Identification of a rare e8a2 BCR-ABL fusion gene in three novel chronic myeloid leukemia patients treated with imatinib

TO THE EDITOR

Most patients (more than 95%) with chronic myeloid leukemia (CML) express the BCR-ABL transcript with the b2a2 (e13a2) or b3a2 (e14a2) junctions corresponding to the major BCR gene breakpoint cluster region (M-BCR). We and others have reported that a small proportion of CML patients (1–2%), who have breakpoints that fall outside of the M-BCR in chromosome 22, give rise to a shortened BCR-ABL transcript with an e1a2 junction (m-BCR), e6a2, b2a3 (e13a3), b3a3 (e14a3) or longer BCR-ABL transcripts with an e19a2 (μ-BCR) junction (Figure 1a). The majority of these atypical transcripts encode fusion proteins that lack or retain different BCR domains, which could influence the clinical phenotype of the disease entity.1 The clinical and hematologic features of eight additional patients with e8a2 BCR-ABL fusions transcripts have been recently reviewed2 and, according to the authors, could be associated with a worse prognosis than M-BCR transcripts. An inverse correlation between the size of the BCR portion retained in the fusion protein and the aggressive behavior of the disease was suggested and thus BCR domains could attenuate the leukemic phenotype.2 In this manuscript, we report for the first time to our knowledge, three additional CML patients with an e8a2 BCR-ABL fusion transcript treated with imatinib mesylate with a median follow-up of 34 months.

Figure 1
figure1

(a) Partial maps of BCR and ABL genes. Exons are indicated by boxes. Breakpoints from BCR gene are shown by black arrows. The nucleotide numbers for the intron Ib from ABL gene (Genbank accession no. U07561); nt: nucleotide. Intronic sequence is in small. (b) Quantification of BCR-ABL e8a2 transcripts after imatinib treatment. The monitoring of the minimal residual disease (MRD) was carried out using real-time PCR with forward primers 5′CGCATCTCACAGAACTTCCT3′, case (no. 1); 5′AAGGGAGAGGGAGAAGACAGGA3′, cases (no. 2 and no. 3) from BCR gene and reverse primer (ENR561) and probe (ENP541) from ABL gene.3 Primers (ENF1003, EN R1063) and probe (EN P1043) from ABL control gene were used to normalize results.3 For PCR calibration, a serial 10-fold dilution series of e8a2 cDNA from the sample before imatinib mesylate therapy (ranging from 106 to 101 copies) was amplified and the assay was found to be linear over at least five orders of magnitude (case no. 1: slope −3.47, intercept 40.8; case no. 2 and no. 3: slope −3.53, intercept 41). The final results were calculated as ratios BCR-ABL/ABL.

These cases (patients no. 1, 2 and 3) were diagnosed with CML in chronic phase based on typical peripheral blood findings and on standard karyotyping analyses indicating t(9;22)(q34;q11). The relevant clinical and biological data for the patients are given in Table 1. In case no. 1, fluorescence in situ hybridization (FISH) analysis performed with dual color probes for BCR and ABL genes (LSI bcr/abl ES Dual Color Translocation Probe, VYSIS Downer's Grove, IL, USA) showed a typical M-BCR picture in 20 metaphases and 100 interphase nuclei (data not shown) which was different from the case previously described.2 The first case (no. 1), a 40-year-old male patient, was referred to the Centre Hospitalier Lyon Sud hospital in July 2002 for hyperleukocytosis at 39 × 109/l with myelemia, discovered on a systematic peripheral blood analysis. After karyotyping analysis, imatinib was introduced in August 2002. The cases no. 2 and no. 3 were referred to the Saint Louis hospital in February 2002 and November 2002, and imatinib was introduced in March and December 2002, respectively. In all cases, multiplex RT-PCR performed for BCR-ABL at diagnosis showed an atypically large fragment that turned out to correspond, after direct sequencing, to an e8a2 fusion transcript with a 55 base pair (bp) insert that wholly matched an inverted sequence from ABL intron Ib (Figure 1a). The monitoring of the minimal residual disease (MRD) was carried out using real-time RT-PCR3 with specific forward primers, located close to the e8-BCR (Figure 1b). The introduction of imatinib mesylate therapy at 400 mg/day allowed complete hematologic and cytogenetic responses at 6 months and a major molecular response in all cases, with a reduction of at least three logs of BCR-ABL transcript levels compared to the diagnosis, at a median follow-up of 34 months (range 30–39) (Figure 1b). Of note, in cases no. 2 and no. 3, a major molecular response was obtained only after increasing the dosage of imatinib, suggesting that those patients may require higher doses (600 mg/day) of imatinib to achieve proper molecular response. Most of the previously described patients with an e8a2 BCR-ABL fusion transcript had thrombocytosis and seemed to be associated with worse prognosis.2 None of the cases described here showed thrombocytosis (Table 1). Moreover, none of the patients previously described, treated with interferon-α, achieved even a minor response; all of the cases treated with imatinib were alive at a median follow-up of 34 months, achieved complete cytogenetic remission at a median follow-up of 7 months and a major molecular remission (BCR-ABL/ABL<0,12%) at a median follow-up of 20 months indicating thus the efficacy of imatinib mesylate in patients with rare BCR-ABL transcripts. The aggressive clinical course of these leukemias suggested previously could be shrouded by appropriate targeted therapy. The direct junction between exons e8 from BCR gene and a2 from ABL gene would generate a stop codon. The open reading frame was preserved either by insertion of intronic sequences from ABL gene, or either (in 3/11 cases described previously) with a break inside the exon e8 from BCR gene.2 An interesting common feature was that in all cases described here (and in three previously reported patients,2, 4, 5 which accounts for more than 50% of the e8a2 patients described to date and therefore could represent the most frequent rearrangement in e8a2 patients) molecular study showed an identical 55 bp inverted fragment insertion from ABL intron Ib (Figure 1a). It has been suggested that the presence of translisin recognition sites, ALU sequences or cryptic splice site signals in the translocation region could contribute to these complex rearrangements.5, 6, 7 This 55 bp inverted fragment added to the two first nucleotides of exon a2 from ABL gene is capable of encoding 19 amino acids. Protein motif analysis using the PROSITE database indicated that they contain a Clathrin box motif, found on cargo adaptator proteins (amino acids 14–18, Figure 1a). There is little information about the biological function of this protein feature, but it could be involved in endocytosis or in cooperative interaction between proteins in vesicular trafficking.8 Obviously, structure/function studies would bring a more comprehensive survey on the real biological significance of this small motif insertion.

Table 1 Clinical and molecular characteristics of CML patients with e8a2 rearrangement

Very few patients have been reported with the unusual e8a2 BCR-ABL transcript; prediction concerning their clinical outcome or the best rational strategy to avoid progression9 cannot yet be made even if the efficacy of imatinib mesylate therapy was confirmed in this study. A longer follow-up and the analysis of a large number of patients with e8a2 BCR-ABL fusions is absolutely necessary to take into account the clinical outcome of these patients and for proper assessment of prognosis in the presence of these rare transcripts. The study of these unusual BCR-ABL junctions and their associated disease seems to be essential to gain more insights into their molecular pathological function and a more comprehensive survey of the different functions of the BCR-ABL chimeric protein.

References

  1. 1

    Melo JV . The diversity of BCR-ABL fusion proteins and their relationship to leukaemia phenotype. Blood 1996; 88: 2375–2384.

    CAS  PubMed  Google Scholar 

  2. 2

    Demehri S, Paschka P, Schultheis B, Lange T, Koizumi T, Sugimoto T et al. e8a2 BCR-ABL: more frequent than other atypical BCR-ABL variants? Leukemia 2005; 19: 681–684.

    CAS  Article  Google Scholar 

  3. 3

    Gabert J, Beillard E, van der Veden VHJ, Bi W, Grimwade D, Pallisgaard N et al. Standardisation and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) of fusion gene transcripts for residual disease detection in leukaemia – A Europe Against Cancer Program. Leukemia 2003; 17: 2318–2357.

    CAS  Article  Google Scholar 

  4. 4

    Branford S, Rudzki Z, Hughes TP . A novel BCR-ABL transcript (e8a2) with the insertion of an inverted sequence of ABL intron 1b in a patient with Philadelphia-positive chronic myeloid leukaemia. Br J Haematol 2000; 109: 635–637.

    CAS  Article  Google Scholar 

  5. 5

    Sugimoto T, Ijima K, Hisatomi H, Murayama T, Mizuno I, Hato A et al. Second case of CML with aberrant BCR-ABL fusion transcript (e8/a2) with insertion of an inverted ABL intron 1b sequence. Am J Hematol 2004; 77: 164–166.

    Article  Google Scholar 

  6. 6

    Martinelli G, Terragna C, Amabile M, Montefusco V, Testoni N, Ottaviani E et al. Translisin recognition site sequences flank translocation breakpoints in a Philadelphia chromosome positive chronic myeloid leukemia patient expressing a novel type of chimeric BCR-ABL transcript (E8-INT-A2). Leukemia 1999; 13: 1635–1637.

    CAS  Article  Google Scholar 

  7. 7

    Martinelli G, Terragna C, Amabile M, Montefusco V, Testoni N, Ottaviani E et al. Alu and translisin recognition site sequences flanking translocation sites in a novel type of chimeric bcr-abl transcript suggest a possible general mechanism for bcr-abl breakpoints. Haematologica 2000; 85: 40–46.

    CAS  PubMed  Google Scholar 

  8. 8

    Le Roy C, Wrana JL . Clathrin- and non-clathrin-mediated endocytic regulation of cell signalling. Nat Rev Mol Cell Biol 2005; 6: 112–126.

    CAS  Article  Google Scholar 

  9. 9

    Hochhaus A, La Rosée P . Imatinib therapy in chronic myelogenous leukemia : strategies to avoid and overcome resistance. Leukemia 2004; 18: 1321–1331.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

This work was supported by the Hospices Civils de Lyon, Ligue contre le cancer du Rhône (to SH, FEN, KC) and a grant from Cancéropôle Lyon Auvergne Rhône-Alpes (CLARA) 2003 (to SH, FEN). We thank Annick Bertholin for technical assistance.

Author information

Affiliations

Authors

Corresponding author

Correspondence to S Hayette.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Cayuela, J., Rousselot, P., Nicolini, F. et al. Identification of a rare e8a2 BCR-ABL fusion gene in three novel chronic myeloid leukemia patients treated with imatinib. Leukemia 19, 2334–2336 (2005). https://doi.org/10.1038/sj.leu.2403986

Download citation

Further reading

Search