Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Increasing endothelial cell specific expression by the use of heterologous hypoxic and cytokine-inducible enhancers

Abstract

One of the current challenges in gene therapy is to construct a vector that will target specific tissues. Targeting expression to endothelium is of particular interest in the treatment of several pathologies. We have shown previously that defined regions of the E-selectin and KDR promoters confer endothelial cell specific expression following retroviral delivery. However, the levels of expression were low. In an attempt to increase expression but to preserve the tissue specificity we have examined hypoxic and cytokine-inducible enhancer elements in combination with the KDR and E-selectin promoters. Both enhancers should be active in the tumour environment, boosting expression and giving additional specificity of gene expression in the tumour endothelium. The hypoxia response element (HRE) of the murine phosphoglycerate kinase-1 (PGK-1) promoter was used as a hypoxic enhancer and the tandem-binding site for NFκB from the murine vascular cell adhesion molecule-1 (VCAM-1) promoter as a cytokine-inducible enhancer. The HRE conferred hypoxia inducibility to the KDR and E-selectin promoters. Endothelial specificity of expression was retained with the KDR but not the E-selectin promoter. The NFκB-binding site conferred responsiveness to TNF-α to the KDR promoter, however the level of induction was less than that achieved with the HRE. Retrovirus combining both enhancer elements transferred inducibility by hypoxia and TNF-α, and reached the highest expression levels upon stimulation. These results confirm that heterologous enhancer elements may operate on a single endothelial cell specific promoter. These findings make the use of inducible enhancers a promising strategy for increasing tissue specific gene expression.

Introduction

For gene therapy we often desire tissue specificity of expression, combined with a high level of expression. Tissue specificity can be achieved by the use of selective promoters, however, expression is invariably low compared with that from viral promoters. We have studied the ability of heterologous enhancers to boost expression in endothelial cells from endothelial cell specific promoters. We employed minimal promoter elements of human VEGF receptor 2 (KDR) and E-selectin.1 Both molecules are specificaly expressed in endothelium23 and show increased activity in tumour endothelium.456 Therefore they offer a tool for targeting the tumour vasculature. To increase endothelial cell specific promoter activity we employed exogenous hypoxic and cytokine-inducible enhancer elements inserted 5′ of the promoters.

Measurements in tumours using tissue oxygen electrodes show oxygen tensions 10 times lower than in normal tissues7 and hypoxia is one of the major drives for tumour progression. A transcriptional response to hypoxia mediated by the inducible transcription complex hypoxia inducible factor-1 (HIF-1) has been identified.8 HIF-1 binds to DNA motifs known as hypoxia response elements (HREs) which have been found in the isoforms of a variety of genes that are overexpressed in cancer. These include VEGF, glucose transporters, enzymes of the glycolytic pathway and the VEGF receptor 1 (flt-1). HIF-1 can be activated by local hypoxia in the tumour microenvironment.910 Furthermore, in some types of tumour HIF-1 is constitutively active.11 The murine phosphoglycerate kinase-1 (PGK-1) HRE has been shown to transfer hypoxia inducibility to other promoters in vitro12 and in vivo.9 Recently, similar HREs have been incorporated into the SV40 minimal promoter in an adenoviral vector which worked well in vitro.13 We therefore used this enhancer in our studies.

Cytokines mediate the inflammatory response and are important modulators in vascular pathophysiology and during angiogenesis. In endothelial cells, expression of a variety of adhesion molecules which function in the rolling of leukocytes on the vessel wall is regulated by cytokines, such as E-selectin, ICAM-1 and VCAM-1.14 The downstream signal after cytokine activation leads to the release of the transcription factor NF-κB from IκB which then binds to a DNA motif within promoters of cytokine-inducible genes. We chose to use the tandem binding site for NF-κB from the murine vascular cell adhesion molecule-1 (VCAM-1) promoter.

In this study we have examined the ability of hypoxic and cytokine-inducible enhancers to increase expression from endothelial cell specific promoters while retaining specificity. Both enhancer elements functioned in combination with the endothelial cell specific promoters. Additionally, constructs containing both enhancer elements showed an additive response. These inducible enhancers could be a useful tool for vascular targeting of gene therapy.

Results

The hypoxia response element conferred hypoxia inducibility on the KDR promoter and maintained tissue specificity in transient transfection assays

A hypoxic enhancer containing two HREs of the murine PGK-1 5′ enhancer was inserted 5′ of the KDR promoter. The enhancer and promoter functions were studied in transient transfection experiments in the mouse skin endothelioma cell line sEND and Swiss murine 3T3 fibroblasts.

The HREs gave an 11-fold induction of luciferase expression in sEND cells after 16 h exposure to hypoxia (0.1% O2), and about seven-fold induction in 3T3 fibroblasts (Figure 1). Under hypoxia the KDR promoter in combination with the hypoxic enhancer was partially endothelial cell specific, showing 2.5-fold higher expression levels in sEND cells compared with 3T3 fibroblasts. The KDR promoter alone drove low levels of luciferase expression and showed no hypoxia inducibility in either cell type.

Figure 1
figure1

Enhancement of endothelial expression from the KDR promoter by hypoxic response elements after transient transfection and exposure to hypoxia. Skin endothelioma cells (sEND) and 3T3 fibroblasts were cotransfected with the Renilla luciferase reporter construct pRL-null containing the KDR or the HRE-KDR promoter and pGL3-control. Cells were incubated in normoxia or exposed to hypoxia (0.1% O2) for 16 h. The ratio of Renilla/firefly luciferase expression is shown (mean of three independent experiments, ± s.d.).

The hypoxic enhancer in combination with the KDR promoter increased gene expression under hypoxia after retroviral delivery

The hypoxic enhancer was combined with the KDR promoter in a retroviral vector to study the enhancer function after retroviral delivery. The self-inactivating (SIN) retroviral vector was used to minimise interference from the viral LTR promoter with the exogenous promoter in the viral constructs. Retroviruses with the hypoxic enhancer 5′ of the KDR promoter driving TNF-α (HRE-SKMT) or luciferase (HRE-SKL, Figure 2) were constructed. Murine endothelioma cells (sEND) and Swiss murine 3T3 fibroblasts were infected and stably transfected cell lines were generated (all stable cell lines were pooled populations). After exposure to hypoxia (0.1% O2, 16 h) cell lines infected with the HRE-containing virus expressed twice as much TNF-α or luciferase as cell lines infected with enhancerless virus (Figure 3). The orientation of the HREs did not affect the enhancer function (data not shown). Cell lines stably transfected with virus containing the KDR promoter alone, did not show any change in expression under hypoxia compared with normoxia. The absolute expression levels in cells infected with HRE-KDR or KDR alone under normoxia were the same, indicating that the enhancer was silent without hypoxic stimulation.

Figure 2
figure2

Retorviral constructs used in this study. A deletion in the U3 region of the 3′ LTR of the retroviral vector pBABE puro was introduced (dLTR) to generate the self-inactivating vector pBABE puro SIN. The inserts consisting of reporter genes with or without promoters and enhancers are indicated as described in Materials and methods.

Figure 3
figure3

Effect of a hypoxic enhancer on KDR promoter activity after retroviral delivery. Murine TNF-α and firefly luciferase were used as reporter genes, generating the viruses SKMT, HRE-SKMT and HRE-SKL. Levels of secreted mTNF-α protein or luciferase in stably transfected cell lines were measured after 16 h exposure to normoxia/hypoxia (0.1% O2). The mean of five independent experiments is shown ± s.d. For the calculation of luciferase the expression under normoxic conditions was set to one-fold. The 2.3-fold increase of expression in HRE-SKL infected cells under hypoxia is significant (P < 0.05).

The hypoxic enhancer was also functional in 3T3 fibroblasts, but the overall expression levels were about six- to 12-fold lower than in sEND cells when using TNF-α as reporter gene. Thus, the KDR promoter functioned as an endothelial cell selective promoter and was able to maintain the specificity even under hypoxia when the enhancer was active. Surprisingly, the KDR promoter showed little endothelial cell specificity when using luciferase as reporter gene with expression levels in 3T3 fibroblasts about 80% of the levels in sEND cells.

A promoterless construct was generated (HRE-SL) as a control. This virus induced no luciferase expression in the target cell lines following retroviral delivery confirming that the 3′ LTR of the self-inactivating retroviral vector pBABE puro SIN was indeed transcriptionally inactive. No expression was detected on exposure to hypoxia confirming that the HRE without the promoter was silent.

The more recently identified hypoxia inducible factor endothelial PAS domain protein-1 (EPAS-1)15 has in subsequent studies shown to be expressed in a wide variety of cell types.16 So there is probably little to be gained from attempting to exchange the PGK HRE used here for one that preferentially binds EPAS-1 rather than HIF-1 α.

The KDR promoter showed differential activity in various endothelial cell lines

The KDR promoter showed inconsistent endothelial cell selective expression. Therefore the promoter function was studied in transient transfections in various cell lines (Table 1).

Table 1 KDR promoter activity in various endothelial cell lines

These experiments demonstrated that the murine endothelioma cells (sEND) were one of the lowest expressing cell lines with even lower levels of luciferase expression than 3T3 fibroblasts. This was especially surprising in that 3T3 fibroblasts do not express KDR/flk-1 in contrast to sEND (Figure 4). Primary murine brain endothelial cells (PMBE) were the highest expressing cells and showed levels more than 10-fold higher than sEND cells. Other primary endothelial cell lines including bovine adrenal capillary endothelial cells (BACE) and bovine lymphatic endothelial cells (A9125) expressed lower levels compared with PMBE cells but still about three-fold more than sEND cells.

Figure 4
figure4

RT-PCR for KDR/flk-1. KDR/flk-1 mRNA could be detected in sEND cells (360 bp PCR product), but not in 3T3 fibroblasts.

The hypoxic enhancer transferred hypoxia inducibility to the E-selectin promoter, but the promoter lost endothelial cell specificity

Constructs containing the E-selectin promoter in combination with the hypoxic enhancer (HRE-SEL) or the E-selectin promoter alone (SEL) driving the firefly luciferase as reporter gene were constructed (Figure 2).

The E-selectin promoter conferred endothelial cell specificity and was inducible by TNF-alpha (10 ng/ml, 16 h) about 2.8-fold (Figure 5). In comparison to the E-selectin protein, which is upregulated 2–4 h after treatment with cytokines and diminishes after 8 h,17 the E-selectin promoter fragment in retroviral vector constructs was inducible after 4 h, reaching even higher levels after 16 h (data not shown). In fibroblasts, the promoter showed greater inducibility, but lower expression levels than in sEND (about four- to 10-fold lower). The HREs were functional in combination with the E-selectin promoter and increased expression levels under hypoxia three-fold, in combination with TNF 5.8-fold. Surprisingly, the HRE-E-selectin construct was even more inducible in fibroblasts (nearly 26-fold) after exposure to hypoxia and TNF-α compared with normoxia, resulting in higher luciferase expression in fibroblasts than in endothelial cells (Figure 5).

Figure 5
figure5

Effect of a hypoxic enhancer on E-selectin promoter activity after retroviral delivery. Luciferase expression was measured in cells stably transfected with the retroviruses SEL and HRE-SEL. Cells were exposed to hypoxia (0.1% O2) and TNF-α (10 ng/ml) for 16 h. Values shown are the mean of six independent experiments. The differences between each culture condition are significant (P < 0.05). Differences between sEND cells and 3T3 are only significant in the case of the SEL, but not of the HRE-2-SEL infected cells. The absolute luciferase expression levels in sEND cells infected with SEL or HRE-2-SEL under normoxic conditions without TNF-α treatment are the same and normalised to a value of 1.

The NF-κB binding sites conferred cytokine inducibility to the KDR promoter and functioned additively with the hypoxic enhancer

The tandem NF-κB binding site of the murine VCAM promoter was used as a cytokine-inducible enhancer and inserted 5′ of the KDR promoter in a retroviral construct (NFκB-SKL, Figure 2). The expression levels in stably transfected sEND cells increased about 40% (P < 0.05) after treatment with TNF-α (10 ng/ml, 16 h) (Figure 6) whereas using the KDR promoter alone no substantial changes occurred (P > 0.1). In 3T3 fibroblasts the NFκB-binding site was also functional and the overall expression levels about 80% of the expression in sEND cells (data not shown).

Figure 6
figure6

Effect of a cytokine-inducible enhancer on KDR promoter activity after retroviral delivery. The fold enhancement was calculated by dividing the expression levels after stimulation by baseline levels of expression. sEND cells were infected with NFkB-SKL retrovirus. The fold enhancement after stimulation with TNF-α (10 ng/ml, 16 h) is significant (*P < 0.05), whereas the slight increase in sEND cells infected with SKL is not. (The mean of five independent experiments is shown.) PMBE cells were infected with the HRE-NFkB-SKL retrovirus and stimulated with TNF-α (10 ng/ml) or/and hypoxia (0.1% O2) for 6 h and 16 h. The values show the mean of five independent experiments. (# has been measured only twice; the mean is shown.)

Two HREs and two NFκB tandem binding sites were combined with the KDR promoter in a retroviral construct (HRE-NFκB-SKL). Primary murine endothelial cells were infected and a stable cell line was generated. Luciferase expression in these cells could be induced with TNF-α and hypoxia. When both stimuli came together the increase of gene expression was additive (2.3-fold higher expression levels after 6 h and 2.7-fold higher after 16 h, Figure 6). This represented the highest enhancement of gene expression by the KDR promoter following retroviral delivery achieved in our experiments.

Discussion

A vector that can target gene expression specifically to endothelial cells has numerous clinical applications ranging from therapies for arteriosclerosis to cancer. To explore this possibility, we previously examined endothelial cell specific promoters following retroviral delivery.1 Specificity was retained but expression from these promoters was low. We have now extended these studies to examine the potential for heterologous enhancer elements to boost transcription, while retaining endothelial specificity of expression.

The first approach utilised the HRE of the murine phosphoglycerate kinase-1 gene as a hypoxic enhancer inserted on to the endothelial cell specific promoters KDR and E-selectin. Tumours characteristically contain regions of hypoxia in which the enhancer will be active. The KDR promoter contains no HREs and expression of KDR itself is not regulated by hypoxia.18 Incorporation of two HREs next to the truncated KDR promoter minimally increased expression under normoxia but substantially increased expression under 0.1% oxygen following transient transfection in vitro (Figure 1). Endothelial specificity of expression was retained under hypoxia.

The hypoxic enhancer was then inserted into a retroviral vector to study the enhancer function after retroviral gene delivery. In these experiments, murine TNF-α (as previously used in Jaggar et al1) and luciferase were examined as reporter genes. While the overall picture remained the same as for the transient transfections, differences were apparent. Most notably (1) hypoxic enhancement from the KDR promoter was less; and (2) while endothelial specificity was retained with TNF-α as reporter, it was less with luciferase as reporter (Figure 3). The molecular explanations of these differences are not clear. Nevertheless, in line with similar studies, the tissue specific promoters show greater specificity after retroviral delivery, however, the enhancers are stronger when delivered as circular plasmids. We believe that this is due to greater accessibility of both the promoter and enhancer elements to transcription factors in the plasmid compared with integrated DNA leading to promiscuous expression from the promoter and greater activity of the enhancer. The enhancement reported here for HREs on endothelial selective promoters is similar to that previously reported with other promoters and cell lines.912

Examination of the KDR promoter function after transient transfections in different endothelial cell lines revealed major differences in expression levels (Table 1). It is clearly shown in these data that primary endothelial cell lines expressed higher levels of the reporter gene than the immortalised mouse endothelial cell lines sEND and the PMBE-derived bEND. The primary mouse brain endothelial cells (PMBE) were particularly high expressers. This points to caution in the use of immortalised endothelial lines as models for gene therapy.

While the KDR promoter fragment used here has previously been shown to control endothelial cell specific expression,1920 other regulatory elements have been recognised and thought to reside in the first intron.21 This is supported by the report that a 4 kb fragment of the KDR promoter failed to target lacZ expression to any cell (including endothelial cells) in a transgenic mouse.22 It is possible that a longer promoter fragment might improve endothelial cell specific expression.

A further approach examined the effect of the same hypoxic enhancer on expression from the E-selectin promoter following retroviral delivery. The hypoxic enhancer substantially increased gene expression under hypoxia, however, in contrast to the minimal KDR promoter used, the E-selectin promoter lost endothelial selectivity following incorporation of the HRE (Figure 5). The loss of selectivity was particulary marked after stimulation with TNF-α and hypoxia, where the induction of gene expression in 3T3 fibroblasts was much higher than in endothelial cells.

In the final set of experiments we turned our attention to a second transcriptional enhancer that could be of therapeutic use, the inflammatory cytokine inducible enhancer of NFκB. Figure 6 shows that a minimal binding site for NFκB confers TNF-α inducibility on the truncated KDR promoter, not seen in its absence. While the KDR is not directly regulated by hypoxia,18 the effect of TNF-α on expression from the KDR promoter is complex and controversial. Thus, while some groups report up-regulation of KDR expression by TNF-α,24 others report the complete opposite.24 All that we can say here is that the minimal promoter unit we employed showed very little cytokine inducibility but that this could be significantly enhanced by addition of a minimal NFκB binding site from the VCAM promoter. More interestingly the HRE and NFκB binding sites operate synergistically and boost luciferase expression from the KDR promoter.

The aim of these studies was three-fold, namely, (1) to examine whether heterologous enhancer elements could increase expression from endothelial cell specific promoters; (2) to determine whether the endothelial specificity of expression was retained; and (3) to examine whether multiple enhancers may function additively/synergistically. The answers clearly depended on the promoter elements studied. With a minimal KDR promoter the answer to all three questions is yes. With a minimal E-selectin promoter, a HRE conferred hypoxia inducibility but preferential endothelial expression was lost. We have shown for the first time that heterologous enhancers may be used to increase endothelial specific expression. This represents a useful step towards the development of functional vectors for targeting the vasculature.

Materials and Methods

Cell lines

Swiss murine 3T3 fibroblasts were provided by Dr C Norbury (ICRF, Clinical Oncology Unit, Oxford, UK). Skin endothelioma cells (sEND) and brain endothelioma cells (bEND), which were isolated from endotheliomas induced in mice containing ES cells infected with a retrovirus expressing polyoma middle T antigen25 were obtained from Professor Kay Davies (Department of Biochemistry, University of Oxford, UK). Primary murine brain endothelial cells (PMBE) were the kind gift of Dr U Tonsch (Boehringer Ingelheim, Vienna, Austria). The retroviral packaging cell line am1226 was obtained from Dr R Vile (ICRF, Gene Therapy Group, St Thomas’ Hospital, London, UK) and the bovine lymphatic endothelial cells (A9125) from Dr M Pepper.27 Bovine adrenal capillary endothelial cells (BACE) have been isolated as described before.28 3T3, sEND, bEND and am12 cells were grown in Dulbecco's modified Eagle medium (DMEM, prepared by ICRF, Clare Hall Central Services) supplemented with 10% fetal calf serum (FCS). PMBE cells were cultured in Gibco's medium 199, 10 mM HEPES buffer, 20 μg/ml endothelial cell growth supplement (ECGS), 100 μg/ml heparin, 10% FCS. BACE were grown in DMEM, 10% FCS, 100 μg/ml heparin, 30 μg/ml ECGS and A9125 in DMEM, 20% FCS with 1 mM sodium pyruvate.

Construction of hypoxic and cytokine-inducible enhancers

Sense and antisense oligonucleotides (24 mers) of the hypoxia response element (HRE) of the mouse PGK-1 5′ enhancer (ATTTGTCACGTCCTGCACGACGCG) with linkers containing BamHI or BglII restriction sites were designed. The oligonucleotides were annealed, ligated together to form concatamers and then digested by BamHI/BglII enzymes to cut incorrectly linked oligos. The cytokine-inducible enhancer was the tandem NF-κB binding site of the murine VCAM promoter (CTGGGTTTCCCCTTGAAGGGATTTCCCTC). Oligonuc- leotides (30 mers) were designed as above and concatamerised. The concatamers were purified by agarose gel electrophoresis and then ligated into the BamHI site of pBABE puro SIN (see below).

Construction of retroviral vectors

The self-inactivating retroviral vector pBABE puro SIN was used. The SIN vector was generated by Dr R Jaggar1 by deletion of a 299-bp PvuII–SacI fragment within the 3′LTR of pBABE puro29 (obtained from Dr R Vile). The deletion in the U3 region of the 3′LTR removed the retroviral enhancer elements and the CCAAT box but not the retroviral TATA box.30 The 1.0-kb cDNA of the murine TNF-α (obtained from Professor W Fiers, Gent, Belgium) was ligated into the SalI site of pBABE puro SIN (pBABE puro SIN-mTNF). The 1.7 kb cDNA of the firefly luciferase from pGL3 basic (Promega, Madison, WI, USA) was end-filled and blunt-end ligated into the SalI site of pBABE puro SIN (pBABE puro SIN-Luc) to generate the constructs with luciferase as reporter gene. A 494 bp fragment of the human KDR promoter (−226 to +268, generated by Dr HY Chan, Molecular Angiogenesis Laboratory, Oxford, UK) was cloned as a BamHI–EcoRI fragment into pBABE puro SIN-mTNF (SKMT) and pBABE puro SIN-Luc (SKL). A 888 bp fragment of the 5′ proximal promoter of E-selectin (−839 to +49, obtained from Professor T Collins, Harvard Medical School, Boston, MA, USA) with an introduced mutation in the AATAAA sequence in position −208 to −2031 was transferred as a BamHI–EcoRI fragment from pBluescript KS into pBABE puro SIN-Luc (SEL). The hypoxia-inducible enhancer or cytokine-inducible enhancer was cloned into the BamHI site 5′ of the promoters to generate HRE-SKMT, HRE-SKL and HRE-SEL, NF-κB-SKL or HRE-NFκB-SKL. All enhancers were completely sequenced (ABI 377 automated sequencing apparatus; Perkin Elmer, Norwalk, CT, USA) to confirm the number and orientation of the binding sites. The proviral structures of the vectors are shown in Figure 2.

Packaging of retroviruses and infection of cell lines

The retroviral packaging cell line am12 was transfected with 20 μg of each vector plasmid by calcium phosphate precipitation and selected in 1.25 μg/ml puromycin for 20 days. The colonies were pooled to generate a retroviral producing cell line. At confluence, the culture medium was replaced with 50% of the standard volume. Twenty-four hours later, the virus containing medium was filtered through a 0.45-μm filter and stored at −70°C. For infection 3T3, sEND and PMBE cells were exposed to the virus for 4 h in the presence of 8 μg/ml polybrene in a serum-free medium. After 48 h cells were selected with 3.5 μg/ml (3T3, sEND) or 2.5 μg/ml (PMBE) puromycin and resistant colonies pooled to generate stable infected cell lines.

Analysis of luciferase expression

Firefly luciferase enzyme activity was measured following the standard single luciferase assay (Promega). Cells were cultured in six-well plates and exposed to hypoxia (0.1% oxygen) or TNF-α (10 ng/ml) for 16 h. Then they were gently washed with PBS twice and lysed by adding 500 μl passive lysis buffer (Promega). Samples were collected after 15 min incubation on a rocking table and 20 μl aliquots were measured for luciferase enzyme activity for 10 s in a single-sample luminometer. To calculate the cell numbers in different samples, the protein concentrations of the lysates were measured using the BCA (bicinchoninic acid) protein quantification kit (Pierce, Rockford, IL, USA).

Analysis of murine TNF-α protein production

Cells were cultured in six-well plates and exposed to hypoxia (0.1% oxygen) for 16 h. The medium was collected, filtered through a 0.2 μm filter and stored at −70°C until further analysis. Levels of murine TNF-α were measured using a factor-X test enzyme-linked immunosorbent assay (ELISA) kit (Genzyme, Cambridge, MA, USA). Cells were trypsinised and lysed in 0.05 M Tris, 0.15 M NaCl, 1% NP-40. The protein concentration of the different samples was measured using the BCA protein quantification kit (Pierce). Results were calculated as pg mTNF-α per milligramme total protein.

Transient transfection

The function of the KDR promoter and the effects of the HRE on KDR were studied in a standard dual luciferase assay (Promega). The KDR and HRE-KDR promoter fragments were inserted as BglII–EcoRI fragments into the Renilla luciferase expression vector pRL null (Promega). To correct the transfection efficiency, cells were cotransfected with pGL3-control containing the SV40 promoter and enhancer (Promega). Twenty-five microgrammes of each plasmid was transfected into 106 cells by electroporation (1 mF, 350 mV). After 24 h, cells were supplied with new medium and exposed to normoxia or hypoxia (0.1% O2) for 16 h. Cells were harvested by passive lysis and Renilla and firefly luciferase activities of 20 μl aliquots were measured in a single sample luminometer for 10 s.

RT-PCR of flk-1

Random hexamer primer was used for the reverse transcription. A 362 bp fragment between +3873 and +4235 of the KDR/flk-1 mRNA was amplified by PCR in 26 cycles of 94°C, 1 min, 60°C, 1 min, 72°C, 1 min using 22 mer primers (5′ GTTTCCTGTATGGAGGARGAGG 3′ sense strand; 5′ TACACGGTGGTGGTCT GTGTCAT 3′ antisense strand).

References

  1. 1

    Jaggar RT et al. Endothelial cell-specific expression of tumor necrosis factor-a from the KDR or E-selectin promoters following retroviral delivery Hum Gene Ther 1997 8: 2239–2247

    CAS  Article  Google Scholar 

  2. 2

    Quinn TP et al. Fetal liver kinase 1 is a receptor for vascular endothelial growth factor and is selectively expressed in vascular endothelium Proc Natl Acad Sci USA 1993 90: 7533–7537

    CAS  Article  Google Scholar 

  3. 3

    Bevilacqua MP et al. Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins Science 1989 243: 1160–1165

    CAS  Article  Google Scholar 

  4. 4

    Brown LF et al. Expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in breast cancer Hum Pathol 1995 26: 86–91

    CAS  Article  Google Scholar 

  5. 5

    Kraling BM et al. E-selectin is present in proliferating endothelial cells in human hemangiomas Am J Pathol 1996 148: 1181–1191

    CAS  PubMed  PubMed Central  Google Scholar 

  6. 6

    Fox SB et al. The increased expression of adhesion molecules ICAM-3, E- and P-selectins on breast cancer endothelium J Pathol 1995 177: 369–376

    CAS  Article  Google Scholar 

  7. 7

    Vaupel PW . Oxygenation of solid tumors. In: BA Teicher (ed.) Drug Resistance in Oncology Marcel Decker: New York 1993 53–85

    Google Scholar 

  8. 8

    Wang GL et al. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension Proc Natl Acad Sci USA 1995 92: 5510–5514

    CAS  Article  Google Scholar 

  9. 9

    Dachs GU et al. Targeting gene expression to hypoxic tumor cells Nature Med 1997 3: 515–520

    CAS  Article  Google Scholar 

  10. 10

    Maxwell PH et al. Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth Proc Natl Acad Sci USA 1997 94: 8104–8109

    CAS  Article  Google Scholar 

  11. 11

    Maxwell PH et al. The tumour supressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolyses Nature 1999 399: 271–275

    CAS  Article  Google Scholar 

  12. 12

    Firth JD et al. Oxygen-regulated control elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: similarities with the erythropoietin 3′ enhancer Proc Natl Acad Sci USA 1994 91: 6496–6500

    CAS  Article  Google Scholar 

  13. 13

    Binley K et al. An adenoviral vector regulated by hypoxia for the treatment of ischaemic disease and cancer Gene Therapy 1999 6: 1721–1727

    CAS  Article  Google Scholar 

  14. 14

    Collins T et al. Transcriptional regulation of endothelial cell adhesion molecules: NF-kB and cytokine-inducible enhancers FASEB J 1995 9: 899–910

    CAS  Article  Google Scholar 

  15. 15

    Tian H, Mcknight SL, Russell DW . Endothelial pas domain protein 1 (Epas1), a transcription factor selectively expressed in endothelial cells Gene Dev 1997 11: 72–82

    CAS  Article  Google Scholar 

  16. 16

    Wiesener MS et al. Induction of endothelial Pas domain protein-1 by hypoxia: characterization and comparison with hypoxia-inducible factor-1alpha Blood 1998 92: 2260–2268

    CAS  PubMed  PubMed Central  Google Scholar 

  17. 17

    Boyle EMJ et al. Transcriptional arrest of the human E-selectin gene J Surg Res 1999 82: 194–200

    CAS  Article  Google Scholar 

  18. 18

    Gerber H-P et al. Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes J Biol Chem 1997 272: 23659–23667

    CAS  Article  Google Scholar 

  19. 19

    Yin LY et al. Genomic structure of the human KDR/flk-1 gene Mamm Genome 1998 9: 408–410

    CAS  Article  Google Scholar 

  20. 20

    Hata Y et al. Transcription factors Sp1 and Sp3 alter vascular endothelial growth factor receptor expression through a novel recognition sequence J Biol Chem 1998 273: 19294–19303

    CAS  Article  Google Scholar 

  21. 21

    Kappel A et al. Identification of vascular endothelial growth factor (VEGF) receptor-2 (Flk-1) promoter/enhancer sequences sufficient for angioblast and endothelial cell-specific transcription in transgenic mice Blood 1999 93: 4284–4292

    CAS  Google Scholar 

  22. 22

    Patterson C et al. Nuclear protein interactions with the human KDR/Flk-1 promoter in vivo. Regulation of Sp1 binding is associated with cell type-specific expression J Biol Chem 1997 272: 8410–8416

    CAS  Article  Google Scholar 

  23. 23

    Giraudo E et al. Tumor necrosis factor-alpha regulates expression of vascular endothelial growth factor receptor-2 and of its co-receptor neuropilin-1 in human vascular endothelial cells J Biol Chem 1998 273: 22128–22135

    CAS  Article  Google Scholar 

  24. 24

    Patterson C et al. Down-regulation of vascular endothelial growth factor receptors by tumor necrosis factor-alpha in cultured human vascular endothelial cells J Clin Invest 1996 98: 490–496

    CAS  Article  Google Scholar 

  25. 25

    Williams RL, Courtneidge SA, Wagner EF . Embryonic lethalities and endothelial tumors in chimeric mice expressing polyoma virus middle T oncogene Cell 1988 52: 121–131

    CAS  Article  Google Scholar 

  26. 26

    Markowitz D, Goff S, Bank A . Construction and use of a safe and efficient amphotropic packaging cell line Virology 1988 167: 400–406

    CAS  Article  Google Scholar 

  27. 27

    Pepper MS et al. In vitro angiogenic and proteolytic properties of bovine lymphatic endothelial cells Exp Cell Res 1994 210: 298–305

    CAS  Article  Google Scholar 

  28. 28

    McCarthy SA, Bicknell R . Responses of pertussis toxin-treated microvascular endothelial cells to transforming growth factor beta 1. No evidence for pertussis-sensitive G-protein involvement in TGF-beta signal transduction J Biol Chem 1992 267: 21617–21622

    CAS  PubMed  Google Scholar 

  29. 29

    Morgenstern JP, Land H . Advanced mammalian gene transfer: high titre vectors with multiple drug selection markers and a complementary helper-free packaging cell line Nucleic Acids Res 1990 18: 3587–3596

    CAS  Article  Google Scholar 

  30. 30

    Yu SF et al. Self-inactivating retroviral vectors designed for transfer of whole genes into mammalian cells Proc Natl Acad Sci USA 1986 83: 3194–3198

    CAS  Article  Google Scholar 

Download references

Acknowledgements

The authors thank Dr Martin K Oehler of the Angiogenesis Laboratory for helpful discussions, especially concerning statistical analysis of data. This work was funded by the Imperial Cancer Research Fund. CWP thanks the Medical Research Council (UK) for financial support.

Author information

Affiliations

Authors

Corresponding author

Correspondence to R Bicknell.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Modlich, U., Pugh, C. & Bicknell, R. Increasing endothelial cell specific expression by the use of heterologous hypoxic and cytokine-inducible enhancers. Gene Ther 7, 896–902 (2000). https://doi.org/10.1038/sj.gt.3301177

Download citation

Keywords

  • endothelial
  • KDR
  • E-selectin
  • promoter
  • hypoxic enhancer
  • cytokine-inducible enhancer

Further reading

Search

Quick links