.org/10.1038/35082600

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/35082600

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing