SV40-derived vectors provide effective transgene expression and inhibition of HIV-1 using constitutive, conditional,and pol III promoters

Article metrics

Abstract

Vectors based on recombinant SV40 viruses (rSV40) are highly effective in delivering transgene expression driven by constitutive promoters. We tested here whether these vectors could be used with conditional promoters and promoters using RNA polymerase III transcription, with inhibition of HIV-1 by Tat activation response (TAR) decoys as a functional measure of effective transgene delivery and activity. TAR decoys inhibit HIV-1 Tat, a trans-activator of HIV-1 transcription. Tat acts early in the viral replicative cycle and is essential for efficient viral replication. We evaluated rSV40 gene delivery using two different inhibitors of Tat. One was a dual function polyTAR gene encoding 25 sequential TAR elements (TAR25), plus an antisense tat, driven either by HIV-1 long terminal repeat (HIV-LTR) as a conditional promoter, or by cytomegalovirus immediate–early promoter (CMV-IEP) as a constitutive promoter. The other inhibitor was a single TAR decoy, driven by the U6 small nuclear RNA promoter (U6-P). These decoys were delivered to unselected cells in two different human T lymphocyte lines and to unstimulated primary human peripheral blood mononuclear cells (pbmc). Gene delivery was confirmed by PCR, and expression by RT-PCR. By in situ hybridization analysis, >95% of cells were transduced. These transgene constructs protected all cell types tested from HIV-1, as measured by syncytia formation and p24 antigen release. Somewhat better inhibition of HIV-1 replication was achieved with HIV-1 long terminal repeat (HIV-1 LTR) as a conditional promoter than with the constitutive CMV-IEP. The U6-P was also very effective, driving a TAR1 transcript. Cell viability was not detectably affected by TAR decoy expression. Thus, rSV40 vectors effectively deliver HIV-1-inhibitory RNAs using either constitutive or conditional pol II promoters, or using a pol III promoter. The versatility of this gene delivery system may prove to be useful in anti-HIV-1 therapeutics.

Introduction

Vectors derived from recombinant, replication-deficient SV40 (rSV40) are reported to be effective in delivering constitutively expressed cDNAs that encode protein products to many different cell types.1,2 The ability of this vector system to deliver untranslated RNA products has not, however, been extensively studied. Accordingly, we tested rSV40 gene delivery using both constitutive and conditional RNA polymerase II (pol II)-transcribed promoters, as well as a pol III promoter. The genes used to test delivery in this system were monomeric and polymeric decoy sequences corresponding to the HIV-1 Tat activation response element (TAR).3

HIV-1 Tat protein is a trans-activator of transcription for all HIV-1 genes, acting primarily at the level of transcriptional elongation rather than initiation.4,5,6 Tat function depends on a bulged RNA stem–loop structure, TAR, at the 5′-end of all HIV-1 mRNAs. The highly conserved interaction between Tat and TAR, and their combined effect on host cell transcription factors are essential for HIV-1 replication.7 Therefore blocking replication of the virus by inhibiting tat function is an attractive strategy for gene therapy of HIV-1 infection.

In order to inhibit Tat function in HIV-1 infected cells, we prepared two different constructs. One was a simple, single TAR sequence, driven by the U6 small nuclear RNA (snRNA) promoter.8,9,10,11 The other was dual function construct (polyTAR) containing a string of 25 TAR sequence (TAR25) followed by an antisense-tat sequence (A/tat). TAR decoys, whether single or polymeric, were designed to sequester HIV-1 Tat protein by recapitulating HIV-1 TAR RNA sequences; the A/tat is intended to block Tat translation from its mRNA.3,12

Sequestering Tat by delivering TAR decoys is specifically advantageous for dealing with the high mutability of HIV-1, which is a major problem in HIV-1-infected patients. Escape from TAR decoy inhibition would require unlikely synchronous, coordinate mutations of HIV-1 tat and TAR to retain the interaction between these two molecules and preserve HIV-1 genome replication.13

We used rSV40 vectors to deliver this polyTAR construct because they provide long-term, very efficient, transduction of many cell types, including lymphocytes, and do not require selection.1,2 These vectors have been used to deliver a range of transgenes to inhibit HIV-1 replication,14 making them potentially attractive for use in HIV-1-directed gene therapeutics. Use of these vectors to transduce cell lines and human peripheral blood mononuclear cells (PBMC) without selection has been described.1,15 Most reported uses of rSV40 gene delivery have involved constitutive RNA polymerase II promoters to express proteins; so we chose to test whether rSV40 vectors could deliver untranslated TAR decoys driven by pol III and conditional pol II promoters, in addition to a constitutive pol II promoter.

We report here that rSV40 vectors successfully delivered the U6-TAR1 construct, as well as both constitutive and conditional polyTAR expression. Further, replication of HIV-1, as measured by HIV-1 p24 antigen production and syncytia formation, was significantly inhibited in both cell lines and primary human cells transduced with these constructs.

Results

Detection of polyTAR sequence in SV(polyTAR) and SV[CMV](polyTAR)-treated cells

SV(polyTAR), carrying the polyTAR transgene driven by HIV-1 LTR (Figure 1), was produced by excising the rSV40 genome from pT7A (Figure 1), and packaging the recombinant virus according to procedures described in Materials and methods. SV[CMV](polyTAR) carries the same transgene, but with expression driven by the cytomegalovirus immediate–early promoter (CMV-IEP). SupT1 cells were transduced with SV(polyTAR), SV[CMV](polyTAR) or with SV(HBS), as described in Materials and methods. DNA was prepared from these cells 24 h later, and PCR done as described. The reaction mixture was electrophoresed, transferred to a nylon membrane, and hybridized to a 32P-labeled DNA probe for the A/tat sequence. These studies confirmed the presence of polyTAR DNA delivered by SV(polyTAR) and SV[CMV](polyTAR) to SupT1 cells (Figure 2).

Figure 1
figure1

Maps of SV(polyTAR) and SV[U6]TAR. SV(polyTAR): in this virus, expression of polyTAR and A/tat (shown) is driven by HIV-1 LTR as a promoter (shown). The HIV-1 LTR is immediately downstream from SV40 early promoter (EP). Transcription from EP is blocked by multiple tandem polyadenylation signals (shown). Transcription of the polyTAR + A/tat sequences is terminated by the SV40 polyA signal (shown). Viral late (capsid) genes (VP1, VP2 and VP3), and regulatory sequences are intact in this construct. SV[CMV](PolyTAR) (not shown) is similar, save that HIV-1 LTR is replaced by CMV-IEP as a promoter. (b) SV[U6]TAR: to make this construct, the HIV-1 LTR + polyTAR transgene were excised and replaced by a modified U6 snRNA gene. The modified U6 gene included the U6-P followed by U6 snRNA, interrupted by a single TAR sequence, inserted into an engineered deletion (see Materials and methods). The remainder of the U6 transcript, plus the pol III termination signal follow.

Figure 2
figure2

PCR and Southern blot analysis of delivery of polyTAR + A/tat to SupT1 cells transduced with SV(PolyTAR). SupT1 cells were transduced with SV(PolyTAR), for 24 h at MOI of 10. This step was repeated two more times on subsequent days, but at MOI of 3. Control cells were transduced with SV(HBS), or were untransduced. DNA was collected 24 h after the third transduction, and PCR and Southern analyses were done as described in Materials and methods. The 216 bp PCR product is indicated (arrow).

Cytotoxicity of polyTAR expression and rSV40-transduction for SupT1 cells

It was important to establish whether transduction of SupT1 cells with the rSV40 vectors used had any effect on cell viability. Thus, we tested cell viability 10 days after transduction with SV(polyTAR) or SV[CMV] (polyTAR) using the Formazan method described in Materials and methods. SupT1 cell viability in all rSV40-transduced cells was comparable to untransduced SupT1 cells (Figure 3). Thus, transduction with rSV40 vectors carrying polyTAR decoys was not measurably toxic to these cells.

Figure 3
figure3

Assay for cytotoxicity of polyTAR + A/tat expression after SV40-mediated gene transfer. One million SupT1 cells in 3 ml RPMI + 10% fetal bovine serum were added to six-well tissue culture plates. Combined MTS/PMS solution (600 μl) was added to each well, plates were incubated at 30°C for 4 h, and absorbance at 490 nm was recorded using a spectrophotometer. A490 nm is directly related to the number of viable cells in culture.

Transduction efficiency

We tested transduction efficiency by in situ hybridization, using an oligonucleotide probe specific for the rSV40 genome. SupT1 cells were transduced with the rSV40 constructs as described in Materials and methods. Control groups were mock-transduced. After 3 weeks of expansion without selection in culture, rSV40 genome carriage was assessed by in situ hybridization. Greater than 95% of the SupT1 cells carried the virus genome (Figures 4). Results, shown here for SV[CMV](polyTAR), are representative of transduction efficiencies seen with SV(polyTAR) and SV[U6]TAR (not shown).

Figure 4
figure4

Assessment of transduction efficiency using SV[CMV] (polyTAR). SupT1 cells were treated with SV[CMV](polyTAR), at MOI = 10, then 3, then 3 on sequential days, followed by 3 weeks of expansion in culture. Carriage of the rSV40 genome was assessed by in situ hybridization in these and mock-transduced cultures thereafter. Cells in mock-transduced cultures did not show hybridization with the SV40 oligonucleotide probe (left, original magnification, ×100). In transduced cultures, cells carrying the rSV40 genome stain variably, but clearly darkly (right, original magnification, ×100) in comparison with control cultures. Higher magnification insets are shown to illustrate the differences involved (original magnifications, ×400).

Detection of polyTAR transcript

Expression of polyTAR was assessed by RT-PCR. SupT1 cells were transduced with SV(PolyTAR) or SV[CMV] (PolyTAR). Control cells were transduced with SV(HBS). Total RNA from transduced cells was extracted before and 24 h after challenge with HIV-1NL4–3, and RT-PCR was performed to detect the A/tat sequence. RT-PCR products were electrophoresed, transferred to nylon membranes, and hybridized with a 32P-labeled DNA probe for A/tat, as described in Materials and methods.

In cells transduced with SV(polyTAR) we expected that transgene expression, driven by HIV-1 LTR promoter, would be minimal or absent in unchallenged cells, but that expression of this transcript would be upregulated by HIV-1 Tat protein after challenge with HIV-1.16 This was demonstrated in these experiments (Figure 5). HIV-1 challenge significantly enhanced expression of TAR25 + A/tat in SupT1 cells transduced with SV(PolyTAR). Interestingly, expression of polyTAR driven by CMV-IEP was also apparently increased by HIV-1 challenge.

Figure 5
figure5

RT-PCR analysis of expression of polyTAR. SupT1 cells were transduced with SV(PolyTAR) or SV[CMV](PolyTAR), for 24 h at MOI of 10. This step was repeated two more times on subsequent days, but at MOI of 3. Control cells were transduced with SV(HBS), or were mock transduced. For challenge with HIV-1, the transduced cells were infected with infectious cell-free HIV-1NL4–3 at a challenge dose of 0.1 pg/ml of HIV-1 p24 antigen equivalents, as described in Materials and methods. Total RNA was collected before and 1 day after HIV-1 challenge. RT-PCR and Southern blotting was done as described in Materials and methods. The 216 bp PCR product is indicated (arrow).

Although the RT-PCR performed here was not quantitative, it allows a degree of comparison between transcript levels in like groups. HIV-1-induced expression of TAR25 + A/tat driven by the HIV-1 LTR in HIV-1-challenged cells was much greater than that seen when CMV-IEP was used as promoter (Figure 5). PolyTAR expression in SV(polyTAR)-transduced SupT1 cells was only detectable after HIV-1 challenge. The selective upregulation of HIV-1 LTR promoter by HIV-1 Tat protein most likely facilitated stronger expression driven by this promoter.

PolyTAR delivered by rSV40s inhibits HIV-1 replication in SupT1 cells

We tested whether intracellular expression of polyTAR delivered by rSV40 vectors inhibit HIV-1 replication in SupT1 cells. Control cells were mock-transduced or transduced with SV(HBS). Unselected cultures were then exposed to HIV-1NL4–3 at several challenge doses (TCID50 = 40, 80, 160). These doses of NL4–3 strain of HIV-1 generally yield HIV-1 replication in these cultures to give p24 values >10 ng/ml by 15–18 days of culture in SupT1 cells, and cause >50% cell death by 25–28 days.

After challenge, cell density was maintained at 106 cells/ml, and cultures were examined microscopically for cytopathic effects by observing syncytia formation and cell death. Both SupT1 cultures transduced with SV(polyTAR) and SV[CMV](polyTAR) showed delayed syncytium formation (not shown). Replication of HIV-1 in these cultures was measured by quantitating HIV-1 p24 antigen released into the culture supernatants. Transduction with SV(polyTAR) and SV[CMV](polyTAR) both delayed and greatly inhibited production of HIV-1 p24 antigen, compared with control cells (Figure 6). SV(polyTAR) was very effective at all challenge doses. SV[CMV](polyTAR) was somewhat less effective on higher dose challenge.

Figure 6
figure6

Inhibition of HIV-1 in SupT1 cells transduced SV40 vectors delivering polyTAR. SupT1 cells were transduced with SV(PolyTAR), SV[CMV](PolyTAR) or SV(HBS). Cells were then challenged with cell-free HIV-1NL4–3 virus with (a) 40 and (b) 80 TCID50/106 cells. Replication of HIV-1 was measured as HIV-1 p24 antigen levels in culture supernatants. Data are representative of two independent experiments.

SV(polyTAR) inhibition of HIV-1 in primary cell cultures

Primary cultures of human pbmc were prepared, maintained and transduced as described in Materials and methods, and transduced with SV(polyTAR) or (as a negative control) SV(BUGT). The latter carries as a transgene the bilirubin conjugating enzyme bilirubin UDP-glucuronysyl transferase (BUGT), which is not expected to inhibit HIV. SV(HBS), which we often use as a control vector in studies of cell lines, elicits immune responses in PBMC from hepatitis B-immune donors.17 SV[CMV](polyTAR) was not used in these studies of primary cells since studies in cell lines showed that SV(polyTAR) was consistently as good as, and usually better than, SV[CMV](polyTAR) in protecting from HIV-1 challenge.

Transduction was performed in peripheral blood cell cultures depleted of adherent cells. These cells were cultured in RPMI-1640 supplemented with fetal calf serum and antibiotics, but lacking any additional cytokines. IL-2 was added only after the completion of transduction. Challenge with HIV-1 was carried out as indicated in Materials and methods, and supernatant p24 antigen concentrations were assayed by ELISA. SV(polyTAR) strongly inhibited HIV-1 replication in these primary cell cultures (Figure 7). After HIV-1 challenge, cell viability was constant throughout the study period in SV(polyTAR)-transduced cultures, but declined rapidly in control cultures after 2 weeks post-challenge (not shown).

Figure 7
figure7

Inhibition of HIV-1 in PBMC transduced SV(polyTAR). Primary PBMC were obtained from anonymous donors as described in Materials and methods, then transduced with SV(polyTAR), or, as negative controls, the cells were either untransduced or transduced with SV(BUGT). Cultures were challenged with 4000 TCID50 of HIV-1NL4–3. HIV replication was measured by p24 ELISA in culture supernatants as a function of time.

Inhibition of HIV-1 replication in lymphocyte cell lines transduced with SV[U6]TAR

Having established that rSV40-delivered polymeric TAR decoys inhibit HIV-1, we compared HIV-1 inhibition by SV40-delivered U6-P-driven monomeric TAR with that of SV(polyTAR). The high levels of transcript produced by the U6-P10,11 made it a reasonable candidate to test the ability of rSV40 vectors to exploit pol III promoters in genetic therapy of HIV-1. We used two different cell lines for these studies: SupT1 and CEMX174. These cells were transduced with SV[U6]TAR, SV(polyTAR), or a control vector (SV(HBS)). Expression of TAR1 in SV[U6]TAR was ascertained by RT-PCR analysis: SV[U6]TAR-transduced cells, but not control cells, expressed TAR (not shown).

Unselected transduced and control cells were then challenged with HIV-1 at TCID50 = 80, 160, or 400. Cultures were assayed for HIV-1 p24 antigen and syncytium formation for 5 weeks thereafter. Both SV(polyTAR) and SV[U6]TAR inhibited both syncytium formation (Figure 8) and HIV-1 replication (Figure 9) virtually completely at the lower challenge dose. SV[U6]TAR impeded HIV-1 p24 antigen generation only slightly less well than SV(polyTAR).

Figure 8
figure8

Inhibition of cytopathic effects of HIV-1 infection by polyTAR and TAR1. Syncytia formation in SupT1 and CEMX174 cells was assessed by inverted light microscopy in cultures that had been transduced with SV(PolyTAR), SV[U6]TAR, or (as control) SV(HBS), and then challenged with 80 TCID50 of syncytium-inducing HIV-1NL4–3. Representative photomicrographs of these cultures were taken 14 days after challenge. Representative syncytia are highlighted with arrows.

Figure 9
figure9

Comparative inhibition of HIV-1 in SupT1 and CEMX174 cells transduced with SV(polyTAR) and SV[U6]TAR. SupT1 cells (a), (b) or CEMX174 cells (c) were transduced with SV(PolyTAR), SV[U6](TAR) or, as negative controls, were either untransduced or transduced with SV(HBS). Cells were then challenged with cell-free HIV-1NL4–3 virus with 80 (a), 160 (b), or (c) 400 TCID50/106 cells. HIV-1 replication was measured by ELISA as HIV-1 p24 antigen concentrations in culture supernatants. Data shown are representative of two independent studies.

The effectiveness of rSV40 delivery of a single TAR to inhibit HIV-1 was shown in very short-term studies using much higher challenge doses of HIV-1: TCID50 = 800 and 1600. At these doses, HIV-1 replication was still largely inhibited by SV[U6]TAR (Figure 10). The time course of inhibition seen with these high-dose challenges differed from those seen using lower challenge doses of HIV-1: large differences between control cells and SV[U6]TAR-transduced cells were not evident until later time points. In both series of high-dose challenge studies, however, p24 values in control cultures exceeded those in SV[U6]TAR-transduced cultures by 50–100-fold.

Figure 10
figure10

Inhibition of HIV-1 in short-term cultures of SupT1 cells transduced SV[U6]TAR and challenged with high doses of HIV-1. SupT1 cells were transduced with SV[U6](TAR) or were mock-transduced. They were then challenged with cell-free HIV-1NL4–3 virus with (a) 800 and (b) 1600 TCID50 HIV-1NL4–3 virus/106 cells. Replication of HIV-1 was measured as HIV-1 p24 antigen levels in culture supernatants.

As U6-P drives constitutive TAR1 expression, the potential toxicity of TAR1 in this setting was assessed by the MTT assay as a function of time. By this assay, we found no evidence of decreased viability of SupT1 cells constitutively expressing TAR1 (Figure 11).

Figure 11
figure11

Assay for cytotoxicity of TAR1. One million SupT1 cells, either mock-transduced or transduced with SV[U6]TAR were cultured in 3 ml RPMI + 10% fetal bovine serum were added to a six-well tissue culture plate. At varying times after transduction, combined MTS/PMS solution (600 μl) was added to each well, the plates were incubated at 30°C for 4 h, and the absorbance at 490 nm was recorded using a spectrophotometer. A490 nm is directly related to the number of viable cells in culture.

These data show that rSV40 delivery of a single TAR or TAR25 + A/tat transgenes – whether driven respectively by a snRNA promoter, or by either HIV-1 LTR as a conditional promoter, or a constitutive promoter such as CMV-IEP-protected cell lines and (in the case of polyTAR) primary human peripheral blood cells against HIV-1 infection.

Discussion

Recombinant, replication-defective vectors derived from SV40 have been shown to transfer transgene expression effectively, both in cultured cells and in experimental animals. In this respect, they have delivered durable transgene expression2,18,19 to high percentages of resting and dividing cells1,17 without apparent immunogenicity.17,19 Specifically, a variety of transgenes has been delivered in rSV40 vectors, directed at inhibition of HIV-1 in cultured T cell lines,14 primary cells (D Strayer, in preparation), and in vivo in SCID-hu mice (H Goldstein et al, in preparation). The utility of these constructs reflects the combined effectiveness of potent anti-HIV-1 transgenes and efficient delivery.

However, these approaches to anti-HIV-1 genetic therapy with rSV40 vectors have relied exclusively on constitutive expression of transgenes transcribed by RNA polymerase II, and designed to produce proteins (eg single chain Fv antibodies, mutant HIV-1 proteins).14,20 Here we tested whether rSV40 vectors could effectively deliver anti-HIV-1 transgenes of a different type: untranslated transcripts to bind and sequester HIV-1 Tat protein. Three different expression systems were chosen. In SV(polyTAR), a polymeric string of 25 TAR decoy sequences (+ A/tat) were driven by a conditional promoter, ie HIV-1 LTR, which is active in HIV-1 infected cells, but inactive in the absence of HIV. SV[U6]TAR uses the U6 snRNA promoter, which activates transcription by RNA polymerase III, and produces small RNAs that localize within the nucleus.8,9 These vectors were compared to a more conventional rSV40 vector, in which the CMV-IEP drives expression of the polyTAR transgene constitutively.

The U6-driven transgene consisted of a single TAR moiety. Although the efficiency of polymeric TAR decoys in inhibiting HIV-1 has been reported to improve with increasing numbers of TAR inserts,3 U6 promoter can only drive expression of very small RNAs.8,9 It was therefore elected to evaluate U6-P + TAR1 inhibition of HIV-1 as a measure of rSV40 utility in delivering pol III-driven transgene expression. The TAR1 decoy delivered by SV[U6]TAR could potentially overcome the disadvantage of carrying a single TAR by concentrating that decoy in the nucleus, which is the location of its target, Tat, rather than diluting its effectiveness by distributing it throughout the entire cell.

Retroviral vector delivery of polyTAR to HIV-1 susceptible T cells has been shown to inhibit HIV-1 replication.5,6 HIV-1 LTR-directed expression of CAT reporter genes was inhibited in COS cells when they were cotransfected with plasmid constructs to express multimerized TAR RNA transcripts.21 This suggested that expression of TAR sequences may inhibit HIV-1 LTR-mediated activation of transcription of HIV-1 genome. Also, transient transfection of antisense tat RNA into CD4+ cells acutely infected with HIV-1 blocked virus replication in these cells.22 It has also been reported that TAR sequences delivered by a retroviral vector to CEM SS21 and Molt-3 T cells6 made these cells non-permissive to HIV-1 replication; and that polymeric TAR decoys delivered to HeLa CD4+ cells by adenoviral vectors coupled with DNA-polylysine complexes6 significantly inhibited HIV-1 replication in these cells. As well, polymeric TAR sequences may have additive anti-HIV-1 effects when co-expressed with A/tat in CD4+ T cells.3,22 Antisense RNA against HIV-1, including antisense TAR, has been reported to inhibit HIV-1 when delivered by adeno-associated virus vectors.23

In the present study, we observed that delivery of TAR25 + A/tat to cell lines inhibited HIV-1 replication (as determined by HIV-1 p24 antigen levels and syncytium formation) at challenge doses that normally produce large amounts of p24 antigen and extensive cell death. We used two different promoters to drive polyTAR expression: one was HIV-1 LTR, which was intended to provide Tat-dependent conditional expression, and the other was CMV-IEP, which should yield constitutive expression. Conditional expression of polyTAR driven by HIV-1 LTR as promoter, and expressed in HIV-1-challenged cells only, was documented. Increased expression was also seen with HIV-1 challenge of SV[CMV] (polyTAR)-transduced cells. This phenomenon has been reported previously: CMV-IEP + TAR is activated by HIV-1 Tat.24,25

Thus, this vector system lends itself readily to the use of such conditional promoters. Further, expression of a single TAR, driven by the U6 promoter, also strongly inhibited HIV-1 replication in this assay. It is also important to note that expression of TAR1 and polyTAR were not associated with any detectable toxicity.

Conditional expression of polyTAR genes driven by HIV-1 LTR provided somewhat greater protection than did expression driven by CMV-IEP. Thus, HIV-1 LTR may be a more effective promoter than CMV-IEP in the case of HIV-1-challenged cells. Conditional expression driven by the HIV-1 promoter is thus an efficient way of selectively expressing this therapeutic gene in target cells upon HIV-1 infection. We have demonstrated that other conditional promoters may also be more effective in T lymphocytes than is the CMV-IEP (M Yu et al, in preparation). Since the polyTAR construct targets a phase of the HIV-1 replicative cycle that occurs after integration, its dependence on the HIV-1 promoter allows a high level of effectiveness and specificity. Constitutive expression driven by CMV-IEP was almost as effective as the HIV-1-LTR despite somewhat lower levels of expression. A promoter such as this might also provide for useful intracellular immunization in HIV-1 susceptible cells. However, for polyTAR expression, the HIV-1 LTR appears to be more effective.

After about 21 days post-challenge, p24 antigen levels did increase slowly and HIV-1 replication occurred at low levels in cells carrying the polyTAR therapeutic gene. There could be several explanations for this observation. Although we documented very high levels of transduction a small percentage of untransduced cells may account for the low levels of p24 antigen production. HIV-1 could also circumvent TAR-decoy mediated inhibition, but such an event would require two coordinate mutations, one in tat plus a corresponding mutation in TAR.21 The frequency of such coordinate double mutations is expected to be quite low. Alternatively, the virus could undergo a single mutation in the TAR sequence, so as to increase the affinity of Tat to TAR.21 It is also possible that the level of expression of our transgenes was not high enough to inhibit all virus replication, allowing a low level of persistent p24 production. Fluctuating, or declining, polyTAR expression may also be involved. We have occasionally noted transgene expression to fluctuate over long periods of time in vivo.1 These issues need to be addressed further.

rSV40 vectors have several desirable characteristics as gene delivery vehicles. They are made at very high infectious titers and transduce most cell types, whether resting or dividing, with comparable efficiency.2 We and others have observed high efficiency rSV40 transduction of unstimulated PBMC ex vivo,1,24 and of hepatocytes, neurons and other non-cycling cells in vivo.1,2,18,26,27,28 In the current studies, >95% of SupT1 cells were transduced.

The ability of SV40 to transduce non-proliferating PBMC is specifically important in gene therapy of HIV-1 infection, since non-activated T-lymphocytes and non-proliferating monocytes/macrophages are important cellular reservoirs for HIV-1 in vivo.1 Along these lines, the effectiveness of SV(polyTAR) inhibition of HIV-1 following transduction of unstimulated primary lymphocytes is noteworthy. We have shown that transduction using rSV40 vectors is equally effective in unstimulated and stimulated cells, both PBMC and CD34+ cells.17,18 This observation was confirmed in the current study, and extended to demonstrate that SV(polyTAR) treatment of unstimulated primary human lymphoid cells can protect these cells from HIV-1 challenge. Taken together with the high transduction efficiency (>95%)14,17 without selection, this finding suggests that rSV40, and in particular SV(polyTAR) may be an excellent candidate gene delivery vehicle for inhibiting HIV-1 in patients’ blood and other lymphoid cells. Recent reports indicate that adoptive transfer of modified pbmc or T cells may be an important area of development for the control of viral infections and other diseases;29,30 the currently reported data suggest that rSV40 gene delivery may be facilitate such therapies.

Transducing normal human or simian CD34+ bone marrow progenitor cells with SV40-derived vectors results in long-term transgene carriage, most likely via chromosomal integration17,31 (JR Chowdhury and DS Strayer, in preparation). Along these lines, treatment of simian CD34+ cells with SV(polyTAR) has been shown to protect their differentiated SIV-susceptible progeny (JD Chen et al, in preparation).

The lack of immunogenicity of rSV40 vectors and their high levels of stable transduction of bone marrow-derived cells were highly advantageous for these studies. The combination of a non-immunogenic transgene (ie an untranslated transcript like TAR1 or polyTAR) with rSV40 vectors highlights the importance of avoiding immune elimination of transduced cells in order to facilitate maintaining a pool of cells in which HIV-1 cannot replicate.

In conclusion, we report that rSV40 vectors can be used effectively to deliver anti-HIV-1 TAR decoy-containing transgenes driven by pol III and conditional pol II promoters. In so doing, these vectors protect several human T cell lines and unstimulated primary lymphocyte cultures from HIV-1 challenge. The combination of this highly efficient gene delivery vector with an effective anti-HIV therapeutic gene (such as these) is currently being tested for efficacy in inhibiting SIV in vitro and in vivo.

Materials and methods

Generation of recombinant SV40 carrier plasmid

Construction of SV(polyTAR) began with the plasmid pT7A5.28 This plasmid consists of the SV40 genome, carrying a cytomegalovirus intermediate–early promoter (CMV-IEP) plus a polylinker immediately downstream of the SV40 early promoter (SV40-EP), in place of the Tag gene. The viral genome had been cloned as a PmeI fragment into an engineered PmeI site in a modified pT7blue (Novagen) plasmid.28 The CMV-IEP was deleted and replaced with a string of polyadenylation signals to minimize transcription from the SV40-EP. The polyTAR construct with the HIV-1 long terminal repeat (LTR), 25 TAR sequences (TAR25), plus A/tat5, was prepared by PCR. The template for this PCR was a plasmid bearing these sequences in a Moloney murine leukemia virus (MuLV) genome, and which had been used to deliver the same transgene with a MuLV vector.5 Immediately downstream from the polylinker was the SV40 polyadenylation signal. This construct, pT7A, was designed so that polyTAR transcription would be directed by HIV-1 LTR as a promoter. Thus, transcription of the polyTAR construct would be very low in the absence of infection with HIV-1. This plasmid was used to make SV (polyTAR) virus, a map of which is shown in Figure 1.

A second plasmid, called pT7AΔLTR_CMV, in which the TAR25 + A/tat sequences were driven by CMV-IEP, was constructed form pT7A, by replacing the HIV-1 LTR with CMV-IEP. pT7AΔLTR_CMV was used to generate the viral vector SV[CMV](PolyTAR). pT7A and pT7AΔLTR_CMV are identical except that the HIV-1 LTR in the former was replaced by CMV-IEP in the latter.

The U6-P was used to express a single TAR moiety inserted into a 30 bp deletion in the U6 snRNA coding sequences. An individual TAR sequence was generated using overlapping oligonucleotide primers, amplified by Taq polymerase (Amplitaq, Perkin-Elmer-Cetus). This was cloned into the unique XhoI site of pGEM/ U6/dl(+24,+53) (kind gift of GR Kunkel, Texas A&M University), which contains U6-P and terminator sequences, and part of the U6 snRNA–deleted from bases 24 to 53 to accommodate inserted DNA. After inserting TAR into this plasmid, the promoter-TAR-terminator portion of this construct was amplified by PCR using primers incorporating orienting restriction sites, and then cloned as above, replacing the HIV-LTR and entire poly-TAR gene in pT7A. The resulting construct was used to produce SV[U6]TAR, a map of which is shown in Figure 1.

Production of SV40-derived transducing viruses

The general principles for making recombinant, replication-defective SV40 viral vectors have been described.15 Briefly, the virus genome was excised from a carrier plasmid, gel-purified, recircularized, then transfected into COS-7 cells (ATCC, Washington, DC, USA). We use COS-7 cells to package rSV40 vectors. They supply Tag protein, which is needed for producing infectious, replication-defective SV40 virus, in trans. Crude virus stocks were prepared as cell lysates, then band-purified by sucrose density gradient centrifugation.32 In order to measure the infectivity of replication-deficient SV-40, the viral stocks were titrated by in situ PCR.33 Infectivity of our SV40 viral vector stocks was generally approximately 1011 infectious units (IU)/ml. The recombinant SV40 (rSV40) species derived in this fashion from pT7A was called SV(polyTAR). The rSV40 virus made from pT7AΔLTR_CMV was entitled SV[CMV](polyTAR); that made from pT7[U6]TAR was called SV[U6]TAR. A rSV40 virus, SV(HBS), which carries hepatitis B surface antigen (HBSAg) as a transgene was used as the negative control. The construction of this virus was previously reported.19

HIV-1

The HIV-1 strain used in this study was pNL4–3. This strain was obtained as a molecular clone (pNL4–3) from the AIDS Reagent Repository (NIH). It is a T cell-tropic (CXCR4-tropic) strain that has the complete HIV-1 genome, and is a hybrid of HIV-1 strains NY5 and LAV.

Cultures of cell lines

The COS-7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (GIBCO), glutamine and antibiotics. SupT1 and CEMX174 cells were maintained in RPMI-1640 medium (GIBCO) supplemented with 10% fetal bovine serum (GIBCO), glutamine and antibiotics. All cells were grown at 37°C in humidified incubator with 5% CO2.

Cultures of primary human peripheral blood

Primary human peripheral blood mononuclear cells (PBMC) were prepared from fresh donor blood that was purchased from the Thomas Jefferson University Hospital Blood Center, without donor identifiers. Buffy coat preparations were prepared by layering whole blood over Histopaque 1077 and centrifugation at 2500 g for 30 min at 15°C. The PBMC layer was washed, resuspended in RPMI + 10% FCS, and cultured overnight on plastic to allow monocytes and macrophages to adhere. The following day, transduction was begun, according to protocols described below. For the entirety of the 3-day transduction procedure, no additional stimulation was used. After the last day of transduction, 20 units natural human IL-2/ml (GIBCO) were added. Cultures were maintained in medium containing 20 U IL-2/ml thereafter.

One week after the beginning of transduction, 106 PBMC were plated/well in 12-well tissue culture dishes and challenged with HIV-1NL4–3.

Transduction of human T lymphocyte cell lines

SupT1 cells were treated with rSV40s, carrying TAR or the antitat genes, or with SV(HBS), for 24 h at multiplicity of infection (MOI) of 10. This was repeated twice on subsequent days, at MOI of 3. No selection was used. This approach offers superior transduction efficiency for most cell types, compared to a single round of transduction. Generally, a single exposure, with MOI = 100, transduces 50–60% of cells, although higher efficiencies can be achieved. Transduction efficiency of SupT1 cells is generally >98% using the triple exposure approach described above.14,17

Detection of polyTAR sequence in SupT1 cells

SupT1 cells were transduced with SV(polyTAR) constructs as described above. Total DNA was extracted from cells 24 h after transduction.34 Twenty-five cycles of PCR were done in 100 μl containing 1 μg RNase-treated DNA, 200 μM each dNTP, 0.5 μM each primer, A/TAT1 and A/TAT2, 1.5 mM MgCl2 and 2.5 U AmpliTaq DNA polymerase (Perkin Elmer Cetus, CA, USA). A/TAT1 and A/TAT2 are the upstream and downstream primers complementary to the A/Tat sequence in SV(PolyTAR) constructs. The sequence of A/TAT1 is 5′tgctttgatagagaagcttga3′, and the sequence of A/TAT2 is 5′atggagccagtagatcctaga3′.

PCR products were electrophoresed and transferred to nylon membranes by upward capillary transfer, using 20 × SSC as the transfer buffer.34 DNA on the membrane was immobilized by baking under vacuum at 180°C. The filter was then hybridized with a 32P-labeled DNA probe specific for the A/tat sequence. This probe was obtained by PCR amplification of the A/tat sequence in pT7A. The hybridization solution contained 50% formamide, 5 × Denhardt's solution, 5 × SSC, 0.2% SDS and 10% Dextran sulfate; and hybridization was done at 42°C for 12 h. After hybridization the filter was washed finally in 0.1% SDS + 0.1 × SSC for 30 min at 60°C, before autoradiography.

Assay for cytotoxicity of SV40-transduction and polyTAR expression in SupT1 cells

Viability of SV40-transduced SupT1 cells was tested by trypan blue dye exclusion, microscopic examination and by the CellTiter 96 AQueous non-radioactive cell proliferation assay (Promega, WI, USA), used according to the manufacturer's instructions.35 The CellTiter 96 AQueous non-radioactive cell proliferation assay is a colorimetric method for assaying cell viability. In this assay, a tetrazolium compound (3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS) is bioreduced by viable cells into a soluble formazan whose absorbance can be measured at 490 nm.34 Conversion of MTS into the aqueous soluble formazan occurs via dehydrogenase enzymes found in metabolically active cells, and the quantity of formazan produced, as measured by the amount of 490 nm absorbance, is directly proportional to the number of living cells in culture.16,34

Detection of polyTAR transcript by RT-PCR

SupT1 cells were transduced with SV(polyTAR) constructs as described. Control cells were transduced with SV(HBS). Total RNA was isolated (RNAzol, Cinna Bio-Tex, TX, USA) before challenge with HIV-1 and 24 h after challenge with HIV-1NL4–3 at a challenge dose of 0.1 pg/ml of p24 antigen equivalents.

Reverse transcription was performed for 15 min in 20 μl containing 1 μg DNase-treated total RNA, 0.75 μM primer A/TAT2, 5 U rTth DNA polymerase (Perkin Elmer), 200 μM each dNTP, 1 mM MnCl2 and RT-PCR buffer. Subsequently, PCR was done in the same tube in a final volume of 100 μl, using 0.5 μM each of primers A/TAT2 and A/TAT1, 5 U rTth DNA polymerase, 200 μM each dNTP, 1.5 mM MgCl2, RT-PCR buffer and Mn-chelating buffer. PCR products were electrophoresed and transferred to nylon membranes by upward capillary transfer, using 20 × SSC as the transfer buffer.33 DNA on the membrane was immobilized by baking under vacuum at 180°C, and then it was hybridized with a 32P-labeled cDNA probe specific for the A/tat sequence. The probe was obtained by PCR amplification of the A/tat sequence in pT7A (see above). The hybridization solution contained 50% formamide, 5 × Denhardt's solution, 5 × SSC, 0.2% SDS and 10% Dextran sulfate; and hybridization was done at 42°C for 12 h. After hybridization the filter was finally washed in 0.1% SDS + 0.1 × SSC for 30 min at 60°C, before autoradiography.

In situ hybridization

SupT1 cells were transduced with SV[CMV](PolyTAR) at MOI = 10, then 3 and 3 on days 1, 2 and 3, respectively. Three weeks after transduction, the cells were spread on to 3-chamber slides (105 cells per chamber) and heat fixed at 105°C for 1 min, followed by 4% paraformaldehyde for 3 h. After fixation, slides were washed in 3 × PBS and then in 1 × PBS. Proteinase K digestion of these slides was then performed for 10 min in PBS containing 6 μg/ml proteinase K. Digestion was terminated by heating slides at 92°C for 2 min. Slides were washed in PBS followed by water, and allowed to air dry.

Slides were then soaked in 2 × SSC for 5 min, and hybridized to biotinylated SV40 probe. The hybridization solution was 50% formamide, 2 × SSC, 10 × Denhardt's solution, 1 mg/ml salmon sperm DNA, 0.1% SDS and 64 nM 5′ biotinylated oligonucleotide probe.14 15 μl hybridization solution was put on each chamber. After a cover slip was added, slides were heated at 95°C for 5 min; hybridization was done in a humidified chamber at 37°C overnight. The slides were then rinsed in 2 × SSC for 5 min, the cover slips removed and treated with 15 μl streptavidin alkaline phosphatase (1:300 dilution in 1 × PBS) at 37°C for 1 h. Slides were rinsed in 1 × PBS for 2 min and treated with BCIP/NBT reagent for 4 h, for color development.

HIV-1 challenge

For challenge with HIV-1NL4–3, the mixed populations of HIV-1-susceptible SupT1, CEMx174 and primary peripheral blood mononuclear cells expressing polyTAR were incubated with infectious cell-free HIV-1NL4–3 overnight, and then maintained in growth medium. Cells were challenged with a range of doses of HIV-1NL4–3 (from 40 top 4000 TCID50/106 cells). In our hands, such doses of HIV-1NL4–3 are generally sufficient to yield p24 values >10 ng/ml by 18 days after challenge, and >50% cell death by 28 days after challenge in unprotected SupT1 cells. Control SupT1 cells, transduced with SV(HBS) were also challenged with HIV-1 the same way. Every 3 days, cells were split 1:2 to maintain a cell density of approximately 106 cells/ml, and the culture supernatants were collected for HIV-1 p24 antigen analysis. HIV-1 p24 antigen levels were tested by ELISA (Cellular Products, NY, USA).

References

  1. 1

    Strayer DS, Kondo R, Milano J, Duan LX . Use of SV40-based vectors to transduce foreign genes to normal human peripheral blood mononuclear cells Gene Therapy 1997 4: 219–225

  2. 2

    Strayer DS . SV40 as an effective gene transfer vector in vitro J Biol Chem 1996 271: 24741–24746

  3. 3

    Lisziewicz J et al. Inhibition of human immunodeficiency virus type 1 replication by regulated expression of a polymeric Tat activation response RNA decoy as a strategy for gene therapy in AIDS Proc Natl Acad Sci USA 1993 90: 8000–8004

  4. 4

    Feinberg MB, Baltimore D, Frankel AD . The role of Tat in the human immunodeficiency virus life cycle indicates a primary effect on transcriptional elongation Proc Natl Acad Sci USA 1991 88: 4045–4049

  5. 5

    Lisziewicz J et al. An autoregulated dual-function antitat gene for human immunodeficiency virus type 1 gene therapy J Virol 1995 69: 206–212

  6. 6

    Lisziewicz J, Sun D, Lisziewicz A, Gallo RC . Antitat gene therapy: a candidate for late-stage AIDS patients Gene Therapy 1995 2: 218–222

  7. 7

    Emerman M, Malim MH . HIV-1 regulatory/accessory genes: keys to unraveling viral and host cell biology Science 1998 280: 1880–1884

  8. 8

    Goomer RS, Kunkel GR . The transcriptional start site for a human U6 small nuclear RNA gene is dictated by a compound promoter element consisting of the PSE and the TATA box Nucleic Acids Res 1992 20: 4903–4912

  9. 9

    Kunkel GR, Pederson T . Upstream elements required for efficient transcription of a human U6 RNA gene resemble those of U1 and U2 genes even though a different polymerase is used Genes Dev 1988 2: 196–204

  10. 10

    Bertrand E et al. The expression cassette determines the functional activity of ribozymes in mammalian cells by controlling their intracellular localization RNA 1997 3: 75–88

  11. 11

    Good PD et al. Expression of small, therapeutic RNAs in human cell nuclei Gene Therapy 1997 4: 45–54

  12. 12

    Sullenger BA, Gallardo HF, Ungers GE, Gilboa E . Overexpression of TAR sequence renders cells resistant to human immunodeficiency virus replication Cell 1990 63: 601–608

  13. 13

    Saag MS et al. Extensive variation of human immunodeficiency virus type-1 in vivo Nature 1988 334: 440–444

  14. 14

    BouHamdan M, Duan LX, Pomerantz RJ, Strayer DS . Inhibition of HIV-1 by an anti-integrase single-chain variable fragment (SFv): delivery by SV40 provides durable protection against HIV-1 and does not require selection Gene Therapy 1999 6: 660–666

  15. 15

    Strayer DS . Effective gene transfer using viral vectors based on SV40. In: Kmiec EB (ed.) Methods in Molecular Biology: Gene Targeting Vector Protocols 133 Humana Press: New York 1999 61–74

  16. 16

    Cory AH, Owens TC, Barltrop JA, Cory JG . Use of an aqueous soluble tetrazolium/formazan assay for cell growth assays in culture Cancer Commun 1991 3: 207

  17. 17

    Kondo R, Feitelson MA, Strayer DS . Use of SV40 to immunize against hepatitis B surface antigen: implications for the use of SV40 for gene transduction and its use as an immunizing agent Gene Therapy 1998 5: 575–582

  18. 18

    Strayer DS et al. Efficient gene transfer to hematopoietic progenitor cells using SV40-derived vectors Gene Therapy 2000 7: 886–895

  19. 19

    Sauter BV et al. Gene transfer to the liver using a replication-deficient recombinant SV40 vector results in long-term amelioration of jaundice in Gunn rats Gastroenterology 2000 119: 1348–1357

  20. 20

    Strayer DS . SV40-based gene transfer vectors: turning an adversary into a friend Curr Opin Mol Therapeut 2000 2: 570–578

  21. 21

    Lisziewicz J, Rappaport J, Dhar R . Tat-regulated production of multimerized TAR RNA inhibits HIV-1 gene expression New Biol 1991 3: 82–89

  22. 22

    Chang HK et al. Block of HIV-1 infection by a combination of antisense tat RNA and TAR decoys: a strategy for control of HIV-1 Gene Therapy 1994 1: 208–216

  23. 23

    Chatterjee S, Johnson PR, Wong KK Jr . Dual-target inhibition of HIV-1 in vitro by means of an adeno-associated virus antisense vector Science 1992 258: 1485–1488

  24. 24

    Kim YS, Risser R . TAR-independent transactivation of the murine cytomegalovirus major immediate-early promoter by the Tat protein J Virol 1993 67: 239–248

  25. 25

    Robinson D, Elliott JF, Chang LJ . Retroviral vector with a CMV-IE/HIV-TAR hybrid LTR gives high basal expression levels and is up-regulated by HIV-1 Tat Gene Therapy 1995 2: 269–278

  26. 26

    Rund D et al. Efficient transduction of human hematopoietic cells with the human multidrug resistance gene 1 via SV 40 pseudovirion Hum Gene Ther 1998 9: 649–657

  27. 27

    Zern M et al. A novel SV40-based vector successfully transduces and expresses an alpha 1-antitrypsin ribozyme in a human hepatoma-derived cell line Gene Therapy 1999 6: 114–120

  28. 28

    Strayer DS . Gene therapy using SV40-derived vectors: what does the future hold? J Cell Physiol 1999 181: 375–384

  29. 29

    Yee C, Riddell SR, Greenberg PD . Prospects for adoptive T cell therapy Curr Opin Immunol 1997 9: 702–708

  30. 30

    Greenberg PD, Riddell SR . Deficient cellular immunity-finding and fixing the defects Science 1999 285: 546–551

  31. 31

    Strayer DS, Zern MA . Gene delivery to the liver using SV40-derived vectors Semin Liver Dis 1999 19: 71–81

  32. 32

    Rosenberg BH, Deutsch JF, Ungers GE . Growth and purification of SV40 virus for biochemical studies J Virol Meth 1981 3: 167–176

  33. 33

    Strayer DS et al. Titering replication-defective virus for use in gene transfer BioTechniques 1997 22: 447–450

  34. 34

    Maniatis T . Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press: Cold Spring Harbor 1982

  35. 35

    CellTiter 96 Non-Radioactive Cell Proliferation Assay Technical Bulletin, TB112, Promega Corporation

Download references

Acknowledgements

These studies were supported by NIH grants RR13156, AI41399, MH58526 and RR00168. The advice of Drs J Roy Chowdhury, Ling-Xun Duan, Paul Hyman, Martyn White and Mark A Zern was helpful in planning and executing some of the studies described here. The technical help of Ms Maria E Lamothe is gratefully acknowledged. We thank Dr GR Kunkel for the kind gift of the U6 promoter construct.

Author information

Correspondence to DS Strayer.

Rights and permissions

Reprints and Permissions

About this article

Keywords

  • pol III
  • conditional promoters
  • HIV-1
  • gene therapy

Further reading