Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Follicular lymphoma without t(14;18) and with BCL-6 rearrangement: a lymphoma subtype with distinct pathological, molecular and clinical characteristics

Leukemia volume 16, pages 2309–2317 (2002)Cite this article

Abstract

Translocations involving the BCL-6 gene are frequently observed in diffuse large B cell lymphoma, but have rarely been reported in follicular lymphoma (FL). We studied a distinct cohort of FLs with a 3q27/BCL-6 gene rearrangement, but lacking the t(14;18) translocation. In 13/15 cases, translocations involved the 3q27 and the 14q32 regions. All cases displayed a marked follicular growth pattern and, in some instances, a monocytoid component. Tumor cells were CD5− CD20+ CD23− CD43− BCL-6+, and in the main CD10 negative (n = 10, 71%) and BCL-2 negative (n = 11, 78%). When compared to 20 typical t(14;18)+ FLs, the presence of large follicles (P = 0.01) and a CD10−/BCL-2− phenotype were more frequently observed (P = 0.001) in our cohort. Clonal mutations arising in the BCL-6 first intron were observed in 5/7 cases with evidence of intraclonal heterogeneity, consistent with a germinal center origin. No significant difference was found in comparison to t(14;18)+ FL regarding age, sex, performance status, bone marrow involvement or overall survival. However, in the 3q27+ FL group, a stage III/IV disease and a bulky mass were less frequently observed. This study indicates that 3q27+ FL without t(14;18) translocation have peculiar clinico-pathologic features and may correspond to a rare and distinct subtype of lymphoma originating from the germinal center.

Download PDF

Introduction

Follicular lymphoma (FL) is one of the most common subtypes of non-Hodgkin's lymphoma (NHL) in the western world. FL tumor cells reside in the germinal center (GC), and are characterized by the t(14;18)(q32;q21) translocation which occurs in 80–90% of cases.1 A consequence of the translocation is a functional overexpression of the anti-apoptotic BCL-2 protein,2,3,4,5,6 which is usually not expressed in normal GC centroblastes and centrocytes.7,8 In contrast, the product of the BCL-6 gene on chromosome 3q27, a transcriptional repressor9 which regulates normal GC B-cell function,10,11 is highly expressed in these cells. High levels of BCL-6 protein are also observed in FL tumors, irrespective of 3q27 translocations7,12 which occur in 9–14% of FL cases as detected by conventional cytogenetics or Southern blotting.13,14,15 By comparison, BCL-6 expression levels are variable in diffuse large B-cell lymphomas (DLBCL),7,16 which carry a higher frequency of translocation into the 3q27 locus.13,17,18 In about half FLs, BCL-6 rearrangements, when present, occur together with the t(14;18) event, considered as the primary genetic event.13,17,19

FL with BCL-6 rearrangements in the absence of any evidence for t(14;18) translocation have rarely been reported in the literature.13,14,20 We report 15 such cases and compare their characteristics with those of FL bearing the hallmark t(14;18) translocation. Using immunophenotype and mutational analysis of the first BCL-6 intron, a marker of GC transit,21,22,23,24,25,26 we identified a subtype of indolent lymphoma which is closely related to typical FL, but is characterized by distinctive pathological features.

Materials and methods

Patient selection

Patients diagnosed between 1984 and 2001 with FL were selected from the cytogenetic data base of the Centre Henri Becquerel (Rouen, France). Selection criteria for this study were: (1) a diagnosis of follicular lymphoma confirmed by at least two pathologists; (2) the absence of t(14;18) translocation by standard cytogenetic and/or molecular analysis; and (3) the presence of a 3q27 rearrangement. Fifteen FL cases fulfilled these criteria. Twelve of these were found in a series of 225 FL (5.3%) in which cytogenetic analysis were available and performed at the time of diagnosis (Table 1), including 149 t(14;18)+/3q27− cases (66%) and 21 t(14;18)+/3q27+ cases (9%). In one additional case, cytogenetic analyses was obtained only at the time of relapse (case 4) and in two cases (cases 14 and 15), initial diagnosis and treatment were performed in a distinct institution (H Mondor Hospital, Créteil, France). A group of 88 t(14;18)+/3q27− FL cases were available as a control group.

Table 1 Cytogenetic and molecular features of 15 follicular lymphomas with 3q27 rearrangement and absence of t(14;18) translocation
Full size table

Follow-up and clinical information taken at the time of initial diagnosis, including a complete medical history and physical examination, CT scan of the chest, abdomen and pelvis, and a bone marrow trephine biopsy were available in all patients.

Cytogenetic analysis

Cytogenetic analyses were performed as previously reported.13 R-banded metaphases were karyotyped and chromosomal abnormalities were evaluated according to the International System for Human Cytogenetic nomenclature.27

Histology

Lymph node biopsies were fixed in 10% formalin and embedded in paraffin. Sections were stained with hematoxylin and eosin, silver impregnation, periodic acid-Schiff, and May–Grünwald-Giemsa. Lymphomas were classified and graded according to the WHO classification.28 Morphological features were retrospectively reviewed, particularly the architecture tumor proliferation, the cytological grading and the size of follicles. The latter was determined by the mean diameter obtained from the measurement of 10 to 25 follicles per case using a graded reticule at a low magnification (×40).

Immunohistochemistry

Immunohistochemistry was performed on deparaffinized tissue sections using an indirect immunoperoxidase automated method with Nexes (Ventana Medical systems, Tucson, AZ, USA) according to the manufacturer's instructions. Paraffin-embedded tissue sections were evaluated with a panel of antibodies including CD3, CD20, CD23, BCL-2, BCL-6 (Dako, Glostrup, Denmark), CD5, CD10 (Nova Castra Labs, Newcastle, UK), and CD43 (Bioscience Products, Emmenbrüke, Switzerland). A semi-quantitative evaluation of p53 (Dako, clone DO-7), Ki67 antigen (Dako), CD10 and BCL-6 expression was performed by assigning to each case a score according to the percentage of positive tumors cells: −, 0%, to 10%; +, 10 to 25%, ++, 25 to 50%; +++, 50 to 100%. In order to assess distinctive histopathological and immunophenotypical characteristics, we compared the 3q27+/t(14;18)− FLs with 20 3q27−/t(14,18)+ FLs from the control group.

PCR amplification of t(14;18) translocation

DNA was extracted from tumor biopsies by standard methods including digestion with proteinase K followed by a ‘salting out’ procedure and ethanol precipitation. PCR detection of BCL-2-JH rearrangement was performed using specific primers for the major break point region (MBR) and minor breakpoint cluster region (mcr), in combination with a JH consensus primer, as previously described2,29 (all primers were supplied by GensetOligos, Genset, Paris, France).

Analysis of the BCL-6 first intron

Southern blotting:

DNA was digested using at least two of four restriction enzymes (BamHI, HindIII, EcoRI or XbaI). Rearrangement of BCL-6 gene was studied using the genomic probes F370, F372 or F381 overlapping the major translocation cluster (MTC) as previously described.13

Analysis of the 5′ end of the BCL-6 first intron and cloning procedure:

Genomic DNA from seven tumoral lymph nodes was obtained. In order to preferentially amplify the untranslocated allele, primers amplifying the 5′ region of the first intron were designed to span the most frequent 3q27 breakpoints.9,30 A PCR product of 2.1 kb was obtained using the following primers: gg1F,5′CTCTTACTCGCCTCTCTAACCCTACTATATATAT3′ and gg1R,5′GCAAAATCACTCACAAAGATCTCCCT3′. DNA (800 ng) was amplified in a 50 μl volume and the PCR conditions were as follows: 94°C for 3′ (one cycle), followed by 94°C for 45 s, 58°C for 30 s and 72°C for 2 min (35 cycles). Contamination was checked in control reactions with no added template. PCR products were analyzed by 1% agarose gel electrophoresis and stained with ethidium bromide. The PCR products were cloned into a pGEM-T cloning vector (Promega, Madison, WI, USA) and used to transform competent Escherichia coli DH5α cells.

DNA sequence analysis:

At least four clones from each patient were sequenced with appropriate internal primers using a commercially available kit based on the dideoxy chain termination method (Thermosequenase; Amersham Life Science, Buckinghamsire, UK). A region of 1100 bases was sequenced and aligned with the germline sequence derived from monocyte DNA using the BLAST 2.0 software.

Germline nucleotide sequence of the BCL-6 first intron region:

Circulating monocytes from three healthy donors were isolated by Ficoll–Isopaque density centrifugation using anti-CD13 coated microbeads and a magnetic cell separation system (MidiMacs system; Miltenyi Biotec, Auburn, CA, USA). An identical sequence was obtained from eight clones and was considered as the reference sequence. This sequence of 1100 nucleotides included the total sequence of the major mutation cluster sequence previously described (Genbank accession number AF 191831)31 and approximately an additional 300 bases.

Taq polymerase error rate:

The Taq polymerase rate error was estimated from monocyte BCL-6 DNA template under identical conditions to analysis of tumoral cells: six mutations were detected in six clones obtained from cloned monocyte DNA, giving an error rate of 1 in 1101 bases (0.1%).

Statistical analysis:

Overall survival was calculated using the method of Kaplan and Meier and compared by a log-rank test. Distinct clinical and pathological features in the 3q27+ group and in the control t(14;18) group were compared using the Fisher's exact test. The mean diameters of follicle between the 3q27+ group and the control group were compared using the Mann and Whitney test. The observed distribution of mutations of the first BCL-6 intron was compared to the theoretic distribution on the basis of the composition of the sequence using the χ2 test.

Results

Clinical features of t(14;18)−/3q27+ FL cases

Clinical features of the 15 patients in this category are summarized in Table 2. The median age was 56 years. There was no difference with the group of 88 t(14;18)+/3q27− FLs with regard to age, sex, performance status, bone marrow involvement and albumin or LDH level (Table 3). However, a stage III/IV disease (P = 0.06) or a bulky mass (P = 0.06) were less frequently observed in the 3q27+ FL group. In these 15 patients, four patients developed a high grade lymphoma. Seven are currently alive and three are still in complete remission. A survival curve was established for 14 t(14;18)−/3q27+ patients and compared with 88 t(14;18)+ patients (Figure 1). The median survival was 42 months and 69 months respectively (P = 0.43). Event-free survival was similar in the two groups.

Table 2 Clinical characteristics of 15 follicular lymphomas with 3q27 rearrangement and absence of t(14;18) translocation
Full size table
Table 3 Comparison of the main clinical and pathological features of follicular lymphomas associated either with 3q27 rearrangement or t(14;18) translocation
Full size table
Figure 1
figure 1

Overall survival curves of patients with follicular lymphomas and 3q27 rearrangement (n = 14) or follicular lymphoma and t(14;18) translocation (n = 88).

Full size image

Cytogenetic findings and Southern blot analysis

In 13/15 cases, translocations involved both 3q27 and the 14q32 regions. In 11/12 patients, the BCL-6 rearrangement was detected by Southern blotting. Other abnormalities associated with BCL-6 rearrangement at the cytogenetic level included structural abnormalities of chromosome 1 (n = 7), trisomy 3 (n = 4), break at 6q23-26 (n = 4) or at the short arm of chromosome 17 (n = 2) (Table 1).

Histological features

All cases presented a prominent follicular growth pattern. In eight cases, follicles were particularly large (Figure 2a), and areas of diffuse infiltration were present in six cases (Table 4). A well-formed mantle zone surrounding most follicles was present in four cases and was reduced or nearly absent in the 11 remaining cases.

Figure 2
figure 2

Histology and immunochemistery of 15 follicular lymphomas with a chromosome 3q27 rearrangement and without t(14;18) translocation. (a) In eight cases, the nodal architecture was characterized by large follicles (case 9). (b) A monocytoid cell component admixed with centrocytic-like cells was observed in five cases (case 14). (c) In three cases, a high rate of apoptotic activity was observed in BCL-2− follicles (case 2). (d) In 11 cases, follicle cells were BCL-2−(case 5). (e) BCL-2 expression was absent in the center of tumoral follicle, contrasting with the positive inter-follicular area and the periphery of follicle in two cases (case 12). (f) In 12/14 cases, centroblastic and centrocytic-like cells showed a nuclear BCL-6+ immunostaining (case 7).

Full size image
Table 4 Pathological and molecular features of 15 follicular lymphomas with chromosome 3q27 rearrangement
Full size table

In all cases, neoplastic follicles were composed of a variable proportion of centrocytes and centroblasts. The 15 FLs were classified as grade I (n = 10; 67%), grade II (n = 3; 20%) and grade III (n = 2; 13%) according to the WHO scheme (Table 4). In case 12, an area of DLBCL was also observed.

In five cases (cases 1, 6, 8, 9 and 14) however, cytological features of tumor follicle cells were unusual (Figure 2b), with follicles showing a prominent population of medium-sized cells with a central non-cleaved nucleus and moderate amounts of pale cytoplasm, consistent with a monocytoid differentiation. These cells frequently had a single central nucleolus and disclosed an intermediate mitotic index (11 to 25 mitosis per 10 hpf). A variable content of centrocytic and centroblastic-like cells were admixed with this population. Numerous tangible body macrophages were detected within follicles in four patients and a high apoptotic activity with a ‘starry sky’ appearance was observed in cases 2, 3 and 14 (Figure 2c).

Phenotypic features

In all cases, tumor cells had a CD20+, CD5−, CD43− phenotype. They were admixed with a variable proportion of CD3+/CD5+ reactive T cells. In 13 cases, immunostaining for CD23 showed a tight meshwork of follicular dendritic cells. Negative immunoreactivity for CD10 antigen was observed in 10/14 cases (71%), although granulocytes were positive (Table 4). Immunostaining for BCL-2 was carried out in 14 patients; virtually all tumor cells were BCL-2− in 11 cases (78%), whereas three cases revealed BCL-2 expression (Figure 1d). In two of these three BCL-2-postive cases, BCL-2 staining was heterogeneous, being mainly confined to the periphery of large follicles and mainly negative in the center of the follicle (Figure 2e). In the third positive case, the expression showed a diffuse pattern.

Despite variation in intensity, BCL-6 protein expression by tumor cells was scored as positive in 12 cases (86%) (Figure 2f). In case 12 with features of transformation into DLBCL, a composite pattern of expression was present, comprising BCL-6+ positive follicles and BCL-6 negativity in the DLBCL area.

p53 protein expression was scored as negative (<10%) in 10 cases (67%), and positive in four cases (cases 3, 8, 11, 12), which were also associated with a high degree of Ki67 expression.

Comparative pathological features of 3q27+ FL vs t(14;18)+ FL

The main histopathological features of FL associated either with BCL-6 or BCL-2 rearrangements are presented in Table 3. Follicles were significantly larger in the 3q27+FL group than in the t(14,18) group (P = 0.006), whereas there were no significant differences between the two groups regarding the presence of diffuse areas or well-formed mantle zones, the presence of tangible body macrophages and the number of large non cleaved cells. 3q27+FL were more frequently BCL-2− (P < 0.0001) and CD10− (P < 0.001). They also showed a trend toward a higher rate of p53 expression (P = 0.16). No significant difference was found with respect to BCL-6, CD23 or Ki67 immunostaining.

Analysis of somatic mutations of the BCL-6 first intron

Single mutational changes (observed only in one BCL-6 clone) from the germ line BCL-6 sequence were present in the analyzed DNA of all cases, but were indistinguishable from Taq error or polyclonal mutations of reactive cells, and were therefore disregarded. In five cases, however, a total of 12 clonal and non-polymorphic mutations were observed, with a mutation frequency ranging from 9.0 × 10−4 to 5.4 × 10−2 bp−1 (Table 4).

In four cases, the observed transition/transversion ratio was higher (2.3) than expected and the T→C substitution was the most frequently observed mutation. Among the five mutated cases, four showed evidence of intraclonal heterogeneity consistent with an ongoing mutation process (Figure 3). In case 3, a deletion of a 174 bp region was observed. In the other cases, the incidence of single substitutions was higher than the Taq error rate suggesting that some of these mutations may be real. Case 12 showed a more complex pattern, including a high mutation rate, together with small insertions and deletions. The observed transition/transversion ratio was high (1.6) and mutations were more frequently located in RGYW/WRCY motifs (R = purine, Y = pyrimidine, W = A or T) than expected (P < 0.05).

Figure 3
figure 3

Intraclonal heterogenity and polymorphic variation of the BCL-6 first intron in four cases of follicular lymphomas with 3q27 rearrangement. In order to facilitate comparison of observed mutations with previously published data, the BCL-6 region is numbered as described by Lossos and Levy.31 Due to differences in primer design we used a negative numbering to describe the first 200 bp. Horizontal lines represent sequenced clones derived from lymphoma samples. Mutations are indicated as circles (grey circle = observed >1 in BCL-6 clones; white circle = observed in only one BCL-6 clone; black circle = deletion T520, polymorphic variation) and mutational deletions as square brackets. In case 12, partial mutations are shown. Case 3, T18C; T95A; T542C; C548T; A782T; deletion [835–1009]; Case 7, T902C; Case 8, T118C; G448A; deletion T520; A601C; Case 12, C(-20)T; T(-7)C; CT29C; A58C; C68G; T75C; G82A; A86C; T87G; A90C; A121G; T131A; G132A; T133C; A135T; C145T; A149G; A151G; A174C; A176T; G184A; T189G; A191C; T194A; A208G; G234T; A283G; G299A; G300T; deletion [391–393]; deletion [401–410]; C411A; C415T; C419T; G422T; C423T; C435G; T436C; G437A; T460A; T492C; A505C; deletion T520; duplication [505–536]; G539A; G597A; G598A; A600G; A601C; T625C; G647A; C662A; A702G; T737A; T740C; G780C; C792T; C819G; T823C; C829T; G850A.

Full size image

Discussion

In the present study, we show that a subtype of FL associated with a BCL-6 rearrangement, but lacking t(14;18), has distinct pathological features in comparison to classical FL. A peculiar histological feature of these lymphomas is a prominent nodal architecture, frequently constituted by significantly larger follicles than in t(14;18)+ FL. It is known from studies in knock-out mice that BCL-6 protein expression is required for germinal center formation.11 The mechanism by which BCL-6 regulates GC development and influence its morphology is as yet not established. It is unclear whether prolonged BCL-6 expression, potentially induced by translocation, could lead to an exuberant follicle growth pattern. The capacity of BCL-6 to block terminal B-cell differentiation, most likely by inhibition of the Blimp-1 gene,32 and the description of peripheral T-cell lymphoma cases expressing BCL-6 protein with a follicular growth pattern,33 may implicate a function for BCL-6 in follicular architecture.

The second remarkable feature is the BCL-2 negative phenotype observed in the majority of cases. BCL-2 protein is expressed in most FL, including cases lacking the t(14;18) translocation.7 However, BCL-2 expression by itself is not sufficient to induce FL, and it is established that additional genetic abnormalities are required.5 Our study also suggests that the t(14;18) translocation is not strictly required in the pathogenesis of at least a subset of FL. This raises the question whether an anti-apoptotic function of BCL-6 could act as a surrogate for BCL-2 defects in this group of FL. BCL-6 is known to inhibit myocyte apoptosis34 and to repress expression of the cycline-dependent-kinase inhibitor p27/kip1,32 which controls G1/S transition. However, in contrast, studies in different cell models, including osteosarcoma cells, macrophages or myocytes have shown that BCL-6 can act as a pro-apoptotic protein.35,36,37 These observations show that many aspects of BCL-6 activity are as yet incompletely understood, and that BCL-6 function may depend on the cellular subtype in which the gene is expressed.

The third remarkable feature observed in our series was the unusual CD10− phenotype. Although CD10 expression is observed in lymphomas which are thought to arise from the GC cells, including FL and some DLBCL or Burkitt's disease,8 a CD10− BCL-6+ phenotype has also been reported in some FLs, particularly with splenic involvement38 and in L&H cells.39 This phenotype suggests that expression of both GC markers can be dissociated, but it is unknown whether it corresponds to a normal stage of GC B cell development or to a tumor specific antigen loss.

Finally, it appears that FLs associated with 3q27 rearrangement, but lacking the t(14;18) translocation, share a common and unusual CD10− BCL-2− BCL-6+ phenotype and frequently disclose a monocytoid component. Interestingly, Horsman and colleagues20 observed a monocytoid differentiation in 2/7 3q27+/t(14;18)− FL cases, as well as a CD10− immunophenotype in 7/7 cases. Nevertheless, it remains to be determined if the 3q27+ FL cases represent a homogeneous subtype of lymphoma. In our series, three cases with small follicles composed of CD10+, BCL-6+ and BCL-2+ cells were indistinguishable from ‘true’ FLs with t(14;18) translocation. Concerning the other cases, nodal marginal zone lymphoma (MZL) in which BCL-6 rearrangements may also occur40,41 certainly represents the most difficult differential diagnosis. Indeed, the presence of a monocytoid component in five cases, a CD5−/CD10− phenotype and a trisomy 3 in four cases are consistent with this diagnosis.8 However, BCL-6 protein expression, useful to discriminate subtypes of lymphomas with a follicular growth pattern and consistently negative in MZL,38 was found in 12/14 cases. Furthermore, foci of monocytoid B cells, which are clonally identical to follicular cells,42 are observed in about 10% of FL43 and such cases are regarded as FLs with marginal zone differentiation.42

Mutations of the first BCL-6 intron are acquired during B cell transit through the GC23,24 and their presence provides additional information concerning the tumor cell of origin.21,22,44 Five of seven cases had mutations in BCL-6, similar to those previously described, consisting of single substitutions, excess of transitions and hot spots in RGYW motifs, consistent with features of the somatic hypermutation machinery.21,25,26 In four cases, an ongoing mutation process was observed, suggesting that these lymphomas appear and remain in the germinal center environment.45 PCR primers, used in our study, widely flanked a 120 bp region, described by Akasaka and colleagues,30 in which the majority of breakpoints cluster, especially when IgH genes are involved. Therefore, it is likely that we preferentially amplified the untranslocated allele, excluding effects of translocated IgH regulatory regions, as described in c-MYC or BCL-2 genes when they are juxtaposed to IgH loci.46,47

There is evidence to indicate that the t(14;18) translocation arises at the pre-B stage of development, during activation of the enzymatic mechanisms governing the V(D)J recombination process.48 However, IgH/BCL-6 translocations, invariably involving switch regions of IgH,30 are most likely to occur during isotype class switch process, also occurring in the GC. Thus, the t(3;14) translocation observed in 13/15 of our cases, which can be regarded as the primary event, most likely occurs at a later stage of B-cell differentiation than in t(14;18)+ FL. At this stage, BCL-6 mutations and isotype switch mechanisms are both activated. It is of note that in recent reports, FL cells have been shown to engage the switch process, suggesting that in rare FL cases, the primary genetic event could occur at a later stage of maturation.49,50

Although the t(3;14)(q27;q32) translocation is mainly associated with de novo DLBCL,14,17 our findings clearly indicate that at least some of them could have an initial follicular growth development. Indeed, four patients developed a DLBCL during the course of the disease and one initially presented with features of both FL and DLBCL. However 3q27+ FL has an overall survival curve similar to t(14;18)+ FL cases and does not mimic that of aggressive lymphomas. The clinical signification of the lack of t(14;18) translocation in FL is a controversial issue.51,52,53 Shen and colleagues53 showed that t(14;18)− FL had distinct clinical characteristics including a higher rate of localized stage (I, II), a lower incidence of bone marrow involvement, a higher incidence of extra-nodal involvement and a higher incidence of trisomy 3 (25%). All of these trends are present in our series but have also been described in DLBCL with 3q27 rearrangement.18 Nevertheless, survival was similar to indolent t(14;18)+ FL cases in our study, and this result contradicts that obtained by Lopez-Guillermo and colleagues,52 showing that ‘germline’ FLs had a worse prognosis, similar to DLBCL. However, in the latter series, FLs were not characterized by cytogenetics, a method known to be more reliable than the molecular approach which gives false negative results, specially due to alternative breakpoints.54,55 The prognostic value of BCL-6 translocation in DLBCL and in FL is also a controversial issue13,18,56,57 and most likely appears less crucial than BCL-6 mRNA expression, which is strongly associated with a better prognosis in DLBCL.58,59 Whether BCL-6 mRNA level of expression in 3q27+ FL is higher than in standard FL cases and could have a prognostic significance or could explain the distinctive pathological features reported in this study remains to be determined.

References

  1. Yunis JJ, Oken MM, Kaplan ME, Ensrud KM, Howe RR, Theologides A . Distinctive chromosomal abnormalities in histologic subtypes of non- Hodgkin's lymphoma N Engl J Med 1982 307: 1231–1236

    CAS  Article  Google Scholar 

  2. Crescenzi M, Seto M, Herzig GP, Weiss PD, Griffith RC, Korsmeyer SJ . Thermostable DNA polymerase chain amplification of t(14;18) chromosome breakpoints and detection of minimal residual disease Proc Natl Acad Sci USA 1988 85: 4869–4873

    CAS  Article  Google Scholar 

  3. Tsujimoto Y, Finger LR, Yunis J, Nowell PC, Croce CM . Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation Science 1984 226: 1097–1099

    CAS  Article  Google Scholar 

  4. Gaulard P, d'Agay MF, Peuchmaur M, Brousse N, Gisselbrecht C, Solal-Celigny P, Diebold J, Mason DY . Expression of the bcl-2 gene product in follicular lymphoma Am J Pathol 1992 140: 1089–1095

    CAS  PubMed  PubMed Central  Google Scholar 

  5. Meijerink JP . t(14;18), a journey to eternity Leukemia 1997 11: 2175–2187

    CAS  Article  Google Scholar 

  6. Korsmeyer SJ . Bcl-2 initiates a new category of oncogenes: regulators of cell death Blood 1992 80: 879–886

    CAS  PubMed  Google Scholar 

  7. Falini B, Mason DY . Proteins encoded by genes involved in chromosomal alterations in lymphoma and leukemia: clinical value of their detection by immunocytochemistry Blood 2002 99: 409–426

    CAS  Article  Google Scholar 

  8. Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, De Wolf-Peeters C, Falini B, Gatter KC . A revised European–American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group Blood 1994 84: 1361–1392

    CAS  Google Scholar 

  9. Kerckaert JP, Deweindt C, Tilly H, Quief S, Lecocq G, Bastard C . LAZ3, a novel zinc-finger encoding gene, is disrupted by recurring chromosome 3q27 translocations in human lymphomas Nat Genet 1993 5: 66–70

    CAS  Article  Google Scholar 

  10. Allman D, Jain A, Dent A, Maile RR, Selvaggi T, Kehry MR, Staudt LM . BCL-6 expression during B-cell activation Blood 1996 87: 5257–5268

    CAS  PubMed  Google Scholar 

  11. Ye BH, Cattoretti G, Shen Q, Zhang J, Hawe N, de Waard R, Leung C, Nouri-Shirazi M, Orazi A, Chaganti RS, Rothman P, Stall AM, Pandolfi PP, Dalla-Favera R . The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation Nat Genet 1997 16: 161–170

    CAS  Article  Google Scholar 

  12. Flenghi L, Ye BH, Fizzotti M, Bigerna B, Cattoretti G, Venturi S, Pacini R, Pileri S, Lo Coco F, Pescarmona E . A specific monoclonal antibody (PG-B6) detects expression of the BCL-6 protein in germinal center B cells Am J Pathol 1995 147: 405–411

    CAS  PubMed  PubMed Central  Google Scholar 

  13. Bastard C, Deweindt C, Kerckaert JP, Lenormand B, Rossi A, Pezzella F, Fruchart C, Duval C, Monconduit M, Tilly H . LAZ3 rearrangements in non-Hodgkin's lymphoma: correlation with histology, immunophenotype, karyotype, and clinical outcome in 217 patients Blood 1994 83: 2423–2427

    CAS  PubMed  Google Scholar 

  14. Muramatsu M, Akasaka T, Kadowaki N, Ohno H, Fukuhara S, Okuma M . Rearrangement of the BCL6 gene in B-cell lymphoid neoplasms Leukemia 1997 11 (Suppl. 3): 318–320

    Google Scholar 

  15. Staudt LM, Dent AL, Shaffer AL, Yu X . Regulation of lymphocyte cell fate decisions and lymphomagenesis by BCL-6 Int Rev Immunol 1999 18: 381–403

    CAS  Article  Google Scholar 

  16. Skinnider BF, Horsman DE, Dupuis B, Gascoyne RD . Bcl-6 and Bcl-2 protein expression in diffuse large B-cell lymphoma and follicular lymphoma: correlation with 3q27 and 18q21 chromosomal abnormalities Hum Pathol 1999 30: 803–808

    CAS  Article  Google Scholar 

  17. Offit K, Louie DC, Parsa NZ, Roy P, Leung D, Lo Coco F, Zelenetz A, Dalla-Favera R, Chaganti RS . BCL6 gene rearrangement and other cytogenetic abnormalities in diffuse large cell lymphoma Leuk Lymphoma 1995 20: 85–89

    CAS  Article  Google Scholar 

  18. Offit K, Lo Coco F, Louie DC, Parsa NZ, Leung D, Portlock C, Ye BH, Lista F, Filippa DA, Rosenbaum A, Ladanyi M, Jhanwar S, Dalla-Favera R, Chaganti RS . Rearrangement of the bcl-6 gene as a prognostic marker in diffuse large-cell lymphoma N Engl J Med 1994 331: 74–80

    CAS  Article  Google Scholar 

  19. Ohshima A, Miura I, Hashimoto K, Takahashi N, Utsumi S, Nimura T, Saito M, Miki T, Hirosawa S, Miura AB . Rearrangements of the BCL6 gene and chromosome aberrations affecting 3q27 in 54 patients with non-Hodgkin's lymphoma Leuk Lymphoma 1997 27: 329–334

    CAS  Article  Google Scholar 

  20. Horsman DE, McNeil BK, Anderson M, Shenkier T, Gascoyne RD . Frequent association of t(3;14) or variant with other lymphoma-specific translocations Br J Haematol 1995 89: 569–575

    CAS  Article  Google Scholar 

  21. Capello D, Vitolo U, Pasqualucci L, Quattrone S, Migliaretti G, Fassone L, Ariatti C, Vivenza D, Gloghini A, Pastore C, Lanza C, Nomdedeu J, Botto B, Freilone R, Buonaiuto D, Zagonel V, Gallo E, Palestro G, Saglio G, Dalla-Favera R, Carbone A, Gaidano G . Distribution and pattern of BCL-6 mutations throughout the spectrum of B-cell neoplasia Blood 2000 95: 651–659

    CAS  PubMed  Google Scholar 

  22. Capello D, Fais F, Vivenza D, Migliaretti G, Chiorazzi N, Gaidano G, Ferrarini M . Identification of three subgroups of B cell chronic lymphocytic leukemia based upon mutations of BCL-6 and IgV genes Leukemia 2000 14: 811–815

    CAS  Article  Google Scholar 

  23. Pasqualucci L, Migliazza A, Fracchiolla N, William C, Neri A, Baldini L, Chaganti RS, Klein U, Kuppers R, Rajewsky K, Dalla-Favera R . BCL-6 mutations in normal germinal center B cells: evidence of somatic hypermutation acting outside Ig loci Proc Natl Acad Sci USA 1998 95: 11816–11821

    CAS  Article  Google Scholar 

  24. Shen HM, Peters A, Baron B, Zhu X, Storb U . Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutation of Ig genes Science 1998 280: 1750–1752

    CAS  Article  Google Scholar 

  25. Peng HZ, Du MQ, Koulis A, Aiello A, Dogan A, Pan LX, Isaacson PG . Nonimmunoglobulin gene hypermutation in germinal center B cells Blood 1999 93: 2167–2172

    CAS  PubMed  Google Scholar 

  26. Migliazza A, Martinotti S, Chen W, Fusco C, Ye BH, Knowles DM, Offit K, Chaganti RS, Dalla-Favera R . Frequent somatic hypermutation of the 5’ noncoding region of the BCL6 gene in B-cell lymphoma Proc Natl Acad Sci USA 1995 92: 12520–12524

    CAS  Article  Google Scholar 

  27. Mitelman F (ed). ISCN (1995): An International System for Human Cytogenetic Nomenclature. S Karger: Basel, Switzerland 1995

    Google Scholar 

  28. Nathwani B, Harris N, Weisenburger D, Isaacson P, Piris MA, Berger F, Muller-Hermelink HK, Swerdlow J . Follicular lymphoma In: Jaffe E, Harris N, Stein H, Vardiman J (eds) World Health Organisation Classification of Tumours. Pathology and Genetics of Tumours of Haematopoietic and Lymphoid Tissues IARC Press: Lyons 2001 pp 162–167

    Google Scholar 

  29. Ngan BY, Nourse J, Cleary ML . Detection of chromosomal translocation t(14;18) within the minor cluster region of bcl-2 by polymerase chain reaction and direct genomic sequencing of the enzymatically amplified DNA in follicular lymphomas Blood 1989 73: 1759–1762

    CAS  PubMed  Google Scholar 

  30. Akasaka H, Akasaka T, Kurata M, Ueda C, Shimizu A, Uchiyama T, Ohno H . Molecular anatomy of BCL6 translocations revealed by long-distance polymerase chain reaction-based assays Cancer Res 2000 60: 2335–2341

    CAS  PubMed  Google Scholar 

  31. Lossos IS, Levy R . Mutation analysis of the 5′ noncoding regulatory region of the BCL-6 gene in non-Hodgkin lymphoma: evidence for recurrent mutations and intraclonal heterogeneity Blood 2000 95: 1400–1405

    CAS  PubMed  Google Scholar 

  32. Shaffer AL, Yu X, He Y, Boldrick J, Chan EP, Staudt LM . BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control Immunity 2000 13: 199–212

    CAS  Article  Google Scholar 

  33. de Leval L, Savilo E, Longtine J, Ferry JA, Harris NL . Peripheral T-cell lymphoma with follicular involvement and a CD4+/bcl-6+ phenotype Am J Surg Pathol 2001 25: 395–400

    CAS  Article  Google Scholar 

  34. Kumagai T, Miki T, Kikuchi M, Fukuda T, Miyasaka N, Kamiyama R, Hirosawa S . The proto-oncogene Bc16 inhibits apoptotic cell death in differentiation-induced mouse myogenic cells Oncogene 1999 18: 467–475

    CAS  Article  Google Scholar 

  35. Dhordain P, Albagli O, Honore N, Guidez F, Lantoine D, Schmid M, The HD, Zelent A, Koken MH . Colocalization and heteromerization between the two human oncogene POZ/zinc finger proteins, LAZ3 (BCL6) and PLZF Oncogne 2000 19: 6240–6250

    CAS  Article  Google Scholar 

  36. Yamochi T, Kaneita Y, Akiyama T, Mori S, Moriyama M . Adenovirus-mediated high expression of BCL-6 in CV-1 cells induces apoptotic cell death accompanied by down-regulation of BCL-2 and BCL-X(L) Oncogene 1999 18: 487–494

    CAS  Article  Google Scholar 

  37. Albagli O, Lantoine D, Quief S, Quignon F, Englert C, Kerckaert JP, Montarras D, Pinset C, Lindon C . Overexpressed BCL6 (LAZ3) oncoprotein triggers apoptosis, delays S phase progression and associates with replication foci Oncogene 1999 18: 5063–5075

    CAS  Article  Google Scholar 

  38. Dogan A, Bagdi E, Munson P, Isaacson PG . CD10 and BCL-6 expression in paraffin sections of normal lymphoid tissue and B-cell lymphomas Am J Surg Pathol 2000 24: 846–852

    CAS  Article  Google Scholar 

  39. Kraus MD, Haley J . Lymphocyte predominance Hodgkin's disease: the use of bcl-6 and CD57 in diagnosis and differential diagnosis Am J Surg Pathol 2000 24: 1068–1078

    CAS  Article  Google Scholar 

  40. Dierlamm J, Pittaluga S, Stul M, Wlodarska I, Michaux L, Thomas J, Verhoef G, Verhest A, Depardieu C, Cassiman JJ, Hagemeijer A, De Wolf-Peeters C, Van den Berghe H . BCL6 gene rearrangements also occur in marginal zone B-cell lymphoma Br J Haematol 1997 98: 719–725

    CAS  Article  Google Scholar 

  41. Dierlamm J, Wlodarska I, Michaux L, Stefanova M, Hinz K, Van Den Berghe H, Hagemeijer A, Hossfeld DK . Genetic abnormalities in marginal zone B-cell lymphoma Hematol Oncol 2000 18: 1–13

    CAS  Article  Google Scholar 

  42. Abou-Elella A, Shafer MT, Wan XY, Velanker M, Weisenburger DD, Nathwani BN, Gascoyne RD, Greiner TC, Chan WC . Lymphomas with follicular and monocytoid B-cell components. Evidence for a common clonal origin from follicle center cells Am J Clin Pathol 2000 114: 516–522

    CAS  Article  Google Scholar 

  43. Nathwani BN, Anderson JR, Armitage JO, Cavalli F, Diebold J, Drachenberg MR, Harris NL, MacLennan KA, Muller-Hermelink HK, Ullrich FA, Weisenburger DD . Clinical significance of follicular lymphoma with monocytoid B cells. Non-Hodgkin's Lymphoma Classification Project Hum Pathol 1999 30: 263–268

    CAS  Article  Google Scholar 

  44. Conconi A, Bertoni F, Pedrinis E, Motta T, Roggero E, Luminari S, Capella C, Bonato M, Cavalli F, Zucca E . Nodal marginal zone B-cell lymphomas may arise from different subsets of marginal zone B lymphocytes Blood 2001 98: 781–786

    CAS  Article  Google Scholar 

  45. Zan H, Li Z, Yamaji K, Dramitinos P, Cerutti A, Casali P . B cell receptor engagement and T cell contact induce Bcl-6 somatic hypermutation in human B cells: identity with Ig hypermutation J Immunol 2000 165: 830–839

    CAS  Article  Google Scholar 

  46. Tanaka S, Louie DC, Kant JA, Reed JC . Frequent incidence of somatic mutations in translocated BCL2 oncogenes of non-Hodgkin's lymphomas Blood 1992 79: 229–237

    CAS  PubMed  Google Scholar 

  47. Hoang AT, Lutterbach B, Lewis BC, Yano T, Chou TY, Barrett JF, Raffeld M, Hann SR, Dang CV . A link between increased transforming activity of lymphoma-derived MYC mutant alleles, their defective regulation by p107, and altered phosphorylation of the c-Myc transactivation domain Mol Cell Biol 1995 15: 4031–4042

    CAS  Article  Google Scholar 

  48. Stamatopoulos K, Kosmas C, Belessi C, Stavroyianni N, Kyriazopoulos P, Papadaki T . Molecular insights into the immunopathogenesis of follicular lymphoma Immunol Today 2000 21: 298–305

    CAS  Article  Google Scholar 

  49. Ottensmeier CH, Thompsett AR, Zhu D, Wilkins BS, Sweetenham JW, Stevenson FK . Analysis of VH genes in follicular and diffuse lymphoma shows ongoing somatic mutation and multiple isotype transcripts in early disease with changes during disease progression Blood 1998 91: 4292–4299

    CAS  PubMed  Google Scholar 

  50. Fenton JA, Vaandrager JW, Aarts WM, Bende RJ, Heering K, van Dijk M, Morgan G, van Noesel CJ, Schuuring E, Kluin PM . Follicular lymphoma with a novel t(14;18) breakpoint involving the immunoglobulin heavy chain switch mu region indicates an origin from germinal center B cells Blood 2002 99: 716–718

    CAS  Article  Google Scholar 

  51. Pezzella F, Jones M, Ralfkiaer E, Ersboll J, Gatter KC, Mason DY . Evaluation of bcl-2 protein expression and 14;18 translocation as prognostic markers in follicular lymphoma Br J Cancer 1992 65: 87–89

    CAS  Article  Google Scholar 

  52. Lopez-Guillermo A, Cabanillas F, McDonnell TI, McLaughlin P, Smith T, Pugh W, Hagemeister F, Rodriguez MA, Romaguera JE, Younes A, Sarris AH, Preti HA, Lee MS . Correlation of bcl-2 rearrangement with clinical characteristics and outcome in indolent follicular lymphoma Blood 1999 93: 3081–3087

    CAS  PubMed  Google Scholar 

  53. Shen LHG, Connors JM, Klasa JM, Horsman DE . Comparison of t(14;18) positive and t(14;18) negative follicular lymphomas: clinical characteristics, outcome and cytogenetics Blood 2000 96 (Suppl. 1): Abstr 574a

    Google Scholar 

  54. Horsman DE, Gascoyne RD, Coupland RW, Coldman AJ, Adomat SA . Comparison of cytogenetic analysis, southern analysis, and polymerase chain reaction for the detection of t(14;18) in follicular lymphoma Am J Clin Pathol 1995 103: 472–478

    CAS  Article  Google Scholar 

  55. Buchonnet G, Lenain P, Ruminy P, Lepretre S, Stamatoullas A, Parmentier F, Jardin F, Duval C, Tilly H, Bastard C . Characterisation of BCL2-JH rearrangements in follicular lymphoma: PCR detection of 3’ BCL2 breakpoints and evidence of a new cluster Leukemia 2000 14: 1563–1569

    CAS  Article  Google Scholar 

  56. Kramer MH, Hermans J, Wijburg E, Philippo K, Geelen E, van Krieken JH, de Jong D, Maartense E, Schuuring E, Kluin PM . Clinical relevance of BCL2, BCL6, and MYC rearrangements in diffuse large B-cell lymphoma Blood 1998 92: 3152–3162

    CAS  PubMed  Google Scholar 

  57. Jerkeman M, Aman P, Cavallin-Stahl E, Torlakovic E, Akerman M, Mitelman F, Fioretos T . Prognostic implications of BCL6 rearrangement in uniformly treated patients with diffuse large B-cell lymphoma – a Nordic Lymphoma Group study Int J Oncol 2002 20: 161–165

    CAS  PubMed  Google Scholar 

  58. Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosenwald A, Boldrick JC, Sabet H, Tran T, Yu X, Powell JI, Yang L, Marti GE, Moore T, Hudson J Jr, Lu L, Lewis DB, Tibshirani R, Sherlock G, Chan WC, Greiner TC, Weisenburger DD, Armitage JO, Warnke R, Levy R, Wilson W, Grevers M, Byrd J, Bolstein D, Brown P, Staudt LM . Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling Nature 2000 403: 503–511

    CAS  Article  Google Scholar 

  59. Lossos IS, Jones CD, Warnke R, Natkunam Y, Kaizer H, Zehnder JL, Tibshirani R, Levy R . Expression of a single gene, BCL-6, strongly predicts survival in patients with diffuse large B-cell lymphoma Blood 2001 98: 945–951

    CAS  Article  Google Scholar 

Download references

Acknowledgements

This work was supported by the Comité Départemental de Seine Maritime de la Ligue Nationale Contre le Cancer. The authors thank C Haioun for providing clinical data, C Lamarche for her technical help and S Sahota for his critical review of the manuscript.

Author information

Affiliations

  1. Department of Haematology and EMI 9906-IRFMP No. 23, Centre Henri Becquerel, Rouen, France

    F Jardin, G Buchonnet, N Contentin, S Leprêtre, P Lenain, A Stamatoullas & H Tilly

  2. Department of Pathology, Centre Henri Becquerel, Rouen, France

    JM Picquenot & C Duval

  3. Molecular Biology Laboratory and EMI 9906-IRFMP No. 23, Centre Henri Becquerel, Rouen, France

    F Parmentier & C Bastard

  4. Department of Pathology and EA 2348, Hôpital Henri Mondor, AP-HP, Créteil, France

    P Gaulard

Authors
  1. F Jardin
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. P Gaulard
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. G Buchonnet
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. N Contentin
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. S Leprêtre
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. P Lenain
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. A Stamatoullas
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. JM Picquenot
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. C Duval
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. F Parmentier
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. H Tilly
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. C Bastard
    View author publications

    You can also search for this author in PubMed Google Scholar

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Jardin, F., Gaulard, P., Buchonnet, G. et al. Follicular lymphoma without t(14;18) and with BCL-6 rearrangement: a lymphoma subtype with distinct pathological, molecular and clinical characteristics. Leukemia 16, 2309–2317 (2002). https://doi.org/10.1038/sj.leu.2402707

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/sj.leu.2402707

Keywords

  • BCL-6 gene
  • BCL-2 gene
  • Follicular lymphoma

Further reading

Search

Advanced search

Quick links