Construction and characterization of efficient, stable and safe replication-deficient foamy virus vectors

Abstract

As serious side effects affected recent virus-mediated gene transfer studies, novel vectors with improved safety profiles are urgently needed. In the present study, replication-deficient retroviral vectors based on feline foamy virus (FFV) were constructed and analyzed. The novel FFV vectors are devoid of almost the complete env gene plus the internal promoter – accessory bel gene cassette including the gene for the viral transcriptional transactivator Bel1/Tas. In these Bel1/Tas-independent vectors, expression of the lacZ (β-galactosidase) marker gene is directed by the heterologous, constitutively active human ubiquitin C promoter (ubi). Env-transcomplemented vectors have un-concentrated titers of more than 105 transducing units/ml. The vectors allow efficient transduction of a broad array of diverse target cells, which can be increased by repeated vector exposure. However, the number of lacZ marker gene expressing cells decreased slightly upon serial passages of the transduced cells. Vectors carrying a self-inactivating (SIN) deletion of the TATA box and most parts of the viral promoter were not rescued by wt FFV whereas those with the intact or a partially deleted promoter were readily reactivated. This finding indicates that the viral promoters are in fact non-functional, pointing to a highly advantageous safety profile of these new FFV-ubi-lacZ-SIN vectors.

Introduction

Although the promise of vector-mediated gene transfer has been recently challenged by serious side effects, this branch of modern molecular medicine has still a great potential for further application.1 This can, however, be only achieved when present problems are rationally addressed and solved by appropriate innovations. In addition, it is required to design and optimize the most appropriate vector system for a given medical application implicating that in the future diverse viral and non-viral gene delivery systems constitute the toolbox of molecular medicine. Efficacy and safety profiles of each considered vector system will determine whether it will enter preclinical and clinical evaluation and application.1

Among the currently used viral vectors, retroviruses hold a great, perhaps the greatest promise owing to the stable transduction of target cells. However, the stable integration into the host genome may also lead to unwanted alterations or even oncogenic transformation of the corresponding target cells.2

Novel retroviral vectors based on primate- and non-primate foamy viruses (FV) which constitute the Spumavirinae subfamily of the retroviruses have currently been established and intensively examined by us and others.3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 For instance, FV vectors based on the human/primate FV allow efficient, stable and long-term transduction of human haematopoietic cells without detectable side effects.11, 12

FVs are considered to be apathogenic in their natural animal hosts and after zoonotic transmission into humans.14, 15 Therefore, FV-based vectors offer an advantageous safety profile.14, 16, 17 Along with this argument, FV DNA integration properties are favourable for safe and stable transduction of target cells and malignant transformation of FV-infected or -transduced cells has never been described.18, 19 Additionally, replication-competent FFV-based vaccine vectors induce a partially protective immunity against a highly pathogenic challenge virus in cats.6

In one of our previous studies, we have demonstrated that FFV self-inactivating (SIN) vectors rapidly give rise to replication-competent revertants (RCRs) indicating that additional genetic deletions are required to generate safe vectors.4 In a following study, we determined that the essential cis-acting sequences required for FFV-based vectors are located upstream and around the gag start codon and inside pol. The env gene turned out to be dispensable for vector function, a characteristic similar to other studied FVs.9, 20 In order to optimize the vector function, we focus in the present study on the construction and characterization of FFV vectors deleted in env or in almost the whole env-bel genomic region. The bel genes (Figure 1a) encode the viral Bel1/Tas transactivator and Bet that counteracts APOBEC3-mediated host restriction.21, 22 Importantly, only the env-bel-deleted vectors carrying SIN-deleted long terminal repressor (LTR) promoters turned out to be suited for the safe and long-term transduction of target cells.

Figure 1
figure1

Schematic presentation of the different replication-competent and replication-deficient FFV vectors used. (a) The authentic replication-competent and CMV-IE promoter-driven FFV vector pCF-7 is shown. FFV genes and the LTRs, subdivided into the U5, R and U3 regions, are marked by open boxes. The FFV LTR and internal promoters are marked by rectangular arrows and the structure of the bet gene is shown. The replication-deficient vector pCF-ΔEnv (e) is derived from pCF-7 by deleting env sequences as indicated by a broken line (Δ). (b) The pCF-7 derived replication-competent vector pCF-Bet-Gfp with the gfp marker gene marked by an open box and the partial U3 deletion in the 3′ LTR marked by a broken line (Δ) is shown.5 Derived from this construct are the env-deleted vectors pCF-Bet-GfpΔEnv and pCF-Bet-Gfp-SINΔEnv (c and d). (fh) The ubi-lacZ vectors pCF-7-ubi-lacZ, pCF-Δ-ubi-lacZ and pCF-SIN-ubi-lacZ with the intact, truncated and functionally deleted LTR promoter and the ubi-lacZ cassette inserted are shown.

Results

We recently showed that (i) FFV SIN vectors rapidly generate RCRs indicating that additional deletions are required to generate safe vectors and that (ii) essential cis-acting sequences required for FFV-based vectors are located upstream and around the gag start codon and within pol.4, 20 Here, we concentrate on the characterization of env-bel-deleted FFV vectors and those with an additional SIN deletion.

Characterization of env-deleted vectors

We first analyzed FFV env-deleted vectors for titers and long-term transduction efficiencies. For this purpose, the Env-deleted vectors pCF-Bet-GfpΔEnv and pCF-Bet-Gfp-SINΔEnv (Figure 1c and d) containing either the intact or the promoter- and TATA-box-deleted FFV SIN–LTR were co-transfected with the Env-expression plasmid pBC-FFV-Env into 293T cells. Vector titers of cell-free supernatants were determined 2 days later using FFV–FAB titration cells.4, 5 Using 3 μg of pCF-Bet-GfpΔEnv or pCF-Bet-Gfp-SINΔEnv plus 3 μg pBC-FFV-Env for cells grown in 6 cm dishes, vector titers of about 104 transducing units (TU)/ml were obtained.

We then analyzed whether the env-deleted FFV vectors allow stable, long-term transduction of permissive CRFK cells and whether RCRs are generated upon extended culture of vector-transduced cells. In repeated experiments using CRFK cells transduced by vectors pCF-Bet-GfpΔEnv and pCF-Bet-Gfp-SINΔEnv, no RCRs and no cytopathic effects were detectable after at least nine serial passages of transduced cells (data not shown). At the same time, we determined the duration of Gfp expression in order to analyze the stability of marker gene expression. During the first passage, 10% of the transduced cells were positive for Gfp auto-fluorescence. The number of positive cells decreased after the second passage to below 5% and readily declined upon further passages (data not shown).

In summary, env-deleted FFV genomes direct the production of vector particles, which are able to transduce CRFK cells without detectable levels of RCRs. However, these env-deficient vectors do not result in a stable, long-term transduction of target cells.

Particle release depends on Env

We next analyzed protein expression and particle release of pCF-Bet-GfpΔEnv in the presence of different amounts of the Env expression construct pBC-FFV-Env. Two days after co-transfection into 293T cells, cell culture supernatants were harvested for preparation of vector particles and cell extracts were analyzed by immunoblotting (Figure 2) using cat 8014 reference serum.23 Efficient proteolytic processing of p52Gag to p48Gag was detectable (upper panel) in cells transfected with the parental replication-competent vector pCF-Bet-Gfp (Figure 1b) and in all samples transfected with the env-deleted vector pCF-Bet-GfpΔEnv. Immunoblot analyses of released vector particles (Figure 2, lower panel) showed efficient particle release from cells co-transfected with 5 or 2 μg pBC-FFV-Env (lanes 1 and 2). Minimal particle release was still detectable with 0.2 μg pBC-FFV-Env (lane 3) whereas in the complete absence of Env (lane 5), no particles were released into the supernatant. Similar to human/primate FV, these data for FFV confirm that the release of FV particles depends on the amount of coexpressed Env and that no FV particles are released in the absence of Env.24, 25

Figure 2
figure2

Immunoblot analysis of cell lysates and particles from transfected 293T cells. 293T cells were transfected with the replication-deficient vector pCF-Bet-GfpΔEnv and different amounts of the pBC-FFV-Env expression plasmid as given below the blots. Two days p.t., cells were lysed and particles harvested from the supernatants. Cellular extracts (upper panel) and particles (lower panel) were analyzed by immunoblotting with FFV cat reference serum 8014.23 The positions of molecular mass markers are shown in kDa at the right hand margin, names of the detected FFV Gag proteins are given at the left hand margin. wt: pCF-Bet-Gfp, mock: non-transfected cells.

We further analyzed whether the amount of released particles correlates with the vector titers as measured with FFV–FAB cell titration.26 For this purpose, pCF-Bet-GfpΔEnv was co-transfected with decreasing amounts of the Env expression plasmid pBC-FFV-Env. Two days post transfection (p.t.) the vector titers were determined and normalized to co-expressed secreted alkaline phosphatase (SEAP). In line with the immunoblot results (Figure 2), the vector titers showed in repeated experiments a clear Env-dependence (Table 1). With high amounts of Env (5 μg pBC-FFV-Env DNA), vector titers were in the range of the parental replication-competent vector pCF-Bet-Gfp (9 × 104 TU/ml).

Table 1 Env dependence of FFV vector particle release

Transcomplementation with different Env-expression plasmids

We next analyzed whether the env-deficient provirus pCF-7ΔEnv derived from the FFV serotype FUV (Figure 1e) can be pseudotyped or complemented with the following FV Env proteins: (i) FFV–FUV serotype Env from pCInFUV7Env DNA, (ii) human/primate FV Env from plasmid pCInHFVEnv and (iii) a chimeric FFV Env consisting of the 44 N-terminal residues from FFV–FUV Env and the following 938 amino acids from the FFV serotype 951 from plasmid pCInFFV7/951Env.27, 28 The heterologous human/primate FV Env allowed almost no transduction whereas the chimeric FUV/951 Env resulted in titers two logs lower than the authentic FUV Env from pInFUV7Env or pBC-FFV-Env (104–105 FFU/ml). These results show that type-specific interactions between N-terminal Env leader protein sequences and Gag are required as recently proposed although other factors may be also required.29, 30

We also tested whether FFV particles can be pseudotyped with the vesicular stomatitis virus glycoprotein VSV-G.31 In repeated experiments, no marker gene transfer using VSV-G-pseudotyped FFV vectors was detectable confirming previous studies using simian/primate FVs.24

Characterization of ubi-lacZ vectors

To increase vector safety and allow insertion of larger foreign genes, additional vector sequences were removed. For this purpose, almost the complete env gene encompassing the internal promoter, the bel1/tas gene and large parts of bet were deleted and replaced by a 4.7 kb marker gene cassette consisting of the constitutively and broadly active human ubiquitin C (ubi) promoter and the lacZ marker gene.32, 33 Clone pCF-7-ubi-lacZ carries the intact 3′-LTR whereas pCF-Δ-ubi-lacZ bears the partially deleted but functional U3 promoter. In contrast, pCF-SIN-ubi-lacZ is devoid of any FFV promoter owing to the env and SIN deletions (Figure 1f–h). In all these clones, pol was left intact whereas in corresponding clones marked by the suffix -SB, the three C-terminal amino acids of Pol were deleted.

To analyze whether the new ubi-lacZ genomes allow efficient production of vector particles, 4 μg of the different vector DNAs together with 2 μg of pBC-FFV-Env were co-transfected into 293T cells. Two days later, vector titers were determined by staining for lacZ expression in the transduced cells. FFV-ubi-lacZ vector titers of 104–105 TU/ml were detected independent of whether the LTRs were intact, partially deleted, or SIN-deleted. Titers were similar to those of replication-competent vectors.

To analyze viral protein expression and particle release from transfected 293T cells, we performed immunoblot analyses with cell lysates and released particles (Figure 3a). In cells transfected with 2 μg of the parental clone pCF-7 (Figure 1a), efficient proteolytic processing of p52Gag to p48Gag was detectable (Figure 3a, upper panel, lane 9). In contrast, reduced amounts of the processed Gag-protein p48Gag were detectable in cells co-transfected with the different ubi-lacZ vectors plus the Env-expression plasmid (upper panel, lanes 1–6). Pol expression and processing was also reduced in the ubi-lacZ vectors compared to the parental virus (data not shown). Immunoblot analyses of released vector particles (lower panel) showed efficient vector release from cells transfected with the parental FFV vector whereas less amounts of ubi-lacZ vector particles were detectable.

Figure 3
figure3

Optimization of ubi-lacZ vectors. (a) Gene expression and particle release from ubi-lacZ vector transfected 293T cells. 293T cells were transfected with the replication-deficient ubi-lacZ vectors pCF-7-ubi-lacZ, pCF-Δ-ubi-lacZ and pCF-SIN-ubi-lacZ and the corresponding vectors lacking three Pol residues (marked by the suffix – SB) as given below the blots. All vector genomes were trans-complemented with the FFV Env clone pBC-FFV-Env. Two days p.t., supernatants were harvested for particle preparation and the cells were lysed. Cellular extracts (upper panel) and particles (lower panel) were analyzed by immunoblotting with cat serum 8014. The positions of molecular mass markers are shown in kDa at the right hand margin, names of the detected FFV Gag proteins are given at the left hand margin. wt: pCF-7, mock: untransfected cells. (b) Enhancing effect of NaB on FFV vector production. 293T cells were transfected with 4 μg pCF-Δ-ubi-lacZ plus 2 μg pBC-FFV-Env (left) and 2 μg pCF-Δ-ubi-lacZ plus 1 μg pBC-FFV-Env plus 3 μg pUC19 DNA (right) and NaB was added to a final concentration of 8 mM from 20 to 48 h p.t. (solid bars) or mock-treated (light bars). Thereafter, vector titers were determined using CRFK target cells and expressed as TU/ml. Error bars are given. (c) Enhancing effect of multiple transductions on marker gene transfer efficiency. In two independent experiments (diamonds and triangles), vector pCF-Δ-ubi-lacZ was generated by transient transfection as described and used for low MOI (0.1–0.2) transduction of CRFK cells. Vector transductions were repeated twice a day. All transduced samples were fixed and stained 2 days after the last transduction. The efficiency of marker gene transfer is expressed as percentage of stained cells.

In summary, the novel FFV ubi-lacZ vectors direct the production of functional vector particles. However, the efficiency of vector protein processing and release is reduced.

Optimization of vector titers

To obtain higher vector titers, we studied the transfection conditions by co-transfection of 2 μg of the vector genome pCF-SIN-ubi-lacZ with different amounts of pBC-FFV-Env and determined the titers 2 days later. As already observed with the env-deleted vectors, the ubi-lacZ vector-mediated gene transfer is Env-dependent. At least 1 μg pBC-FFV-Env was necessary to obtain vector titers above 104 TU/ml. Increasing the amount of Env was in general accompanied by further increased titers (data not shown). Co-expression of the accessory Bet protein34 in the vector-producing 293T cells did not reproducibly increase vector titers.

We then analyzed whether addition of sodium butyrate (NaB) to the transfected cells does increase the vector titers. For this purpose, NaB was added to the 293T cell medium at a final concentration of 8 mM from 20 to 48 h after co-transfection of pCF-Δ-ubi-lacZ and pBC-FFV-Env (Figure 3b). Vector titers were determined using CRFK cells and compared with controls without NaB. In independent experiments and using different DNA concentrations, NaB increased vector titers two to threefold.

Optimization of transduction efficiencies

We next analyzed whether transduction efficiency can be increased by multiple rounds of vector expositions. For this purpose, CRFK cells were transduced with multiplicities of infection (MOI) of 0.1–0.2 either once or repeatedly (up to five times). Transduction rates increased mainly after the second and third consecutive transduction whereas further treatments yielded only minor effects (Figure 3c). As expected, transductions at high MOI showed only minor increases as already a high percentage of cells had been transduced (data not shown). These data correlate with those for other viral vectors.35 Thus, multiple transductions may be especially suited for cells with a low sensitivity towards FFV vector transduction or low-concentrated vector stocks.

Long-term transduction with ubi-lacZ vectors

We next analyzed the stability of transgene expression in ubi-lacZ vector-transduced CRFK cells. These cells transduced with the different ubi-lacZ vectors were split twice a week for up to 10 weeks. In regular intervals, parts of the culture were assayed for lacZ expression and the percentage of stained cells was determined. Comparing the initial number of marker gene expressing cells to the final number at the end of the study, in two out of three cases, a two- to threefold reduction of the number of positive cells was apparent. The third study did not show a decline of transduced cells. Vector-derived RCRs were not detected in any of these long-term studies.

pCF-SIN-ubi-lacZ vectors are not reactivated by wt FFV super-infection

The ubi-lacZ FFV vector genomes are flanked by LTRs upon integration into the target cell genome. Thus, we studied whether the integrated vectors are reactivated by wt FFV super-infection. For this purpose, CRFK cells transduced with the ubi-lacZ vectors with the intact, partially deleted and SIN LTR (and untreated controls) were wt FFV-infected. Supernatants were harvested 2 days after super-infection when strong syncytia developed. The clarified supernatants were then added to fresh CRFK cells (reporter culture) to determine whether lacZ expression indicative for vector reactivation had occurred. All reporter cultures developed syncytia which were induced by wt FFV (Figure 4d–f). FFV infection of CRFK cells transduced with intact and ΔU3 LTR ubi-lacZ vectors resulted additionally in lacZ transduction and dark-blue stained nuclei in the reporter cultures indicative of vector rescue (Figure 4e and f) similar to that obtained directly after transduction with the pCF-SIN-ubi-lacZ (Figure 4c). The titers of reactivated vectors were about 104 TU/ml. In contrast, the LTR promoter-deficient pCF-SIN-ubi-lacZ vector did not yield any detectable marker gene transfer (Figure 4d) indicating that no vector reactivation occurred. The controls of untreated or only FFV-infected CRFK cells (Figure 4a and b) as well as reporter cultures from ubi-lacZ-transduced but not FFV super-infected cells (data not shown) did not show stained nuclei. These data were confirmed in two independent experiments.

Figure 4
figure4

The pCF-SIN-ubi-lacZ vector genome is not reactivated by wt FFV. Vectors pCF-7-ubi-lacZ, pCF-Δ-ubi-lacZ and pCF-SIN-ubi-lacZ were generated using standard methods and used to transduce CRFK cells at a MOI of 0.3. The transduced cells were super-infected with FFV after the fourth passage. Two days after super-infection, the cell culture supernatants were harvested, cleared by low-speed centrifugation and used to transduce/infect CRFK cells as a reporter culture. As controls, CRFK cells were mock-infected (a), FFV-infected (b) and pCF-SIN-ubi-lacZ-transduced (c). Two days later, reporter and control cultures were fixed and stained for lacZ expression. All reporter cultures (df) developed syncytia similar to the FFV-infected control (b). Reporter cultures from pCF-Δ-ubi-lacZ- and pCF-7-ubi-lacZ-transduced cells (e and f) showed in addition strong nuclear lacZ staining in syncytia and single cells. In contrast, pCF-SIN-ubi-lacZ reporter cells showed syncytia without any evidence for lacZ marker gene transduction (d) similar to the FFV-infected controls (b). As expected, pCF-SIN-ubi-lacZ-transduced cells displayed nuclear staining without syncytia induction (c). Images were taken at a 250-fold magnification. The solid arrows mark syncytia and the dashed arrows point to single cells with specifically lacZ-stained nuclei.

Transduction of different cell types with ubi-lacZ vectors

Finally, diverse human and non-human cells from different organs were assayed for transduction by vectors pCF-7-ubi-lacZ and pCF-SIN-ubi-lacZ. Several of these cells were transduced with high or intermediate efficiency (Table 2). Cells permissive for FFV replication showed in general also a considerable permissiveness towards FFV vector transduction. Remarkably, most murine cells showed low permissiveness indicating that mouse cells express restriction factors counteracting transduction by FFV vectors.

Table 2 Susceptibility of different cell types towards FFV vector transduction

Discussion

In the present paper, we describe the construction and functional characterization of novel replication-deficient retroviral vectors based on the FFV genome. The vectors constructed display a highly advantageous safety profile and are suited for transduction of a broad range of different human and non-human cells. This limited target cell specificity may be even advantageous provided that vector targeting can be achieved by other means (e.g. by direct injection into the tumour) or when this is not strictly required (e.g. in case of ex vivo transduction regimen).

The env-bel-deficient ubi-lacZ vectors are much safer than previous FFV vectors:4 (i) the generation of RCR has not been detected using these vectors, (ii) ubi-lacZ vectors with the SIN deletion in the LTR are not reactivated by super-infection with wt FFV and (iii) the absence of significant amounts of SIN LTR-directed viral transcripts was confirmed by reverse transcription polymerase chain reaction (PCR)-based expression studies (data not shown). This indicates that the SIN-deleted 5′-LTR did not direct expression of genomic vector transcripts. We conclude that also the 3′-LTR with the corresponding SIN deletion is transcriptionally silent. Thus, the pCF-SIN-ubi-lacZ vector is unlikely to direct expression of flanking cellular sequences from the viral LTR promoters. With respect to vector safety, the complete inactivation of the SIN LTR in the FFV ubi-lacZ vectors adds up to the low preference for FV integration into transcribed genes as it is known for lentivirus-based vectors.18, 19, 36

To further enhance the safety profile of these FFV vectors, it is reasonable trying to avoid run-through transcription from the heterologous ubi promoter and to molecularly characterize the integration site preference of FFV (see also below).

In addition, a scenario of vector reactivation by infection with the parental wt FFV is unlikely considering the application of a feline-derived vector in men, a setting where also a pre-existing immunity against the vector is unlikely. Even when the FFV ubi-lacZ vectors are used during pre-clinical trials in cats (or in the course of cat gene therapy), simple recombination events between the integrated and multiply engineered vector genome and the wt exogenous parental virus are not sufficient for creating RCRs confirming the advantageous safety profile of the FFV env-bel-deficient vectors. The functional characterization of these novel FFV-based vectors in the authentic, immuno-competent and not inbred host, the cat, is challenging but feasible. For instance, we recently showed that replication-competent vectors that are directly related to the replication-deficient ubi-lacZ vectors are efficient at expressing a heterologous vaccine antigen without any side effects.6 In order to use the current vectors in animal experiments, we employed the constitutively active human ubi C promoter for transgene expression as this promoter displays long-term activity in several cell types from men and a broad range of animals.37 In addition, mapping of vector integration sites in the authentic animal model will become possible considering the success of the cat genome sequencing project.38 Currently, no information is available on the integration site specificity and frequency of FFV in infected or transduced cells. As FV infection is known to induce super-infection resistance and as FFV does not retro-integrate upon infection, we assume that in general a single provirus is integrated per transduced cell.39, 40

The expected whole cat genome sequence may also explain why the number of marker gene-expressing cells decreased over time as observed in two out of three experiments: vector integration into heterochromatic areas of the genome with the subsequent suppression of transgene expression might be the underlying mechanism. We are currently underway to address this issue by using inhibitors of DNA methylation and by the utilization of alternative reporter genes. Alternatively, the nuclear localized LacZ enzyme expressed by our vectors could have toxic or detrimental effects as discussed recently thus leading to a counter-selection against transduced cells.41

Our study reveals that not only the closely related FVs of simian and higher primates but also the distantly related FFV cannot be pseudotyped by heterologous surface glycoproteins of different origin. Even the Env protein from the human/primate FV did not allow efficient marker gene transduction, underlining the concept that highly specific Gag–Env interactions are required for proper particle assembly although other reasons cannot be formally excluded.29, 30 In addition, we did not find a significant effect of Bet on the vector titer, as the 293T cells used for vector production are APOBEC3-deficient and thus, the deaminase-counteracting function of Bet is not required.22 Additional effects of Bet on FFV vector particle release were not observed in this study.

FV vectors have intrinsic advantages, for example, the high physical and genetic stability, apathogenicity of the parental viruses, capacity for the uptake of larger foreign DNA sequences and reduced dependence on replicating cells.9 To fully appreciate the potential of the novel FFV ubi-lacZ vectors, improvements in vector production and titer as well as a better understanding of target cell and integration site specificity are required.

Materials and methods

Virus and cells

293T cells and FFV-FAB titration cells were grown as reported previously.26 Transfection of recombinant DNA into 293T cells was performed by calcium co-precipitation.42 The infectivity of FFV-derived replication competent vectors and the transduction efficiencies of replication-deficient vectors were assayed using FFV-FAB cells and CRFK cells grown in 24-well plates.26

To normalize transfection efficiencies of different vector constructs, 1 μg of the SEAP plasmid pCMV-SEAP was co-transfected.43 Two days later, an aliquot of the supernatant was harvested and SEAP chemoluminescent detection was performed as recommended (Roche, Mannheim, Germany). Vector titers were normalized to co-expressed SEAP activity and are expressed relative to the replication competent vector pCF-Bet-Gfp.

To analyze long-term transduction of FFV vectors, vector stocks from transfected 293T cells were used to transduce permissive CRFK cells.4 Transduced cells were serially passaged twice a week and the supernatants were analysed for RCRs by infection of FFV-FAB cells.4 In parallel, duration of Gfp expression from Gfp transducing vectors was determined by microscopy of the transduced CRFK cultures.

For the transduction of different target cell lines, cells were grown in six-well plates and transduced with 1 ml of vector particle containing cell culture supernatants. Three days after transduction, the efficiency was determined by lacZ staining.

To purify FFV particles, cell culture supernatants from transfected 293T cells were harvested 2 days p.t., and cleared by low-speed centrifugation. Particles were sedimented through 2 ml of 20% (wt/vol) sucrose in phosphate buffer saline (PBS) for 2 h at 28 000 r.p.m in a SW 41 rotor (Beckman, Munich, Germany) and resuspended in protein lysis buffer.30

Molecular cloning

To delete the major parts of env (from RNA position 5340 to 7676) without deleting the internal promoter, FFV sequences were amplified in a standard polymerase chain reaction (PCR) with primers 8746S (5′-IndexTermTCAGTC GACTCATCCTGAGTTAACGCGTACGACAGACTGTG GCATACC-3′), which contains a recognition site for SalI (underlined) and 9390AS (5′-IndexTermCAACAATTTTACTGG TATGC-3′) using pCF-Bet-Gfp as template.4, 5 To obtain the env deleted vectors pCF-7ΔEnv, pCF-Bet-GfpΔEnv and pCF-Bet-Gfp-SINΔEnv the vectors pCF-7, pCF-Bet-Gfp and pCF-Bet-Gfp-SIN and the PCR product were digested with SalI and Bsu36I and ligated.

For construction of ubi-lacZ vectors, the plasmid pGem7-ubi-lacZ containing the ubi promoter upstream of the lacZ gene was first constructed. For this purpose, plasmid pGem1nlslacZ was digested with SalI and BamHI to excise the lacZ gene.33 The ubi promoter-containing plasmid #17.XhoI32 was digested with XhoI and BamHI and the lacZ gene was inserted downstream of the ubi promoter.

The ubi-lacZ expression cassette was inserted by two slightly different methods into the replication-competent vectors pCF-7 and pCF-ΔU3 and the replication-deficient vector pCF-SIN.4, 5 In the first series of ubi-lacZ vectors called pCF-7-ubi-lacZ, pCF-Δ-ubi-lacZ and pCF-SIN-ubi-lacZ, the pol gene was left intact and 138 bp of the 5′ end of env were maintained in the vector genome. The deletion ranges from the Acc65I site (RNA genome position 5383) at the 5′ end of env to the BamHI site in bel2 about 250 bp upstream of the 3′-LTR (RNA genome position 9022). The vector genomes pCF-7, pCF-ΔU3 and pCF-SIN were digested with Acc65I, blunt ended with Klenow enzyme, and digested with BamHI. The plasmid pGem7-ubi-lacZ was digested with SalI, blunt ended with Klenow enzyme and digested with BamHI. Thereafter, the ubi-lacZ fragment was ligated with the vector genomes.

In the second type of ubi-lacZ vectors called pCF-7-ubi-lacZ-SB, pCF-Δ-ubi-lacZ-SB and pCF-SIN-ubi-lacZ-SB, the deletion in the vector genome ranges from the SalI site in the 3′ end of pol (RNA genome position 5323) to the BamHI site in bel2. In these vectors, the last three codons of pol were deleted and only 79 bp of the 5′ end of env were maintained. For clonings, plasmid pGem7-ubi-lacZ and the vector genomes pCF-7, pCF-ΔU3 and pCF-SIN were digested with SalI and BamHI and the ubi-lacZ cassette was ligated into the vector genomes.

Immunoblot analyses

Transfected cells were harvested by lysis in 1% sodium dodecyl sulphate. Immunoblotting of proteins separated on denaturing gels and detection of specifically bound antibodies by enhanced chemoluminescence was carried out as previously described.44 Cat 8014 antiserum was used as described previously.23, 45

References

  1. 1

    Verma IM, Weitzman MD . Gene therapy: twenty-first century medicine. Annu Rev Biochem 2005; 74: 711–738.

    CAS  Article  Google Scholar 

  2. 2

    Baum C, von Kalle C, Staal FJ, Li Z, Fehse B, Schmidt M et al. Chance or necessity? Insertional mutagenesis in gene therapy and its consequences. Mol Ther 2004; 9: 5–13.

    CAS  Article  Google Scholar 

  3. 3

    Pandya S, Klimatcheva E, Planelles V . Lentivirus and foamy virus vectors: novel gene therapy tools. Expert Opin Biol Ther 2001; 1: 17–40.

    CAS  Article  Google Scholar 

  4. 4

    Bastone P, Löchelt M . Kinetics and characteristics of replication-competent revertants derived from self-inactivating foamy virus vectors. Gene Therapy 2004; 11: 465–473.

    CAS  Article  Google Scholar 

  5. 5

    Schwantes A, Ortlepp I, Löchelt M . Construction and functional characterization of feline foamy virus-based retroviral vectors. Virology 2002; 301: 53–63.

    CAS  Article  Google Scholar 

  6. 6

    Schwantes A, Truyen U, Weikel J, Weiss C, Löchelt M . Application of chimeric feline foamy virus-based retroviral vectors for the induction of antiviral immunity in cats. J Virol 2003; 77: 7830–7842.

    CAS  Article  Google Scholar 

  7. 7

    Leurs C, Jansen M, Pollok KE, Heinkelein M, Schmidt M, Wissler M et al. Comparison of three retroviral vector systems for transduction of nonobese diabetic/severe combined immunodeficiency mice repopulating human CD34(+) cord blood cells. Hum Gene Therapy 2003; 14: 509–519.

    CAS  Article  Google Scholar 

  8. 8

    Heinkelein M, Hoffmann U, Lucke M, Imrich H, Müller JG, Meixensberger J et al. Experimental therapy of allogeneic solid tumors induced in athymic mice with suicide gene-transducing replication-competent foamy virus vectors. Cancer Gene Therapy 2005; 12: 947–953.

    CAS  Article  Google Scholar 

  9. 9

    Mergia A, Heinkelein M . Foamy virus vectors. Curr Top Microbiol Immunol 2003; 277: 131–159.

    CAS  PubMed  Google Scholar 

  10. 10

    Moore MD, McGarvey MJ, Russel RA, Cullen BR, McClure MO . Stable inhibition of hepatitis B virus proteins by small interfering RNA expressed from viral vectors. J Gene Med 2005; 7: 918–925.

    CAS  Article  Google Scholar 

  11. 11

    Josephson NC, Trobridge G, Russell DW . Transduction of long-term and mobilized peripheral blood-derived NOD/SCID repopulating cells by foamy virus vectors. Hum Gene Therapy 2004; 15: 87–92.

    CAS  Article  Google Scholar 

  12. 12

    Josephson NC, Vassilopoulos G, Trobridge GD, Priestley GV, Wood BL, Papayannopoulou T et al. Transduction of human NOD/SCID-repopulating cells with both lymphoid and myeloid potential by foamy virus vectors. Proc Natl Acad Sci USA 2002; 99: 8295–8300.

    CAS  Article  Google Scholar 

  13. 13

    Trobridge G, Vassilopoulos G, Josephson N, Russell DW . Gene transfer with foamy virus vectors. Methods Enzymol 2002; 346: 628–648.

    CAS  Article  Google Scholar 

  14. 14

    Heneine W, Schweizer M, Sandstrom P, Folks T . Human infection with foamy viruses. Curr Top Microbiol Immunol 2003; 277: 181–196.

    CAS  PubMed  Google Scholar 

  15. 15

    Saib A . Non-primate foamy viruses. Curr Top Microbiol Immunol 2003; 277: 197–211.

    CAS  PubMed  Google Scholar 

  16. 16

    Linial ML . Foamy viruses are unconventional retroviruses. J Virol 1999; 73: 1747–1755.

    CAS  PubMed  PubMed Central  Google Scholar 

  17. 17

    Falcone V, Schweizer M, Neumann-Haefelin D . Replication of primate foamy viruses in natural and experimental hosts. Curr Top Microbiol Immunol 2003; 277: 161–180.

    CAS  PubMed  Google Scholar 

  18. 18

    Trobridge GD, Miller DG, Jacobs MA, Allen JM, Kiem HP, Kaul R et al. Foamy virus vector integration sites in normal human cells. Proc Natl Acad Sci USA 2006; 103: 1498–1503.

    CAS  Article  Google Scholar 

  19. 19

    Nowrouzi A, Dittrich M, Klanke C, Heinkelein M, Rammling M, Dandekar T et al. Genome-wide mapping of foamy virus vector integrations into a human cell line. J Gen Virol 2006; 87: 1339–1347.

    CAS  Article  Google Scholar 

  20. 20

    Bastone P, Bravo IG, Löchelt M . Feline foamy virus-mediated marker gene transfer: identification of essential genetic elements and influence of truncated and chimeric proteins. Virology 2006; 348: 190–199.

    CAS  Article  Google Scholar 

  21. 21

    Löchelt M . Foamy virus transactivation and gene expression. Curr Top Microbiol Immunol 2003; 277: 27–61.

    PubMed  Google Scholar 

  22. 22

    Löchelt M, Romen F, Bastone P, Muckenfuss H, Kirchner N, Kim Y-B et al. The antiretroviral activity of APOBEC3 is inhibited by the foamy virus accessory Bet protein. Proc Natl Acad Sci USA 2005; 102: 7982–7987.

    Article  Google Scholar 

  23. 23

    Alke A, Schwantes A, Zemba A, Flügel R-M, Löchelt M . Characterization of the humoral immune response and virus replication in cats experimentally infected with feline foamy virus. Virology 2000; 275: 170–176.

    CAS  Article  Google Scholar 

  24. 24

    Pietschmann T, Heinkelein M, Heldmann M, Zentgraf H, Rethwilm A, Lindemann D . Foamy virus capsids require the cognate envelope protein for particle export. J Virol 1999; 73: 2613–2621.

    CAS  PubMed  PubMed Central  Google Scholar 

  25. 25

    Baldwin DN, Linial ML . The roles of Pol and Env in the assembly pathway of human foamy virus. J Virol 1998; 72: 3658–3665.

    CAS  PubMed  PubMed Central  Google Scholar 

  26. 26

    Zemba M, Alke A, Bodem J, Winkler IG, Flower RLP, Pfrepper K-I et al. Construction of infectious feline foamy virus genomes: cat antisera do not cross-neutralize feline foamy virus chimera with serotype-specific Env sequences. Virology 2000; 266: 150–156.

    CAS  Article  Google Scholar 

  27. 27

    Trobridge G, Josephson N, Vassilopoulos G, Mac J, Russell DW . Improved foamy virus vectors with minimal viral sequences. Mol Ther 2002; 6: 321–328.

    CAS  Article  Google Scholar 

  28. 28

    Flower RL, Wilcox GE, Cook RD, Ellis TM . Detection and prevalence of serotypes of feline syncytial spumaviruses. Arch Virol 1985; 83: 53–63.

    CAS  Article  Google Scholar 

  29. 29

    Lindemann D, Pietschmann T, Picard-Maureau M, Berg A, Heinkelein M, Thurow J et al. A particle-associated glycoprotein signal peptide essential for virus maturation and infectivity. J Virol 2001; 75: 5762–5771.

    CAS  Article  Google Scholar 

  30. 30

    Wilk T, Geiselhart V, Frech M, Fuller SD, Flügel RM, Löchelt M . Specific interaction of a novel foamy virus Env leader protein with the N-terminal Gag domain. J Virol 2001; 75: 7995–8007.

    CAS  Article  Google Scholar 

  31. 31

    Cronin J, Zhang XY, Reiser J . Altering the tropism of lentiviral vectors through pseudotyping. Curr Gene Therapy 2005; 5: 387–398.

    CAS  Article  Google Scholar 

  32. 32

    Schorpp M, Jager R, Schellander K, Schenkel J, Wagner EF, Weiher H et al. The human ubiquitin C promoter directs high ubiquitous expression of transgenes in mice. Nucleic Acids Res 1996; 24: 1787–1788.

    CAS  Article  Google Scholar 

  33. 33

    Bonnerot C, Rocancourt D, Briand P, Grimber G, Nicolas J-F . A beta-galactosidase hybrid protein targeted to nuclei as a marker for developmental studies. Proc Natl Acad Sci USA 1987; 84: 6795–6799.

    CAS  Article  Google Scholar 

  34. 34

    Alke A, Schwantes A, Kudo K, Flötenmeyer M, Flügel RM, Löchelt M . The bet gene of feline foamy virus is required for virus replication. Virology 2001; 287: 310–320.

    CAS  Article  Google Scholar 

  35. 35

    Marx JC, Allay JA, Persons DA, Nooner SA, Hargrove PW, Kelly PF et al. High-efficiency transduction and long-term gene expression with a murine stem cell retroviral vector encoding the green fluorescent protein in human marrow stromal cells. Hum Gene Therapy 1999; 10: 1163–1173.

    CAS  Article  Google Scholar 

  36. 36

    Mitchell RS, Beitzel BF, Schroder AR, Shinn P, Chen H, Berry CC et al. Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol 2004; 2: E234.

    Article  Google Scholar 

  37. 37

    Gill DR, Smyth SE, Goddard CA, Pringle IA, Higgins CF, Colledge WH et al. Increased persistence of lung gene expression using plasmids containing the ubiquitin C or elongation factor 1alpha promoter. Gene Therapy 2001; 8: 1539–1546.

    CAS  Article  Google Scholar 

  38. 38

    O'Brien SJ, Menotti-Raymond M, Murphy WJ, Yuhki N . The feline genome project. Annu Rev Genet 2002; 36: 657–686.

    CAS  Article  Google Scholar 

  39. 39

    Bock M, Heinkelein M, Lindemann D, Rethwilm A . Cells expressing the human foamy virus (HFV) accessory Bet protein are resistant to productive HFV super-infection. Virology 1998; 250: 194–204.

    CAS  Article  Google Scholar 

  40. 40

    Roy J, Rudolph W, Juretzek T, Gärtner K, Bock M, Herchenröder O et al. Feline foamy virus genome and replication strategy. J Virol 2003; 77: 11324–11331.

    CAS  Article  Google Scholar 

  41. 41

    Callahan SM, Boquet MP, Ming X, Brunner LJ, Croyle MA . Impact of transgene expression on drug metabolism following systemic adenoviral vector administration. J Gene Med 2006; 8: 566–567.

    CAS  Article  Google Scholar 

  42. 42

    Wagner A, Doerks A, Aboud M, Alonso M, Tokino T, Flügel RM et al. Induction of cellular genes is mediated by the Bel1 transactivator in foamy virus-infected human cells. J Virol 2000; 74: 4441–4447.

    CAS  Article  Google Scholar 

  43. 43

    Berger J, Hauber J, Hauber R, Geiger R, Cullen BR . Secreted placental alkaline phosphatase: a powerful new quantitative indicator of gene expression in eukaryotic cells. Gene 1988; 66: 1–10.

    CAS  Article  Google Scholar 

  44. 44

    Winkler I, Bodem J, Haas L, Zemba M, Delius H, Flower RP et al. Characterization of the genome of feline foamy virus and its proteins shows distinct features different from those of primate spumaviruses. J Virol 1997; 71: 6727–6741.

    CAS  PubMed  PubMed Central  Google Scholar 

  45. 45

    Geiselhart V, Schwantes A, Bastone P, Frech M, Löchelt M . Features of the Env leader protein and the N-terminal Gag domain of feline foamy virus important for virus morphogenesis. Virology 2003; 310: 235–244.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We thank JF Nicolas (Institut Pasteur, Paris), A Alonso and B Hartenstein (DKFZ) for plasmid constructs and L Gissmann (DKFZ) for continuous support.

Author information

Affiliations

Authors

Corresponding author

Correspondence to M Löchelt.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Bastone, P., Romen, F., Liu, W. et al. Construction and characterization of efficient, stable and safe replication-deficient foamy virus vectors. Gene Ther 14, 613–620 (2007). https://doi.org/10.1038/sj.gt.3302890

Download citation

Keywords

  • feline foamy virus
  • retrovirus
  • replication-deficient vector
  • biosafety
  • SIN vector

Further reading

Search

Quick links