Table 2 Amplification characteristics of developed SNP allele-specific primers in real-time PCR

From: Quantification of donor and recipient hemopoietic cells by real-time PCR of single nucleotide polymorphisms

Gene/STR SNP Allele-specific primer (5′ to 3′) a Amplification ΔCtc
    pos. allele neg. allele  
    C t ΔRnb C t ΔRn  
PECAM1 C AGGACTCACCTTCCACCAACCC G (R) 22.9 1.1 44.8 0.1 21.9
  G AGGACTCACCTTCCACCAACCT C (R) 25.0 1.1 41.4 0.1 16.4
ICAM1 G AGAGCACATTCACGGTCACCCA C (R) 25.5 1.1 38.1 0.3 12.6
  A AGAGCACATTCACGGTCACCATT (R) 24.9 1.1 36.1 0.8 11.2
HA1 C–A GCTCTCACCGTCACGCAA (R) 24.9 1.4 39.9 0.1 15.0
  T–G GCTCTCACCGTCATGCC G (R) 24.1 1.3 40.2 0.2 26.1
MLH1 G TCGTGCTCACGTTCTTCCTCC (R) 23.9 1.2 38.5 0.3 14.6
  A TCGTGCTCACGTTCTTCCATT (R) 24.5 1.2 35.9 0.8 11.4
SUR1 C TGCCACCCTCCCTCCCTA C (F) 23.9 1.1 38.5 0.5 14.6
  T TGCCACCCTCCCTCCCTA T (F) 24.5 1.1 35.9 0.8 11.4
G42863 A GGCTTGTGGATGAAGGAGA A (F) 22.0 1.1 34.9 0.8 12.9
  C GGCTTGTGGATGAAGGAGT C (F) 22.5 1.1 34.8 0.8 12.3
G42888 T GGGGAGGGGAGGAAGAGAC T (F) 21.4 1.1 35.1 0.3 13.7
  C GGGGAGGGGAGGAAGAGAG C (F) 20.9 1.1 35.1 0.7 14.2
  1. apolymorphic nucleotides are given in bold and mismatched nucleotides introduced to decrease background amplification are underlined: (F)=forward primer; (R)=reverse primer.
  2. bNormalized reporter signal−baseline signal.
  3. cCt of negative allele minus Ct positive allele.