Intratracheal injection of manganese superoxide dismutase (MnSOD) plasmid/liposomes protects normal lung but not orthotopic tumors from irradiation

Abstract

To determine whether intratracheal (IT) lung protective manganese superoxide–plasmid/liposomes (MnSOD–PL) complex provided ‘bystander’ protection of thoracic tumors, mice with orthotopic Lewis lung carcinoma-bacterial β-galactosidase gene (3LL-LacZ) were studied. There was no significant difference in irradiation survival of 3LL-LacZ cells irradiated, then cocultured with MnSOD–PL-treated compared with control lung cells (D0 2.022 and 2.153, respectively), or when irradiation was delivered 24 h after coculture (D0 0.934 and 0.907, respectively). Tumor-bearing control mice showed 50% survival at 18 days and 10% survival at 21 days. Mice receiving liposomes with no insert or LacZ–PL complex plus 18 Gy had 50% survival at 22 days, and a 20% and 30% survival at day 50, respectively. Mice receiving MnSOD–PL complex followed by 18 Gy showed prolonged survival of 45% at 50 days after irradiation (P < 0.001). nested rt-pcr assay for the human mnsod transgene demonstrated expression at 24 h in normal lung, but not in orthotopic tumors. decreased irradiation induction of tgf-β1, tgf-β2, tgf-β3, mif, tnf-α, and il-1 at 24 h was detected in lungs, but not orthotopic tumors from mnsod-pl-injected mice (p < 0.001). thus, pulmonary radioprotective mnsod–pl therapy does not provide detectable ‘bystander’ protection to thoracic tumors.

Introduction

We have previously demonstrated in a mouse model that intratracheal (IT) injection of human manganese superoxide dismutase–plasmid/liposomes (MnSOD–PL) complex prevents irradiation-induced organizing alveolitis and increases survival.123 Lung expression of human MnSOD by IT injection of plasmid/liposomes was associated with a decrease in subsequent irradiation induction of endogenous murine MnSOD and inflammatory cytokines transforming growth factor-beta (TGF-β1, TGF-β2) and tumor necrosis factor-alpha (TNF-α).123 As delivery of gene therapy vectors has become a subject of intense investigation for potential use in the therapy of pulmonary diseases, the use of this route of administration for lung-specific transgene expression has raised several questions. Will vector-mediated pulmonary transgene expression affect other organs and, if so, by what mechanism? A question that followed from our experiments was whether gene therapy protection of normal lung may provide ‘bystander’ protection of a lung tumor. In the present studies, the levels of gene transcription for cytokines TGF-β1, TGF-β2, interleukin-1 (IL-1) and TNF-α, as well as transgene MnSOD, were measured in orthotopic tumor cells and in normal lung following irradiation of mice that received MnSOD–PL or control liposome injections. The results indicated that effective lung radioprotective IT injections of MnSOD–PL complex did not produce detectable MnSOD transgene expression in orthotopic tumors, did not decrease irradiation induction of cytokine mRNA in tumors, and did not detectably protect 3LL-LacZ cells in culture or in orthotopic lung tumors from irradiation killing. Thus, pulmonary radioprotective MnSOD–PL gene therapy may be safe with respect to lack of bystander tumor protection.

Results

Lack of detectable tumor cell expression of human MnSOD transgene following IT injection of PL in mice with 3LL-LacZ orthotopic tumors

C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME, USA) were IT-injected with 3LL-LacZ tumor cells. Ten days later, the mice were injected with MnSOD–PL complex and killed 24 h later. The lungs were removed and the 3LL tumors excised from the surrounding normal lung tissue. RNA was extracted from both the tumor and normal lung tissue, and nested reverse transcriptase-polymerase chain reaction (RT-PCR) performed. Nested RT-PCR reactions using primers specific for the human MnSOD transgene were used to attempt to detect expression of the human MnSOD transgene in explanted orthotopic 3LL-LacZ tumors, compared with normal lung in the same mice. Expression of the human MnSOD transgene was detected in all of the normal lungs of injected mice, but not in 3LL-LacZ tumors. Data on five representative mice are shown in Figure 1. There was no detectable human MnSOD mRNA in the lungs of mice IT-injected with LacZ-PL or empty liposomes (data not shown). The data confirm and extend our prior publication showing that IT injections of MnSOD–PL complex transfected normal lung tissue.1 The data establish that this technique did not result in detectable transgene expression in 3LL-LacZ orthotopic lung tumors in the same mice.

Figure 1
figure1

Lack of detection of the human MnSOD transgene expression in 3LL-LacZ orthotopic tumors explanted from IT-injected MnSOD–PL mice. C57BL/6J mice were IT-injected with 3LL-LacZ cells. Ten days later, subgroups of mice received IT injection of MnSOD–PL complex. The mice were killed 24 h later and lungs removed. The tumor was separated from the lung tissue, RNA extracted from tumor or normal lung, and nested RT-PCR reactions for the human MnSOD transgene were performed (as described in the Methods). Human MnSOD transgene expression was detected in each normal lung sample (arrow), but was not detected in the 3LL-LacZ tumors. The pRK5-MnSOD plasmid is a positive control.

Irradiation survival of 3LL-LacZ cells cocultivated with lung cells from control or MnSOD–PL complex-injected mice

Lung cells were isolated from control mice or mice injected 24 h earlier with MnSOD–PL complex. The lung cells were mixed with 3LL-LacZ cells at a ratio of 10:1. The cocultures were either irradiated immediately to doses ranging from 0 to 8 Gy, or were plated in four-well tissue culture plates 4.0 per ml Linbro four-well tissue culture plates (Flow Laboratories, McLean, VA, USA) and irradiated 24 h later. The plates were stained for LacZ-positive colonies of 50 cells per colony at day 7. The data demonstrated no difference in the irradiation survival curves for 3LL-LacZ cells cocultivated with normal lung cells or with lung cells from mice that had been injected with MnSOD–PL complex (Figure 2; Table 1). Cocultures were irradiated immediately after mixing and showed a D0 for blue 3LL-LacZ colonies of 2.022 ± 0.089 when mixed with normal lung cells, compared with a D0 of 2.153 ± 0.065 for 3LL-LacZ cells mixed with lung cells from mice that had been injected with MnSOD–PL complexes. The lung cells from mice injected with MnSOD–PL showed four times the level of biochemically active MnSOD than that detected in the control lung cells (data not shown), and were more resistant to irradiation-induced DNA strand breaks, as measured by Comet assay (Table 2). Prior studies have shown that the MnSOD–PL transgene transfected lung cells produce intracellular, but not secreted MnSOD.1 There was no detectable difference in irradiation sensitivity of 3LL-LacZ cells when cocultivated with either lung cell population 24 h before irradiation. The D0 for 3LL-LacZ cells cocultivated with lung cells from mice injected with MnSOD–PL complexes was 0.907 ± 0.032 Gy, compared with a D0 of 0.934 ± 0.029 Gy for lung cells from control mice. This difference was not significant (P = 0.02). Cocultures irradiated immediately after mixing showed an increased radioresistance relative to the cocultures cocultivated for 24 h before irradiation, but there was no difference between the groups. The reason for the increased radioresistance of freshly mixed cocultures is not known.

Figure 2
figure2

Irradiation survival of Lewis lung carcinoma (3LL-LacZ) cells cocultivated with explanted control lung cells or MnSOD–PL in vivo injected lung cells. Lungs were removed from control C57BL/6J mice or mice that had been injected with MnSOD–PL complex 24 h earlier. Lung cells in single cell suspension were mixed with 3LL-LacZ cells (as described in the Methods). Cells were mixed at a ratio of 10 lung cells to each 3LL-LacZ cell. The cell cocultures were irradiated to doses ranging from 0 to 8 Gy either immediately (a) or 24 h (b) after mixing, and coculture in 4.0 ml dishes in DMEM supplemented with 10% FBS.5 Colonies were stained for LacZ expression 7 days later, and LacZ-positive colonies of 50 cells were counted. The data were analyzed by using the linear quadratic and single-hit, multi-target models.28 There was no significant difference in the survival of 3LL-LacZ cells mixed with normal lung cells or lung cells from mice injected with MnSOD–PL complex (P = 0.02).

Table 1 Irradiation survival of 3LL-LacZ cells in vitro cocultivated with explanted single cell suspensions of lung from control or MnSOD–PL-injected mice
Table 2 Prevention of DNA strand breaks in normal lung by MnSOD–PL intratracheal injection

Unaltered radiation responsiveness of 3LL-LacZ orthotopic tumors following IT injections of MnSOD–PL complexes 24 h before irradiation

Female C57BL/6Nsd mice (25 g) (Harlan Sprague Dawley, Indianapolis, IN, USA) were IT-injected with 5 × 105 3LL-LacZ cells. Twenty-four hours later, the mice were IT-injected with MnSOD or LacZ–PL complexes, according to our published methods,1 then irradiated 24 h later to 18 Gy to the thoracic cavity, and the mice were followed for survival (Figure 3). All animals in this study died of progressive tumor. The dose of 18 Gy has been shown to be associated with late organizing alveolitis at the later time-points of 100–150 days.1 Mice injected with 3LL-LacZ cells plus MnSOD–PL complex therapy before 18 Gy irradiation showed 50% survival at 37 days. Mice receiving 3LL-LacZ cells alone showed more rapid tumor growth leading to a 50% survival at 15 days. There was a 50% survival at 20 days for tumor-bearing mice receiving irradiation only to 18 Gy, and 19 days for tumor-bearing mice treated with IT LacZ–PL complex, then 18 Gy irradiation. The overall survival was significantly increased in the tumor-bearing mice receiving MnSOD–PL complex before 18 Gy irradiation, compared with all groups of mice receiving 3LL-LacZ cells only, 3LL-LacZ cells plus 18 Gy irradiation, or 3LL-LacZ cells plus LacZ–PL complex and 18 Gy irradiation (P = 0.0006, 0.0012 and 0.0046, respectively). At 60 days after irradiation, the overall survival rate was 36% for irradiated tumor-bearing mice pretreated with MnSOD–PL complex, 11% for unirradiated tumor-bearing mice, and 5% for tumor-bearing receiving 18 Gy irradiation, or LacZ–PL complex before irradiation. The experiment was terminated at 60 days as all the remaining mice had persistent tumors and statistical significance for the MnSOD–PL group compared with the other groups had been reached.

Figure 3
figure3

Survival of mice bearing 3LL-LacZ orthotopic thoracic tumors following MnSOD–PL gene therapy, then 18 Gy whole lung irradiation. C57BL/6J mice were IT-injected with 1 × 105 3LL-LacZ cells. Subgroups of mice were injected 24 h later with MnSOD–PL or LacZ–PL complex and irradiated to 18 Gy 24 h later. Control groups received 3LL-LacZ cells only or 3LL-LacZ cells followed by 18 Gy irradiation 48 h after injection. The mice were followed for survival. Median survival was 15 days for mice receiving 3LL-LacZ cells only, 20 days for mice receiving 3LL-LacZ plus 18 Gy irradiation, 19 days for mice injected with LacZ–PL complex plus 18 Gy irradiation, and 37 days for mice receiving MnSOD–PL complex followed by 18 Gy irradiation. Mice injected with MnSOD–PL complex before irradiation had a significantly increased survival compared with all groups: mice receiving 3LL-LacZ cells only, 3LL-LacZ cells plus 18 Gy irradiation, or 3LL-LacZ cells plus LacZ–PL complex plus 18 Gy irradiation (P = 0.006, 0.0012 and 0.0046, respectively).

IT injection of MnSOD–PL decreases irradiation induction of normal pulmonary but not orthotopic tumor inflammatory cytokine mRNA

The above results suggested that MnSOD–PL complex IT injections may have prolonged survival in the irradiated tumor-bearing mice by slowing tumor growth, and/or sensitizing the tumor to irradiation. Since no human MnSOD transgene mRNA was detected in the tumors, we tested whether there had been an effect of the MnSOD–PL transgene expression through its expression in normal lung on irradiation induction of cytokine mRNA levels in the tumors. A different form of tumoricidal ‘bystander’ effect in the tumor may have occurred which could be detected at the level of mRNA expression at 24 h after irradiation.

C57BL/6J mice were next injected with 5 × 105 3LL-LacZ cells at the carina and 10 days later, when tumors were approximately 0.3–0.5 cm in diameter,4 the mice were injected with MnSOD–PL complex or LacZ–PL complex as a control. Twenty-four hours later the mice were irradiated to 18 Gy and then after an additional 24 h were killed for mRNA quantification in lung and tumor (as described in the Methods). The lungs were removed and the tumor excised. The tumor and normal lung were then snap-frozen, mRNA was extracted, and cytokine mRNA quantified using an RNase Protection Assay Kit (PharMingen, San Diego, CA, USA).

As shown in Table 3 and Figure 4, normal lung mRNA levels for TGF-β3, MIF, IL-1β and IL-1Rα were increased at 24 h after 18 Gy in empty liposome-injected mice. There was a detectable increase in TGF-β3 and MIF expression in the normal lung of control empty liposome-injected mice 24 h after irradiation (Figure 4a, b), and this increase was abrogated by MnSOD–PL therapy (Figure 4c). In contrast, the 3LL-LacZ tumors from control empty liposome-injected mice or mice injected with MnSOD–PL (Figure 4d) showed no effect of MnSOD–PL injection on irradiation-induced changes in cytokine mRNA levels within the tumors. In three animals, we observed an increase in the level of TNF-α and TGF-β mRNA in tumors of nonirradiated MnSOD–PL-injected mice (Figure 4d, lanes 4–6). The level of TNF-α mRNA increased after irradiation in one animal (Figure 4d, lane 7). This effect of MnSOD–PL injection on elevating tumor cytokine mRNA levels was seen in one of six nonirradiated mouse normal lung areas (Figure 4c, lane 5). These results confirm and extend our prior published data for the effect of MnSOD–PL IT injection on decreasing irradiation-induced cytokine mRNA levels.1 In contrast, with respect to orthotopic tumors, there was an induction of mRNA for MIF and IL-β1 in irradiated tumor explants from control liposome-injected mice with no detectable effect of MnSOD–PL on MIF and little effect on IL-1β.

Table 3 Irradiation induction of cytokine mRNA in 3LL-LacZ tumors compared with adjacent normal lung in MnSOD–PL IT-injected mice (normalized to GAPDH) at 0 and 24 h after 18 Gy
Figure 4
figure4

Cytokine mRNA expression in orthotopic tumors and normal adjacent lung following 18 Gy detected by RNase Protection Assay. C57BL/6J mice were IT-injected with 5 × 105 3LL-LacZ cells. A control irradiated group received IT-injected empty liposomes. The experimental group received IT MnSOD–PL injection as described in the Methods. All mice were irradiated 24 h later to 18 Gy to the pulmonary cavity and were killed at either 0 or 24 h after irradiation. The lungs were excised, and areas of 3LL-LacZ tumors were separated from the normal sections of lung. RNA was extracted from tumor compared with normal lung, and cytokine expression determined using an RNase Protection Assay Kit (PharMingen RiboQuant Multi-Probe Template Set). Densitometry was performed on the resulting radiographic film and each cytokine mRNA expression was normalized to GAPDH mRNA expression to normalize for RNA loading. Lung tissue results from areas with no tumor in control liposome-injected mice are shown in Figure 4a and b. In (a) lanes 2–8 (0 h) are before irradiation, and lanes 9–15 are 24 h after irradiation. Lane 1 contains the unprotected probe. Lane 16 is a mouse spleen mRNA (positive control). (b) shows the same samples as (a), reprobed for the indicated cytokines. The asterisks show increases. (c) shows data with normal lung from mice that received MnSOD–PL before irradiation. Lanes 1–6 represent MnSOD–PL mice killed at 0 h, and lanes 7–12 represent MnSOD–PL mice killed at 24 h. Lane 13 is the positive mouse spleen mRNA control, and lane 14 is the negative yeast plus RNA control. (d) shows results with mRNA from 3LL-LacZ tumors from the same mice as in (c). Lanes 2 and 3 are from nonirradiated control mice at 0 h, and lanes 4–6 are from MnSOD–PL-treated, nonirradiated mice at 0 h. Lanes 7–9 are from MnSOD–PL-injected mice killed at 24 h after irradiation.

Discussion

Protection of normal tissue from ionizing irradiation damage by MnSOD–PL complex application before irradiation has been demonstrated for the lung and esophagus.12356 Protection of a tumor in the normal organ volume by this therapy has been a concern. ‘Bystander’ protection has been reported for irradiation models in vitro.789 However, in the literature of gene therapy models, ‘bystander effects’ reported have usually been in the transmission of killing of adjacent tissues by transgene-expressing cells.7891011121314151617 Delivery of MnSOD–PL complex by IT injection did not facilitate expression of the MnSOD transgene as measured by nested RT-PCR in orthotopic 3LL-LacZ carinal tumors when it was uniformly detected in the normal lung tissue. This may have been due to lack of penetration of the PL complex into the tumor, or to the route of IT administration which distributed the PLs to the upper airway and bronchoalveolar cells that were not in direct contact with central areas of tumor. Radioresistant mediastinal tumors such as thymic carcinomas, soft tissue sarcomas, and mesotheliomas usually require high doses of fractionated irradiation for local control. However, normal lung must be transited by external beam irradiation directed at the tumor and may receive 50–70% of the tumor dose. These tumors, as well as non-small cell adenocarcinomas and squamous cell carcinomas of the lung, displace the normal lung tissue as they grow. Thus, intratracheal administration of PLs would not be expected to reach these tumors. IT injections of MnSOD–PL complex were also tested for indirect effects at protection of lung tumors. Irradiated cocultures of MnSOD–PL-treated or normal lung with 3LL-LacZ tumor, showed no differences in the irradiation survival curves of 3LL-LacZ cells under either cocultivation condition. Thus, overexpression of MnSOD in normal lung cells did not provide in vitro protection from irradiation killing of 3LL-LacZ cells.

If MnSOD transgene expression in the normal lung tissue of MnSOD–PL complex-injected mice also protected the orthotopic 3LL-LacZ tumors in vivo, we expected to see rapid, continued tumor growth and decreased survival, perhaps even more rapid death from tumor than that observed in nonirradiated mice.

Unexpectedly, tumor-bearing mice receiving MnSOD–PL complex before 18 Gy irradiation had a significantly increased 30 day survival (50%) and overall survival, compared with the other groups. Thus, overexpression in normal lung of the human MnSOD transgene did not protect 3LL-LacZ tumors from irradiation and may have improved tumor kill. The mechanism by which this tumor radiosensitization occurred may be related to the decreased cytokine mRNA expression in normal lung following irradiation in these mice.123 Following irradiation, there is a rapid increase over 48 h in the pulmonary levels of IL-1, TNF-α and TGF-β mRNA.123 Irradiation-induced increases in VEGF and other cytokines,18192021 and inflammatory response genes have been reported.19 Previously, we demonstrated that mice injected 24 h before irradiation with MnSOD–PL complex had decreased cytokine mRNA levels for IL-1 and TGF-β at 24 h, and TNF-α increase at 48 h compared with irradiated control.123 In the present study we detected at 24 h after irradiation, increases in TGF-β3, IL-1β, MIF and IL-1Rα in normal lung and these levels were reduced by MnSOD–PL treatment. Thus, the present study confirms our prior results with TGF-β and IL-1 at 24 h after irradiation and extends these findings to include macrophage migration inhibitory factor (MIF) and IL-1Rα.

The importance of cytokine production in local irradiation repair within tumors was recently demonstrated by injection of a VEGF antisense mRNA into irradiated mice bearing 3LL carcinoma and showing more effective tumor kill.22 Under conditions of normal tissue cytokine expression, some tumors may have a greater capacity for repair of irradiation-induced damage, reflected as decreased irradiation responsiveness. Delivery of MnSOD–PL complex to the lung reduces the organs stress response to irradiation by decreasing mRNA levels for inflammatory cytokines.123 This response may not only have protected normal lung, but may have limited lung tumor repair of irradiation damage resulting in an improved survival. Further studies will be required to determine the mechanism of the increased survival of irradiated tumor-bearing mice that received pulmonary radioprotective IT MnSOD–PL gene therapy.

Antioxidant gene therapy of the lung has been considered for hyperoxia, as well as the ischemia response from injury.23 MnSOD–PL therapy to prevent irradiation injury has been reported by us previously,12324 and now we extend this model to tumor-bearing animals showing not only safety but an unexpected tumor radiosensitization. As delivery of new inhalation gene therapy vectors becomes feasible,25 use of radioprotective gene therapy programs in fractionated radiotherapy of thoracic tumor volumes or in total body irradiation patients3 may become practical for reducing side-effects, including those mediated by lung tissue radiation damage.26272829

Materials and methods

Orthotopic 3LL-LacZ tumors in C57BL/6J mice

The 3LL carcinoma cell line has been described.4 Cells were cotransfected with the pIEP-LacZ plasmid and pSV-neo plasmids using lipofectin (Gibco/BRL, Grand Island, NY, USA) at a ratio of 10:1. G418-positive colonies were isolated and stained for LacZ expression. A clone expressing LacZ (3LL-LacZ) was isolated and uniformly expressed LacZ in vitro in >95% of cells over a 3 month passage in vitro in Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal calf serum (FCS).1 Groups of C57BL/6J female mice (25 g) (20–25 per group) were IT-injected with 1 × 105 3LL-LacZ cells. Each group was IT-injected 24 h later with either the human MnSOD–PL or LacZ–PL complex (500 μg DNA in 50 μl of H2O plus 28 μl of lipofectant), or lipofectant alone (empty liposomes). Mice were irradiated using a Varian linear accelerator (dose-rate of 200 cGy/min) (Varian Oncology Systems, Palo Alto, CA, USA), 24 h later to 18 Gy, a dose shown previously to induce both an acute increase in pulmonary mRNA for IL-1, TNF-α and TGF-β and the late lesion (organizing alveolitis) in control mice at around 100–500 days;1 and in preliminary experiments, to produce a detectable decrease in orthotopic tumor growth measurable as increased survival beyond 15 days. The mice were shielded (as published), so that only the thoracic cavity was irradiated.

Nested RT-PCR for human MnSOD transgene expression

After IT injection of 1 × 105 3LL-LacZ cells, at several time-points from 1 to 10 days later, human MnSOD–PL or control LacZ–PL complex, respectively, was injected IT, as described above,1 and mice were killed 24 h later. The 3LL-LacZ tumors and normal lung areas were removed, snap-frozen in liquid nitrogen, the tissue then thawed and placed in 3 ml Triazol (Gibco/BRL, Gaithersburgh, MD, USA), and homogenized using a Polytron Model PT2000 (Brinkman Instruments, Westbury, NY, USA). The samples were then incubated for 5 min at room temperature, followed by addition of 0.6 ml of chloroform, then vortexed, and incubated for 3 min at room temperature. The samples were centrifuged at 12 000 g for 15 min at 4°C, followed by transfer of the aqueous phase to a new centrifuge tube and addition of 1.5 ml of isopropyl alcohol. The samples were then incubated at room temperature for 10 min and centrifuged at 12 000 g for 10 min at 4°C. The pellets were next washed with 70% ethanol, centrifuged 7500 g for 5 min at 4°C, air-dried, and resuspended in 500 μl of diethylpyrocarbonate (DEPC)-treated water (Sigma Chemical Company, St Louis, MO, USA). Two micrograms of each RNA samples were mixed with 1.0 μl of poly-dT (20 pmol/μl) and incubated for 10 min at 70°C, then placed on ice for 10 min. Each tube received 200 U of Superscript II reverse transcriptase (Gibco/BRL) and 10 mM mixture of dCTP, dATP, dGTP and dTTP, and incubated for 10 min at room temperature, 42°C for 50 min, 95°C for 10 min, followed by incubation at 4°C. From each reverse transcriptase (RT) reaction, 1 μl of a 1:100 dilution of the RT reaction was mixed with the first set of 5′ and 3′ oligonucleotide primers, 10 mM mixture of dATP, dCTP, dGTP and dTTP, and 0.4 U Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN, USA). The mixture was subjected to 20 cycles of 94°C (30 s), 60°C (50 s) and 72°C (90 s) in a Perkin Elmer Model 9600 Gene Amp PCR system (Perkin Elmer, Foster City, CA, USA). For the second reaction (detecting only the human transgene), 1 μl of the first reaction was diluted in 99 μl of DEPC-treated water in the presence of the inner oligonucleotide primers. The second set of primers was chosen to be internal of the first set of primers and did not overlap in sequences.1 Thermocycling was identical to that of the first PCR reaction, except the reaction was for 35 cycles. The PCR products were electrophoresed on a 1% agarose gel and stained with ethidium bromide. For MnSOD, the first set of oligonucleotide sequences consisted of a 5′ primer of CGGCGGCATCAGCGGTAAGCCAGCACTA (nucleotides 61–69), and a 3′ primer of TGAGCCTTGGACACCAACAGATGCA (nucleotides 505–529). The internal primers consisted of a 5′ primer of GCTGGCTCCGGCTTTG GGGTATCTG (nucleotides 128–152), and a 3′ primer of GCTGAGCTTTGTCCAGAAAATGCTC (nucleotides 388–412). The expected size of the correct nested human MnSOD PCR product is 284 base pairs.1

Irradiation survival of 3LL-LacZ cells cocultivated with lung cells from mice injected with MnSOD–PL complex or other control lung cell preparations

Control C57BL/6J mice or mice which had been injected with MnSOD–PL complex 24 h earlier were killed and the lungs perfused by injecting 1 ml of 0.9% NaC1 solution into the right ventricle. The lungs were expanded by injecting 1 ml of dispase via IT injection, followed by a 0.5 ml injection of low-melt agarose (1% stored at 45°C), covered immediately with crushed ice, and incubated for 2 min at room temperature. The lungs were then removed and transferred to 7 ml of 0.01% DNase solution in DMEM. The digested lung was teased from the airway and swirled for 5–10 min at room temperature. The resulting suspension was filtered through a 40 μm filter and centrifuged at 1000 r.p.m. for 10 min at 4°C. The cell pellet was counted and mixed with 3LL-LacZ cells at a ratio of 10 lung cells to each 3LL cell. Half of the cells were immediately irradiated to doses ranging from 0 to 8 Gy, plated in 4.0 per ml Linbro four-well tissue culture plates (Flow Laboratories) at concentrations of 500, 1000 or 5000 3LL cells per well, and incubated at 37°C in a humidified CO2 incubator. The remaining cells were plated at 500, 1000 or 5000 cells per plate, incubated overnight at 37°C in a humidified CO2 incubator, and irradiated 24 h later at doses of 0.09 to 8 Gy. Five days later, the plates were stained for LacZ by fixing the cells in 0.5% glutaraldehyde for 10 min at 4°C, washing the cells in 1 mM MgCl2 in phosphate-buffered saline (PBS), and covering the cells in a solution of 1 mg/ml X-gal in KC stock solution (20 × KC stock solution consists of 0.82 g K3Fe(Cn)6 and 1.05 g K4Fe(Cn)6, 3H2O in 25 ml of 1 mM MgCl2 in PBS). The plates were placed in a humidified CO2 incubator at 37°C for at least 2 h. The plates were rinsed in 1 mM MgCl2, fixed in 4% paraformaldehyde for 10–20 min, and rinsed in 1 mM MgCl2. LacZ-positive colonies of 50 cells were counted and analyzed by linear quadratic and single-hit, multi-target models.530

Quantification of irradiation-induced DNA fragmentation in lung cells by Comet assay

Control C57BL/6J female mice or mice which had been IT-injected with MnSOD–PL 24 h previously, were irradiated to 5 Gy. The mice (four per group) were immediately killed, lungs perfused with 5 ml PBS, excised, placed in ice-cold PBS containing 5 mg/ml dispase, and incubated on ice for 30 min. Single cell suspensions were made by teasing the lungs apart with forceps and filtering the cells successively through 100 μm and 40 μm filters. For each mouse, 1200 cells were resuspended in 1% low-melt agarose and plated on three slides precoated with 1% agarose which were kept on ice. The cells were lysed with alkaline lysis buffer and neutralized with 0.4 M Tris. The proteins and RNA were digested by incubating the cells with proteinase K and RNase A, and the DNA electrophoresed for 1 h at 100 mA. The DNA was stained with propidium iodide and the length of the Comet tails measured using units established for Comet length, using a standard curve of Comet length.3132 At least 150 comets were measured for each mouse lung specimen. The data were analyzed using the Mann–Whitney confidence interval and test.32

Quantification of cytokine mRNA in the lungs following irradiation and modulation by prior overexpression of MnSOD transgene

C57BL/6J mice were IT-injected with 5 × 105 3LL-LacZ cells. Ten days later, the mice were injected with MnSOD–PL complex (500 μg, plasmid DNA, as described above) and irradiated to 18 Gy. At 0 or 24 h after irradiation, the mice were killed, lungs removed and snap-frozen in liquid nitrogen, and RNA extracted as described above. Cytokine mRNA expression was determined using a RiboQuant In Vitro Transcription Kit (PharMingen) which utilizes an RNase protection assay by hybridizing 10 μg of RNA with a P32-labeled probe for mCK-3b or mCK-2b mouse cytokine Multi-Probe Template Sets (PharMingen) (TNF-α, TNF-β, LT-β, IL-6, IFN-γ, IFN-β, TGF-β1, TGF- β2, TGF-β3 and MIF; or IL-1α, IL-1β, IL-1Rα, IL-6, IFN-γ, IL-10, IL-12, p35, IL-12, p40, IGIF and MIF, respectively). The RNA hybrids were then treated with RNase for 45 min at 30°C and proteinase K for 15 min at 37°C. The RNA was extracted using chloroform/phenol, precipitated by incubation at −70°C for 30 min, centrifugation at 14 000 r.p.m. at 4°C for 5 min, and the pellet then air-dried and electrophoresed in a 5% acrylamide gel. The gel was absorbed on Whatman filter paper, placed in a gel dryer under vacuum for 1 h at 80°C, placed in an autoradiographic cassette and covered with radiographic film. The film was developed and densitometry on the bands performed with a Molecular Dynamics Personal Densitometer SI (Molecular Dynamics, Sunnyvale, CA, USA). The cytokine expression was normalized to a known nonirradiation-inducible mRNA4 using L32 and GADPH probes included in the mCK-3b and mCK-2b Multi-probe Template Sets.

References

  1. 1

    Epperly MW et al. Prevention of late effects of irradiation lung damage by MnSOD gene therapy Gene Therapy 1998 5: 196–208

  2. 2

    Epperly MW et al. Intratracheal injection of adenovirus containing the human MnSOD transgene protects athymic nude mice from irradiation-induced organizing alveolitis Int J Radiat Oncol Phys 1999 43: 169–181

  3. 3

    Epperly MW, Travis EL, Sikora C, Greenberger JS . MnSOD–plasmid/liposome pulmonary radioprotective gene therapy: modulation of irradiation-induced mRNA for IL-1, TNF-α, and TGF-β correlates with delay of organizing alveolitis/fibrosis Biol Blood Marrow Transplant 1999 5: 204–214

  4. 4

    Greenberger JS et al. Stromal cell involvement in leukemogenesis and carcinogenesis In Vivo 1996 10: 1–18

  5. 5

    Stickle RL et al. Prevention of irradiation-induced esophagitis by intraesophageal plasmid/liposome delivery of the human MnSOD transgene Radiat Oncol Invest 1999 7: 204–217

  6. 6

    Epperly MW et al. Plasmid/liposome transfer of the human MnSOD transgene prevents ionizing irradiation-induced apoptosis in human esophagus organ explant culture Radiat Oncol Invest 1999 (in press)

  7. 7

    Freeman SM et al. The ‘bystander effect’: tumor regression when a fraction of the tumor mass is genetically modified Cancer Res 1993 53: 5274–5283

  8. 8

    Mesnil M et al. Bystander killing of cancer cells by herpes simplex virus thymidine kinase gene is mediated by connexins Proc Natl Acad Sci USA 1996 93: 1831–1835

  9. 9

    Bishayee A, Rao DV, Howell RW . Evidence for pronounced bystander effects caused by nonuniform distributions of radioactivity using a novel three-dimensional tissue culture model Radiat Res 1999 152: 88–97

  10. 10

    Schmidberger H et al. The combined effect of interferon beta and radiation on five human tumor cell lines and embryonal lung fibroblasts Int J Radiat Oncol Biol Phys 1999 43: 405–412

  11. 11

    Lawrence TS et al. Preferential cytotoxicity of cells transduced with cytosine deaminase compared to bystander cells after treatment with 5-flucytosine Cancer Res 1998 58: 2588–2593

  12. 12

    Wei MX et al. Suicide gene therapy of chemically induced mammary tumor in rat: efficacy and distant bystander effect Cancer Res 1998 58: 3529–3532

  13. 13

    McMasters RA et al. Lack of bystander killing in herpes simplex virus thymidine kinase-transduced colon cell lines due to deficient Connexin43 gap junction formation Hum Gene Ther 1998 9: 2253–2261

  14. 14

    Touraine RL, Ishii-Morita H, Ramsey WJ, Blaese RM . The bystander effect in the HSV-tk/ganciclovir system and its relationship to gap junctional communication Gene Therapy 1998 5: 1705–1711

  15. 15

    Boucher PD, Ruch RJ, Shewach DS . Differential ganciclovir-mediated cytotoxicity and bystander killing in human colon carcinoma cell lines expressing herpes simplex virus thymidine kinase Hum Gene Ther 1998 9: 801–814

  16. 16

    Yang L et al. Intercellular communication mediates the bystander effect during herpes simplex thymidine kinase ganciclovir-based gene therapy of human gastrointestinal tumor cells Hum Gene Ther 1998 9: 719–728

  17. 17

    Namba H et al. Bystander effect-mediated therapy of experimental brain tumor by genetically engineered tumor cells Hum Gene Ther 1998 9: 5–11

  18. 18

    Weichselbaum RR, Hallahan D, Fuks Z, Kufe D . Radiation induction of immediate–early genes: effectors of the radiation-stress response Int J Radiat Oncol Biol Phys 1994 30: 229–234

  19. 19

    Hallahan DE et al. Protein kinase C mediates X-ray inducibility of nuclear signal transducers EGR1 and JUN Proc Natl Acad Sci USA 1991 88: 2156–2160

  20. 20

    Hallahan DE et al. Membrane-derived second messenger regulates X-ray-mediated TNF-α gene induction Proc Natl Acad Sci USA 1994 91: 4897–4901

  21. 21

    Goltry KL, Epperly MW, Greenberger JS . Induction of serum amyloid A inflammatory response genes in irradiated bone marrow cells Radiat Res 1998 149: 570–578

  22. 22

    Gorski DH et al. Blockade of the vascular endothelial growth factor stress response increases the antitumor effects of ionizing irradiation Cancer Res 1999 59: 3374–3378

  23. 23

    Danel C et al. Gene therapy for oxidant injury-related diseases: adenovirus-mediated transfer of superoxide dismutase and catalase cDNAs protects against hyperoxia but not against ischemia-reperfusion lung injury Hum Gene Ther 1998 9: 1487–1496

  24. 24

    Zwacka RM et al. Redox gene therapy protects human IB-3 lung epithelial cells against ionizing radiation-induced apoptosis Hum Gene Ther 1998 9: 1381–1386

  25. 25

    Eastman SJ et al. Aerosolization of cationic lipid:pDNA complexes – in vitro optimization of nebulizer parameters for human clinical studies Hum Gene Ther 1998 9: 43–52

  26. 26

    Greenberger JS et al. Considerations in optimizing radiation therapy for non-small cell lung cancer. (International Symposium on Thoracic Malignancies) Chest 1998 113: 465–525

  27. 27

    Bahri S et al. Results of multifield conformal radiation therapy of non-small cell lung cancer using multileaf collimation beams Radiat Oncol Invest 1999 7: 204–217

  28. 28

    Latini P et al. Interstitial pneumonitis after hyperfractionated TBI in HLA-matched T-depleted bone marrow transplantation Int J Radiat Oncol Biol Phys 1992 23: 401–405

  29. 29

    Mah K, Van Dyk F, Keane T, Poon P . Acute radiation-induced pulmonary damage: a clinical study on the response to fractionated radiation therapy Int J Radiat Oncol Biol Phys 1987 13: 179–188

  30. 30

    FitzGerald TJ et al. Resistance of hematopoietic stem cells to X-irradiation at clinical low-dose-rate is induced by several classes of oncogenes Radiat Res 1990 122: 44–53

  31. 31

    Olive PL . Detection of hypoxia by measurement of DNA damage in individual cells from spheroids and murine tumours exposed to bioreductive drugs. I. Tirapazamine Br J Cancer 1995 71: 529–536

  32. 32

    Epperly MW et al. Overexpression of the human MnSOD transgene in subclones of murine hematopoietic progenitor cell line 32D cl 3 decreases irradiation-induced apoptosis but does not alter G2/M or G1/S phase cell cycle arrest Radiat Oncol Invest 1999 7: 331–342

Download references

Acknowledgements

This paper is supported in part by the National Institutes of Health, research grant No. RO1-HL60132. We thank Valerie Dewald, RTT, for technical assistance, and Dr William Gooding for the biostatistics. This paper was supported by Research Grants RO1-HL-60132 of the National Institutes of Health.

Author information

Correspondence to JS Greenberger.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Epperly, M., Defilippi, S., Sikora, C. et al. Intratracheal injection of manganese superoxide dismutase (MnSOD) plasmid/liposomes protects normal lung but not orthotopic tumors from irradiation. Gene Ther 7, 1011–1018 (2000). https://doi.org/10.1038/sj.gt.3301207

Download citation

Keywords

  • plasmid/liposomes
  • MnSOD
  • lung radioprotection

Further reading