Immunophenotypes

Adult precursor B-ALL with BCR/ABL gene rearrangements displays a unique immunophenotype based on the pattern of CD10, CD34, CD13 and CD38 expression

Article metrics

Abstract

The Philadelphia chromosome (Ph+) reflects a balanced reciprocal translocation between the long arms of chromosomes 9 and 22 [t(9;22)(q34;q11.2] involving the BCRand ABL genes. At present, detection of BCR/ABL gene rearrangements is mandatory in precursor-B-ALL patients at diagnosis for prognostic stratification and treatment decision. In spite of the clinical impact, no screening method, displaying a high sensitive and specificity, is available for the identification of BCR/ABL +precursor-B-ALL cases. The aim of the present study was to explore the immunophenotypic characteristics of precursor B-ALL cases displaying BCR/ABL gene rearrangements using multiple stainings analyzed by quantitative flow cytometry in order to rapidly (<1 h) identify unique phenotypes associated with this translocation. From the 82 precursor-B-ALL cases included in the study 12 displayed BCR/ABL gene rearragements, all corresponding to adult patients, four of which also displayed DNA aneuploidy. Our results show that BCR/ABL + precursor B-ALL cases constantly displayed a homogeneous expression of CD10 and CD34 but low and relatively heterogeneous CD38 expression, together with an aberrant reactivity for CD13. In contrast, this unique phenotype was only detected in three out of 70 BCR/ABL cases. Therefore, the combined use of staining patterns for CD34, CD38 and CD13 expression within CD10-positive blast cells is highly suggestive of BCR/ABL gene rearrangements in adults with precursor B-ALL.

Introduction

The Philadelphia chromosome (Ph+) reflects a balanced reciprocal translocation between the long arms of chromosomes 9 and 22 [t(9;22)(q34; q11.2)] involving the BCR and ABL genes, respectively.1 2 Three breakpoint cluster regions in the BCR gene have been described so far: major(M)- minor(m)- and micro (μ)-BCR.3 4 5 6 These breakpoints result in BCR-ABL fusion proteins that differ in their size and transforming potential4 5 the p210, p190 and p230 proteins, respectively. While the M-BCR breakpoint is the genetic hallmark of chronic myeloid leukemia (CML),7 8 Ph+ precursor B-acute lymphoblastic leukemias are usually associated with the m-BCR and to a much lesser extent with M-BCR gene rearrangements.9

Among precursor-B-ALL cases, t(9;22) translocation occurs in around 20–30% of adults and in 5% of children.10 11 12 13 14 15 16 From the clinical point of view, Ph+ precursor-B-ALL is associated with a highly aggressive disease frequently resistant to chemotheraphy and with a short survival.14 17 18 19 20 21 Therefore, at present, detection of BCR/ABL gene rearrangements is mandatory in precursor-B-ALL patients at diagnosis for prognostic stratification and treatment decision making. Unfortunately, a rapid screening method, displaying a high sensitivity and specificity, for identification of BCR/ABL + precursor-B-ALL cases is not currently available. Although an association between BCR/ABL gene rearrangements and a common (BII) phenotype has long been reported22 it is well-established that reactivity for CD10 in the absence of cIgμ and sIg expression – a common, BII phenotype – is also present in around half of all BCR/ABL precursor-B-ALL cases.22 23 Therefore, molecular and/or cytogenetic studies directed to the identification of BCR/ABL gene rearrangements should be performed in all precursor-B-ALL cases, from which only a minor proportion would be positive.

The immunophenotypic characteristics of precursor B-ALL leukemic cells have long been believed to reflect normal hematopoietic B cell precursors. However, more recent studies have shown that through the simultaneous assessment of several antigens almost all precursor-B-ALL cases display phenotypic aberrations.23 24 25 26 27 Such phenotypic aberrations may be associated with specific genetic abnormalities, and it has been suggested that they could be used to better understand dysregulation of protein expression and at the same time they could help in identifying cases carrying specific genetic lesions such as t(12;21)28 29 30 and 11q23 abnormalities.31 32 33

The aim of the present study was to explore in detail the immunophenotypic characteristics of precursor B-ALL cases displaying BCR/ABL gene rearrangements in order to rapidly identify unique phenotypes associated with this translocation; patients showing such phenotypic profile should be considered as high priority cases for molecular confirmation of BCR/ABL translocation if the technique is available, or if not categorized as positive in a therapeutic decision-making process. Our results show that the combined use of the patterns of CD34, CD38 and CD13 expression among CD10-positive precursor-B ALL adult patients is highly suggestive of BCR/ABL gene rearrangements.

Materials and methods

Patients

A total of 82 consecutive patients whose bone marrow (BM) samples were referred to the laboratory of the University Hospital of Salamanca for immunophenotypic and molecular/ cytogenetic analysis were included in the present study. All patients had an unequivocal diagnosis of ‘de novo’ precursor B-ALL based on morphological, cytochemical and immunophenotypic criteria;34 of the patients analyzed, 54 were males and 28 were females. In children (n = 32) mean age was 4 ± 4 years (median 3 years) while in adults (n = 50) it was 41 ± 19 years (median 36 years). All cases were studied at diagnosis.

Immunophenotypic studies

In all cases immunophenotypic studies were performed at diagnosis on erythrocyte-lysed whole BM samples upon staining with monoclonal antibodies directly conjugated to fluorochromes. Antigen expression was analyzed on a FACSort flow cytometer (Becton Dickinson Biosciences, San Jose, CA, USA) using triple-stainings for the following combinations of fluorochrome-conjugated monoclonal antibodies (fluorescein isothiocyanate (FITC), phycoerythrin (PE) and either peridin clorophyll protein (PerCP) or the PE/cyanine 5 (Cy5) fluorochrome tandem) directed against cell surface antigens: CD4/CD8/CD3, CD7/CD5/CD3, CD19/CD34/CD45, CD10/ CD13/CD19, CD5/CD33/CD20, CD34/CD38/CD19, CD10/ CD20/CD19, CD7/CD2/CD3, CD34/CD22/CD19, Tdt/CD10/ CD19, CD7/CD34/CD38, and kappa/lambda/CD19. In addition, the expression of MPO, CD79a, IgM and CD3 was also explored at the cytoplasmic level.

Briefly, BM samples were obtained and immediately diluted in phosphate-buffered saline (PBS) containing K3 EDTA as anticoagulant at a proportion of 1/1 (v/v). Afterwards, for surface antigenic stainings, 200 μl of PBS-diluted BM samples, containing between 0.5 and 1 × 106 nucleated cells were placed in each tube and incubated with the appropriate combination of monoclonal antibodies for 15 min at room temperature in the dark. Once this incubation period was finished, 2 ml of FACS lysing solution (Becton Dickinson) diluted 1/10 (v/v) in distilled water were added to each tube and after vigorous vortexing another incubation for 10 min in the darkness (room temperature) was performed. Afterwards, cells were centrifuged (5 min at 540 g), washed once in 2 ml of PBS/tube (5 min at 540 g) and resuspended in 0.5 ml/tube of PBS.

For the staining of cytoplasmic antigens (MPO, CD79a and CD3) the Fix & Perm reagent from Caltag Laboratories (San Francisco, CA, USA) was used, strictly following the recommendations of the manufacturer.

The source and specificity of each monoclonal antibody reagent used in the present study was as follows: CD34 (HPCA-2-PE and My10-FITC), CD33 (leu M9-PE), CD38 (leu 17-PE), CD13 (leu M7-PE), CD7 (leu 9-FITC), CD10 (CALLA-FITC), CD5 (leu 1-FITC and leu 1-PE), CD3 (leu 4-PerCP), CD4 (leu 3-FITC), CD8 (leu 2-PE), CD19 (leu 12-FITC), CD20 (leu 16-PE), CD22 (leu 14-PE), anti-kappa-FITC and anti-lambda-PE were purchased from Becton Dickinson, CD19 (SJ25C1-PE/Cy5), MPO (H435-FITC), CD38 (HB7-PE-Cy5), polyclonal anti-IgM (PE), CD20 (HI47-PE-Cy5), and CD45 (HI30-PE/Cy5) were obtained from Caltag Laboratories, CD79a (HM57-PE) and anti-Tdt (HT-6-PE) from Dako (Glostrup, Denmark) and CD2 (SFCI3Pt2H9-T11-PE) and CD10 (J5-PE) from Beckman Coulter (Miami, FL, USA).

Isotype-matched mouse non-specific immunoglobulins and a tube stained for the CD4-FITC, CD8-PE and CD3-PerCP antigens were used as negative and positive controls, respectively.

Data acquisition was performed using the CellQuest software program (Becton Dickinson) and information on a minimum of 15 000 events/tube from the total BM cellularity was acquired. In order to make results comparable between different days, careful instrument calibration and fluorescence compensation was performed using both CALIBRITE beads (Becton Dickinson) and normal peripheral blood (PB) lymphocytes stained for CD4-FITC, CD8-PE and CD3-PE/Cy5 or PerCP as previously described.35 For data analysis the PAINT-A-GATE PRO software (Becton Dickinson) was used. Whenever necessary, further stainings were made in a second step in order to be able to specifically gate on leukemic cells. The following information was explored on the leukemic cells for each of the antigens analyzed: (1) presence or absence of antigen expression; (2) fluorescence intensity, as reflected by the mean fluorescence intensity (MFI) expressed in relative linear fluorescence chanels scaled from 0 to 10 000 (arbitrary units); and (3) the pattern of antigen expression (homogeneous vs heterogeneous) as reflected by the coefficient of variation (CV) of the fluorescence intensity obtained for each fluorochrome-conjugated monoclonal antibody reagent. From the 82 cases included in this study 18 displayed a pro-B/BI phenotype, 60 corresponded to common BII and four were pre-B/BIII ALL.34

Flow cytometric DNA ploidy studies

The analysis of blast cell DNA contents was performed on erythrocyte-lysed whole BM samples after specifically staining for both the blast cells and cell DNA. For that purpose the Cycloscope LLA reagent kit (IMICO, Madrid, Spain) was used strictly following the recommendations of the manufacturer. Measurements of DNA cell contents were performed on a FACSCalibur flow cytometer, as previously described.36

A case was considered to display DNA aneuploidy when G0/G1-phase blast cells showed a different propidium iodide-associated fluorescence intensity as compared to that of normal residual G0/G1 BM cells. DNA index was calculated as the ratio between the modal fluorescence intensity of G0/G1 blast cells and that of the normal G0/G1 residual BM cells.

PCR amplification of BCR/ABL transcripts

RNA was extracted from washed BM mononuclear cells by the guanidium thiocyanate method.37 In vitro reverse transcription (RT) of total RNA to cDNA and RT-PCR amplification of M/m-BCR/ABL fusion transcripts were performed according to Biomed 1 guidelines.38 RT was performed on 1 μg of RNA, after heating at 70°C for 10 min, with random hexamers as reaction primer. The reaction was carried out at 42°C for 45 min in a 20 μl volume containing 200 U of Superscript II (Life Technologies, Paisley, UK). Subsequently, 2 μl of the RT product were used for two-step PCR analysis.38 In all cases both M-BCR and m-BCR breakpoints were explored. The first round PCR was performed with the BCR-e1-A (m-BCR) (5′GACTGCAGCTCCAATGAGAAC3′) or BCR-b1-A (M-BCR) (5′GAAGTGTTTCAGAAGCTTCTCC3′) as 5′ primers and the ABL-a3-B (5′GTTTGGGCTTCACACCATTCC3′) as 3′ primer. For the second-round PCR, the system used was the same as the first round except that 1 μl of the first PCR product was used instead of RT product and the primers in this case were BCR e1c (m-BCR) (5′CAGAACTCGCAACAGTCCTTC3′) or BCR-b2-c (M-BCR) (5′CAGATGCTGACCAACTCGTGT3′) as 5′ primers and ABL-a3-D (5′TTCCCCATTGTGATT ATAGCCTA3′) as 3′ primer. Two negative controls (one with RNA from the HL60 cell line and one without RNA) and several positive controls (one with RNA from K562, KCl 22-M-BCR and Tom-1 m-BCR cell lines were included in each experiment). The integrity of the RNA preparation was assessed by amplification of normal ABL RNA. A control PCR (shifted PCR) for confirmation or exclusion of false positive results was used according to the Biomed 1 guidelines.38

Fluorescence in situ hybridization (FISH) studies

FISH analysis for the t(9;22) was performed using the LSI-BCR/ABL dual-color probe (Vysis, Downers Grove, IL, USA), which allows the distinction between M-BCR/ABL and m-BCR/ABL gene rearrangements. The ABL probe was conjugated with Spectrum Orange and the BCR probe was labeled with Spectrum Green.

FISH analysis was performed on cells from BM samples prepared according to conventional cytogenetic techniques. Slides containing fixed cells were immersed in pepsin (0.1 mg/ml)(Sigma, St Louis, MO, USA) followed by fixation with 1% formaldehyde and dehydrated with ethanol according to previously reported techniques.39 40 The probes were placed on the slides and were denatured in a Hybrite (Vysis) thermocycler at 75°C for 1 min. Hybridization was then allowed to take place by incubating the slide overnight (16 h) in the thermocycler at 37°C. Once this incubation period was finished, slides were washed three times (3 × 10 min) in 50% formamide in 2 × SSC (pH 7.0) at 46°C, followed by another wash for 10 min in 2 × SSC (pH 7.0); finally, the slides were washed for 5 min in 2 × SSC containing Tween 20 (Sigma). Afterwards, slides were counterstained with 0.1 mg/ml of DAPI (Sigma), and Vectashield (Vector Laboratories, Burlingame, CA, USA) was used as antifading agent.

Fluorescence signals were evaluated using a fluorescence microscope (Olympus BX60, Hamburg, Germany) equipped with a 100× oil objective and a minimun of 200 cells/sample were analyzed including both interphase nuclei and metaphase chromosomes. For all slides measured the number of unhybridized cells in the areas assessed was <1% and only those spots with similar size, intensity and shape were counted. In normal cells, the probe signals appear as two distinct signals of each color (two green and two red). Cells with yellow spots (fusion of green and red signals) were interpreted as carrying BCR/ABL gene rearrangements. The distinction between M-BCR and m-BCR gene rearrangements was based on the number of fusions per cell: one or two, respectively. Based on interphase FISH studies performed in normal BM samples a case was considered to be M-BCR + and m-BCR + when more than 3% and 0.1% of the nuclei showed fused or juxtaposed BCR and ABL signals, respectively.

Statistical methods

For all phenotypic variables included in the present study their mean, median, standard deviation, 95% confidence interval and range were reported. Comparison between groups were performed using the Mann–Whitney U and chi-square tests for continuous and dichotomic variables, respectively; cut-off values for immunophenotypic markers were selected using receiver operating curves (ROC) as those values providing a 100% sensitivity with the greatest specificity. P values lower than 0.05 were considered to be associated with statistically significant differences (SPSS 8.0; SPSS, Chicago, IL, USA).

For the assessment of the power of the immunophenotypic criteria for discrimination between BCR/ABL + and BCR/ABL cases, a multivariate analysis for categorized immunophenotypic variables was performed using a logistic regression model with the forward stepwise option and a probability comparison test (SPSS 8.0, SPSS). The immunophenotypic variables included in the multivariate analysis were those displaying statistically significant differences in the univariate study. The sensitivity, the specificity as well as the efficacy of the immunophenotypic criteria to identify cells carrying the BCR/ABL + gene rearrangements were calculated as follows: (1) sensitivity: number of true positive (TP) cases divided by the sum of TP plus false negative (FN) cases; (2) specificity: number of true negative (TN) cases divided by the number of TN plus the false positive (FP) cases and; (3) efficacy: TP plus TN divided by the TP+TN+FP+FN cases.

Results

From the 82 precursor-B-ALL patients included in the present study, 12 cases displayed the BCR/ABL translocation, both by RT-PCR and FISH techniques, all corresponding to adult patients. From the remaining 70 cases, all except one, were negative for the BCR/ABL gene rearrangements by both methods; one case displaying a pro-B/BI phenotype – CD10, CD34+heterogeneous, CD38hi, CD13−/+dim, CD19+, cCD79a+, CD22+, nTdt+, CD33 – was repeatedly positive by PCR although it showed neither the Ph+ chromosome on conventional cytogenetics nor BCR/ABL gene rearrangements on interphase and metaphase FISH. PCR results for this patient could not be confirmed in another sample. From the 12 BCR/ABL + cases, 10 showed typical m-BCR gene rearrangements while the other two displayed a M-BCR gene rearrangement either as a sole abnormality in one case or coexisting with a m-BCR/ABL gene rearrangement in the other patient. From the phenotypic point of view, all BCR/ABL + cases showed a CD10 common ALL (BII) phenotype, which was also present in 48/70 (69%) of the BCR/ABL cases. DNA aneuploidy was observed in 4/12 (33%) and 22/70 (31%) BCR/ABL + and BCR/ABL patients, respectively. From the four BCR/ABL + cases displaying DNA aneuploidy two displayed a DNA index higher than 1.16.

Upon grouping the 82 patients analyzed according to the presence or absence of BCR/ABL gene rearrangements it was observed that BCR/ABL + cases had several membrane phenotypic features in common which were significantly different from those of BCR/ABL cases. Tables 1 and 2 show the patterns of antigen expression detected on blast cells as reflected by the mean fluorescence intensity (MFI) and its degree of variability (coefficient of variation (CV) – homogeneous vs heterogeneous expression. As may be seen in these tables BCR/ABL + precursor-B-ALL patients constantly corresponded to common-ALL cases displaying an homogeneous (hm) expression for both CD10-FITC and CD34-PE; in addition, all these cases showed a dim and heterogenous CD13-PE expression together with an aberrantly low and heterogenous expression of CD38 (Tables 1, 2 and Figure 1). In contrast, among the BCR/ABL cases the frequency at which these phenotypic features were observed was significantly lower (P < 0.02) (Table 2). No significant differences were observed for any of the other markers analyzed as shown in Table 1. Such phenotypic differences were also noted once we restricted the comparison to the CD10+ precursor-B-ALL cases displaying a common/BII immunophenotype (Tables 1 and 2).

Table 1  Precursor-B-ALL: immunophenotypic features of blast cells in BCR/ABL + cases as compared to the BCR/ABL patients
Table 2  Comparative analysis of the immunophenotypic differences between BCR/ABL and BCR/ABL + precursor-B-ALL cases
Figure 1
figure1

 Representative dot plots of CD10, CD34, CD38, CD13, CD19, CD45 expression in normal bone marrow (BM) (panels a to d), as well as in two BCR/ABL + (panels e to l) and in two BCR/ABL cases (panels m to t). Panels e to h and m to p correspond to DNA diploid cases while panels i to l and q to t correspond to DNA aneuploid patients. In all panels only BM B cells are displayed. In the dot plots corresponding to normal BM (panels a to d) CD19+/CD34+ B cell precursors are painted in red; in dot plots e to t red dots correspond to B cell ALL leukemic blasts.

Multivariate analysis showed that once these four markers were combined, the patterns of CD34 and CD38 expression had an independent value to discriminate between BCR/ABL + and BCR/ABL precursor B-ALL cases even if only BII cases were considered in the analysis; all cases in the former group were also CD10+hm and CD13+int (Table 2). Furthermore, once a score system based on these immunophenotypic markers was applied to the precursor-B-ALL cases included in this study, all BCR/ABL + patients (100%) had a score of 4 while only 6% of the remaining BCR/ABL cases – two children and one adult – simultaneously displayed the four markers defined here (Table 3); moreover, most of the BCR/ABL cases (74%) showed an immunophenotypic score <3. Therefore, the simultaneous assessment of antigen expression for these four markers displayed both a high sensitivity (100%) and specificity (94%) for predicting BCR/ABL gene rearrangements in precursor-B-ALL cases (Table 4).

Table 3  Immunophenotypic score of BCR/ABL + and BCR/ABL precursor-B-ALL cases according to CD10 FITC+hm, CD34 PE++hm, CD38 PE−/+int and CD13 PE+int expression
Table 4  Clinical value (sensitivity, specificity) of the CD34++hm/ CD38−/+int CD10+ hm/CD13+ int phenotype for identification of BCR/ ABL + ALL cases

Since it is well-established that adult BCR/ABL + cases still display a genetically heterogeneous background, an additional aim of our study was to explore whether the variability in the expression of other antigens among this subgroup of precursor-B-ALL patients was related to the coexistence of additional genetic abnormalities. Accordingly, upon dividing the BCR/ABL + cases into two groups according to the presence or absence of DNA aneuploidy by flow cytometry, it was observed that DNA aneuploid BCR/ABL + cases (n = 4) displayed a higher expression (MFI values) of the CD10, CD19, CD38 and CD45 antigens as compared to the DNA diploid BCR/ABL + patients (n = 8); in addition, CD10 and CD38 showed a more homogeneous pattern of expression among DNA aneuploid BCR/ABL + cases (P = 0.01) (Figures 1 and 2). Interestingly, among BCR/ABL+ cases the intensity of CD19 expression (MFI >100) alone was able to clearly discriminate between the DNA diploid and the DNA aneuploid cases.

Figure 2
figure2

 Immunophenotypic differences between DNA diploid (n = 8) and DNA aneuploid (n = 4) BCR/ABL + precursor-B-ALL cases: median, standard deviation and 95% confidence interval of the distribution of the mean fluorescence intensity (MFI) of the most relevant immunophenotypic markers analyzed in the present study according to the DNA ploidy status. FITC, fluorescein isothiocyanate; PE, phycoerythrin; PE/Cy5, phycoerythrin/cyanine5.

Discussion

Precursor-B-acute lymphoblastic leukemia is believed to derive from the clonal expansion and accumulation of B cell precursors which have lost their ability to completely undergo differentation.41 Such dysregulation of cell proliferation and blockade of B-lineage maturation is probably due to the sequential accumulation of underlying genetic abnormalities, of which a large number have been identified to date.42 Among the specific chromosome translocations identified and causally linked to leukemogenesis, BCR/ABL gene rearrangements represent one of the best characterized.2 43 Previous reports have shown that among precursor-B-ALL patients, this translocation is present in around 20–30% of adult cases while it is rarely detected in children,10 11 12 13 14 15 16 as found in the present study.

From the functional point of view, the BCR/ABL fusion proteins are associated with an increased tyrosine-kinase activity.44 45 At the intracellular level, this translates into a dysregulation of transcription factors leading to abnormal patterns of protein expression.44 46 47 Among the different protein cell compartments, the cytoplasmic membrane is particularly relevant, its proteins representing the interface between a particular cell and its environment. Such a relationship is crucial and impacts on the behavior of both normal and neoplastic cells. Accordingly, it might be expected that specific genetic aberrations would be translated not only into an abnormal pattern of intracellular protein expression but also into altered surface antigen expression. This would translate into the so-called ‘phenotypic aberrations’ (ie asynchronous antigen expression, cross-lineage antigen expression and antigen under- or overexpression, among others) which have been well-characterized in acute leukemias.24 25 26 27 Therefore, it would be expected that BCR/ABL translocation is associated with unique patterns of surface antigen expression in a similar way to what has been previously described among precursor-B-ALL for the TEL/AML1 28 29 30 and 11q23 gene rearrangements.31 32 33 In the present study, we clearly show that precursor-B-ALL cases carrying BCR/ABL gene rearrangements display unique phenotypic features. Accordingly, we have observed that all BCR/ABL + adult patients, including both cases with M-BCR and m-BCR breakpoint gene rearrangements, showed a homogeneous expression of the CD34 (CD34++hm) and CD10 (CD10+hm) antigens together with a low and relatively heterogeneous expression of CD38 (CD38−/lo int) and CD13 (CD13+int) antigens. In contrast, this phenotypic profile (CD34++hm/CD10+hm/CD38−/lo int/CD13+int) was only detected in 6% of the BCR/ABL precursor B-ALL patients (3% of all BCR/ABL adults analyzed).

Previous reports have shown that apart from being CD10+, BCR/ABL + precursor-B-ALL cases usually display higher reactivity for CD13 and CD33,48 CD2549 and CD66c.50 In spite of the relatively high sensitivity displayed by some of these markers to identify BCR/ABL + ALL cases, further studies have shown that their expression is not specific of ALL patients with BCR/ABL gene rearrangements.30 51 52

Interestingly, our results based on the overall phenotypic profile of blast cells, illustrate the importance of quantitative flow cytometric assessment of antigen expression, which takes into account the mean fluorescence intensity and the reactivity pattern (homogeneous vs heterogeneous) for each antigen instead of just the presence or absence of particular antigens (based on arbitrary cut-off values for positivity). These differences in the methodological approach would contribute in explaining both the high sensitivity and specificity of immunophenotype to identify BCR/ABL gene rearrangements among precursor-B-ALL patients found in the present study.

Moreover, our findings provide new insights into the biology of BCR/ABL + leukemic cells in adult precursor-B-ALL. Accordingly, from these unique phenotypic patterns, the abnormally low and heterogeneous reactivity for CD38 and the reactivity for CD13 represent two well-characterized antigenic aberrations.27 53 The expression of both markers have been shown to be finely regulated during normal hematopoiesis, including the differentiation process towards the B cell lineage.27 54 55 56 57 58 However, the physiological role of both antigens at the early stages of B cell maturation still remain to be elucidated.54 55 56 57 59 Interestingly, the absence or low CD38 expression as well as the reactivity for CD13 have been reported as features of early immature CD34+ hematopoietic progenitor and precursor cells while the commitment of these cells into the B-lymphoid lineage is associated with a marked increase in CD38 expression and down-regulation of CD13.49 50 51 52 54 In this sense, both features apparently appear to be abnormally regulated among BCR/ABL + B cell committed leukemic cells.

During B cell differentation, CD10 is one of the earliest antigens to become detectable,54 56 its expression being down-regulated as CD34+ precursors differentiate into mature sIg+/CD20+ B cells.54 CD10 expression on CD34+ blast cells was found in all BCR/ABL + precursor-B-ALL cases as well as in around half of the BCR/ABL patients, representing one of the most frequent phenotypes in precursor-B-ALL; these findings suggest that blockade of CD10 down-regulation is a relevant event in leukemic B cell differentiation. In this sense it has been suggested that this surface antigen, which acts as a peptidase, could be involved in arresting normal B cell differentiation through the degradation of peptides which act as B cell differentiation factors.60

In spite of the singular phenotypic features described above in common for adults with BCR/ABL + precursor B-ALL, there is still a certain degree of heterogenity as regards the expression of several of the surface antigens explored here. This phenotypic heterogenity could be further explained by the DNA ploidy status of leukemic cells. Within BCR/ABL + cases, those with DNA aneuploidy were associated with a higher mean reactivity per cell for the CD10, CD38, CD45 and CD19 antigens. Interestingly, the phenotypic differences on CD10, CD38 and CD45 expression but not CD19, were also noted among the BCR/ABL diploid vs aneuploid cases (data not shown). These observations would further support the notion that the phenotypic features of leukemic B cells blocked in their maturation at a relatively early differentiation stage to a large extent reflect the underlying genetic aberrations carried by the neoplastic cells.

In summary, the present study shows that adult ALL patients carrying the BCR/ABL + translocation display a unique phenotypic profile (CD34++hm/CD10+hm/CD38−/lo int/CD13+int), the utility of this approach for identifying this subgroup of poor prognosis adult ALL patients deserving further confirmation in larger series of patients in which children with BCR/ABL+ ALL are also analyzed.

References

  1. 1

    Rowley JD . A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Guiemsa staining Nature 1973 243: 290–293 (letter)

  2. 2

    Rowley JD . Molecular genetics in acute leukaemia Leukemia 2000 14: 513–517

  3. 3

    Sandbery AA, Morgan R, Kipp TJ, Hecht F . The Philadelphia (ph) chromosome in leukemia. II. Variant Ph translocations in acute lymphoblastic leukemia Cancer Res Cytogenet 1985 14: 11–21

  4. 4

    Melo JV . The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype Blood 1996 88: 2375–2384

  5. 5

    Saglio G, Guerrasio A, Rosso C, Zaccaria A, Tassinari A, Serra A, Rege-Cambrin G . New type of Bcr/Abl junction in philadelphia chromosome-positive chronic myelogenous leukemia Blood 1990 76: 1819–1824

  6. 6

    Fardel S, Kantarjian HM, Talpaz M, Estrov Z . Clinical significance of cytogenetic abnormalities in adult acute lymphoblastic leukemia Blood 1998 91: 3995–4019

  7. 7

    Hagemeijer A . Chromosome abnormalities in CML Clin Haematol 1987 1: 963–981

  8. 8

    Gale RP, Canaani E . Review: the molecular biology of chronic myelogenous leukemia Br J Haematol 1985 60: 395–408

  9. 9

    Bloomfield CD, Goldman AI, Alimena, Berger R, Borgstrom GH, Brandt L, Catovsky D, de la Chapelle A, Dewald GW, Gaison OM . Chromosomal abnormalities identify high-risk and low-risk patients with acute lymphoblastic leukemia Blood 1986 67: 415–420

  10. 10

    Rieder H, Bonwetsch C, Janssen LA, Maurer J, Janssen JW, Schwartz S, Ludwig WD, Gassman W, Bartram CR, Thiel E, Loffler H, Gokbuget N, Hollzer D, Fonatsch C . High rate of chromosome abnormalities detected by fluorescence in situ hybridization using BCR and ABL probes in adult acute lymphoblastic leukemia Leukemia 1998 12: 1473–1481

  11. 11

    Copelan EA, McGuire EA . The biology and treatment of acute lymphoblastic leukemia in adults Blood 1995 85: 1151–1168

  12. 12

    Secker-Walker LM, Craig JM, Hawkins JM, Hoffbrand AV . Philadelphia positive acute lymphoblastic leukaemia in adults – age distribution, BCR breakpoint and prognostic significance Leukemia 1991 5: 196–199

  13. 13

    Annino L, Ferrari A, Cedrone M, Giona F, Lo Coco F, Meloni G, Arcese W, Mandelli F . Adult Philadelphia-chromosome-positive acute lymphoblastic leukaemia: experience of treatments during a 10-year period Leukemia 1994 8: 664–667

  14. 14

    Secker-Walker LM, Pentrice HG, Durrant J, Richards S, Hall E, Harrison G . Cytogenetics adds independent prognostic information in adults with acute lymphoblastic leukaemia on MRC trial UKALL XA Br J Haematol 1997 96: 601–610

  15. 15

    Pui CH, Crist WM, Look T . Biology and clinical significance of cytogenetic abnormalities in childhood acute lymphoblastic leukaemia Blood 1990 76: 1449–1463

  16. 16

    Pui CH, Evans WE . Acute lymphoblastic leukemia New Engl J Med 1998 339: 605–615

  17. 17

    Götz G, Weh HJ, Walter TA, Kuse R, Kolbe K, Dolken G, Hellrieger KP, Hoelzer D, Hossfeld DK . Clinical and prognostic significance of the Philadelphia chromosome in adult patients with acute lymphoblastic Ann Hematol 1992 64: 97–100

  18. 18

    Westbrook CA, Hooberman AL, Spino C, Dodge RK, Laison RA, Davey F, Wurster-Hill DH, Sobol RE, Schiffer C, Bloomfield CD . Clinical significance of the BCR-ABL fusion gene in adult acute lymphoblastic leukemia: a cancer and leukemia group B study (8762) Blood 1992 80: 2983–2990

  19. 19

    Roberts WM, Rivera GK, Raimondi SC, Santana VM, Sandlund JT, Crist WM, Pui CH . Intensive chemotherapy for Philadelphia chromosome-positive acute lymphoblastic leukemia Lancet 1994 343: 331–332

  20. 20

    Faderl S, Kantarjian HM, Thomas DA, Cortes J, Giles F, Pierce S, Albitar M, Estrov Z . Outcome of Philadelphia chromosome-positive adult acute lymphoblastic leukemia Leuk Lymphoma 2000 36: 263–273

  21. 21

    Brisco MJ, Sykes PJ, Dolman G, Neoh SH, Hughes E, Peng LM, Tauro G, Ekert H, Toogood I, Bradstock K, Morley AA . Effect of the Philadelphia chromosome on minimal residual disease in acute lymphoblastic leukemia Leukemia 1997 11: 1497–1500

  22. 22

    Jennings CD, Foon KA . Recent advances in flow cytometry: application to the diagnosis of hematologic malignancy Blood 1997 90: 2863–2892

  23. 23

    Ong ST, Larson RA . Current management of acute lymphoblastic leukemia in adults Oncology 1995 9: 433–442

  24. 24

    Campana D, Pui CH . Detection of minimal residual disease in acute leukemia: methodologic advanced and clinical significance Blood 1995 85: 1416–1434

  25. 25

    Ciudad J, San Miguel JF, López-Berges MC, Vidriales B, Valverde B, Ocqueteau M, Mateos G, Caballero MD, Hernández J, Moro MJ, Mateos Mv, Orfao A . Prognostic value of immunophenotypic detection of minimal residual disease in acute lymphoblastic leukemia J Clin Oncol 1998 16: 3774–3781

  26. 26

    Orfao A, Schmitz G, Brando B,. Ruiz-Arguelles A, Basso G, Braylan R, Rothe G, Lacombe F, Lanza F, Papa S, Lucio P, San Miguel JF . Clinically useful information provided by the flow cytometric immunophenotyping of hematological malignancies: current status and future directions Clin Chem 1999 45: 1708–1717

  27. 27

    Orfao A, Ciudad J, Almeida J, San Miguel JF . Residual disease detection of leukemia. In: Stewart CC, Nicholson JKA (eds) Immunophenotyping Wiley-Liss: New York 2000 pp 239–259

  28. 28

    Borowitz MJ, Rubnitz J, Nash M, Pullen DJ, Camitta B . Surface antigen phenotype can predict TEL-AML1 rearrangement in childhood B-precursor ALL: a Pediatric Oncology Group study Leukemia 1998 12: 1764–1770

  29. 29

    Borowitz MJ, Hunger SP, Carroll AJ, Shuster JJ, Pullen DJ, Steuber CP, Cleary ML . Predictability of the t(1;19)(q23;p13) from surface antigen phenotype: implications for screening cases of childhood acute lymphoblastic leukemia for molecular analysis. A Pediatric Oncology Group study Blood 1993 82: 1086–1091

  30. 30

    De Zen L, Orfao A, Cazzaniga G, Maziero L, Cocito MG, Spinelli M, Rivolta A, Biondi A, Zanesco L, Basso G . Quantitative multiparametric immunophenotyping in acute lymphoblastic leukemia: correlation with specific genotype. ETV6/AML1 ALLs identification Leukemia 2000 14: 1225–1231

  31. 31

    Tritz D, Pettigrew A, Talkington S, Smith L, Jennings CD . Association of CD15 expression and 11q23 translocation in acute leukemias Mol Pathol 1995 8: 122–129

  32. 32

    Pui CH . Acute leukemias with the t(4;11)(q21;q23) Leuk Lymphoma 1992 7: 173–179

  33. 33

    Pui CH, Raimondi SC, Head DR, Schell MJ, Rivera GK, Mirro J Jr, Crist WM, Behm FG . Characterization of childhood acute leukemia with multiple myeloid and lymphoid markers at diagnosis and at relapse Blood 1991 78: 1327–1337

  34. 34

    Bene MC, Castoldi G, Knapp W, Ludwig WD, Matutes E, Orfao A, van't Veer MB . Proposals for the immunological classification of acute leukemias. European Group for the immunological characterization of leukemias (EGIL) Leukemia 1995 9: 1783–1786

  35. 35

    Orfao A, Ciudad J, López-Berges MC, López A, Vidriales B, Caballero MD, Valverde B, González M, San Miguel JF . Acute lymphoblastic leukemia (ALL): detection of minimal residual disease (MRD) at flow cytometry Leuk Lymphoma 1994 13: (Suppl. 1) 87–90

  36. 36

    San Miguel JF, García-Sanz R, González M, Moro MJ, Hernández JM, Ortega F, Borrega D, Carnero M, Casanova F, Jimenez R . A new staging system for multiple myeloma based on the number of S-phase plasma cells Blood 1995 85: 448–455

  37. 37

    Chomczynski P, Sacchi N . Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 1987 162: 156–159

  38. 38

    van Dongen JJ, Macintyre EA, Gabert JA, Delabesse F, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dolti G, Griesinger F, Parreira A, Gameiro A, Diaz MG, Malec M, Langerak AW, San Miguel JF, Biondi A . Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease Leukemia 1999 13: 1901–1928

  39. 39

    García Isidoro M, Tabernero MD, García JL, Najera ML, Hernández JM, Wiegant J, Raap A, San Miguel J, Orfao A . Detection of the Mbcr/abl translocation in chronic myeloid leukaemia by fluorescence in situ hibridization. Comparison with conventional cytogenetics and implications for minimal residual disease detection Hum Pathol 1997 28: 154–159

  40. 40

    Tabernero MD, San Miguel JF, García-Sanz R, Najera ML, García-Isidoro M, Pérez-Simón JA, González M, Wiegant J, Raap A, Orfao A . Incidence of chromosome numerical changes in multiple myeloma. Fluorescence in situ hybridization analysis using 15 chromosome-specific probes Am J Pathol 1996 149: 153–161

  41. 41

    Cobaleda C, Gutiérrez-Cianca N, Pérez-Lozada J, Flores T, García-Sanz R, González M, Sánchez-García I . A primitive hematopoietic cell is the target for the leukemic transformation in human Philadelphia-positive acute lymphoblastic leukemia Blood 2000 95: 1007–1013

  42. 42

    Sánchez-García I . Consequences of chromosomal abnormalities in tumour development Ann Rev Genet 1997 31: 429–453

  43. 43

    Sánchez-García I, Grütz G . The tumorigenic activity of the BCR-ABL oncogenes is mediated by BCL-2 Proc Natl Acad Sci USA 1995 92: 5287–5291

  44. 44

    Lugo YG, Pendergast AM, Muller AJ, Witte ON . Tyrosine kinase activity and transformation potential of bcr-abl oncogene products Science 1990 247: 9312–9316

  45. 45

    Verfaille CM . Chronic myelogenous leukemia: too much or too little growth, or both? Leukemia 1998 12: 136–138

  46. 46

    Skorski T, Kanakaraj P, Nieborowska-Skorska M, Ratajczak MZ, Wen SC, Zon G, Gewirtz AM, Perussia B, Calabretta B . Phosphatidylinositol – 3 kinase activity is regulated by BCR/ABL and is required for the growth of Philadelphia chromosome-positive cells Blood 1995 86: 726–736

  47. 47

    Jain SK, Keeler S, Carlesso N, Druker B, Varticovski L . PI 3-kinase activation in BCR/abl transformed hematopoietic cells does not require interaction of p85 SH2 domains with p210 BCR/abl Blood 1996 88: 1542–1550

  48. 48

    Schlieben S, Borkhardt A, Reinisch I, Ritterbach J, Jansen JWG, Ratei R, Schrappe M, Repp R, Zimmermann M, Kabisch H, Janka-Schaub G, Bartram CR, Ludwing W-D, Riehm H, Lampert F, Harbott J . Incidence and clinical outcome of children with BCR/ABL-positive acute lymphoblastic leukaemia (ALL). A prospective RT-PCR study based on 673 patients enrolled in the German pediatric multicenter therapy trials ALL-BFM-90 and CoALL-05–92 Leukemia 1996 10: 957–963

  49. 49

    Paietta E, Racevskis J, Neuberg D, Rowe JM, Goldstone AH, Wiernik PH . Expression of CD25 (interleukin-2 receptor alfa chain) in adult acute lymphoblastic leukaemia predicts for the presence of BCR/ABL fusion transcripts: results of a preliminary laboratory analysis of ECOG/MRC Intergroup Study E2993 Leukemia 1997 11: 1887–1890

  50. 50

    Mori T, Suzuki T, Okazaki T, Manabe A, Hosoya R, Mizutani S, Kinoshita A, Nakazawa S . A novel monoclonal antibody, KOR-SA3544 which reacts to Philadelphia chromosome-positive acute lymphoblastic leukaemia cells with high sensitivity Leukemia 1995 9: 1233–1239

  51. 51

    Baruchel A, Cayuela JM, Ballerini P, Landman-Paker J, Cezard V, Haddad E, Auclerc MF, Valensi F, Cayre YE, Mancintyre EA, Sigauz F . The majority of myeloid-antigen-positive (My+) childhood B-cell precursor acute lymphoblastic leukaemias express TEL-AML1 fusion transcripts Br J Haematol 1997 99: 101–106

  52. 52

    Hrusak O, Trka J, Zuna J, Houskova J, Bartunkova J, Stary J . Aberrant expression of KOR-SA3544 antigen in childhood acute lymphoblastic leukaemia predicts TEL-AML1 negativity Leukemia 1998 12: 1064–1070

  53. 53

    Drexler HG, Thiel E, Ludwig WD . Review of the incidence and clinical relevance of myeloid antigen-positive acute lymphoblastic leukemia Leukemia 1991 5: 637–645

  54. 54

    Lucio P, Parreira A, van den Beemd MW, van Lochem EG, van Wering ER, Baars E, Porwit-MacDonald A, Bjorklund E, Gaipa G, Biondi A, Orfao A, Janossy G, van Dongen JJ, San Miguel JF . Flow cytometry analysis of normal B cell differentiation: a frame of reference for the detection of minimal residual disease in precursor-B-ALL Leukemia 1999 13: 419–427

  55. 55

    Orfao A, Chillón MC, Bortoluci AM, López-Berges MC, García-Sanz R, González M, Tabernero MD, García-Marcos MA, Rasillo AI, Hernández-Rivas J, San Miguel JF . The flow cytometric pattern of CD34, CD15 and CD13 expression in acute myeloblastic leukaemia is highly characteristic of the presence of PML-Rarα gene rearrangements Haematologica 1999 84: 405–412

  56. 56

    Novelli EM, Ramírez M, Civin CL . Biology of CD34+/CD38 cells in lymphohematopoiesis Leuk Lymphoma 1998 31: 285–293

  57. 57

    Terstappen LW, Huang S, Safford M, Lansdorp PM, Loken MR . Sequential generations of hematopoietic colonies derived from single nonlineage-committed CD34+CD38 progenitor cells Blood 1991 77: 1218–1227

  58. 58

    Loken MR, Shah VO, Dattilio KL, Civin CL . Flow cytometric analysis of human bone marrow. II Normal B lymphocyte-development Blood 1987 70: 1316–1324

  59. 59

    Waller EK, Olweus J, Lund-Johansen F, Huang S, Nguyen M, Guo GR, Terstappen L . The ‘common stem cell’ hypothesis reevaluated: human fetal bone marrow contains separate populations of hematopoietic and stromal progenitors Blood 1995 85: 2422–2435

  60. 60

    Salles G, Rodewald HR, Chin BS, Reinherz EL, Shipp MA . Inhibition of CD10/neutral endopeptidase 24.11 promotes B-cell reconstitution and maturation in vivo Proc Natl Acad Sci USA 1993 90: 7618–7622

Download references

Acknowledgements

This work was partially supported by a grant from the Agencia Española de Cooperaciónal (AECI) from the Ministerio de Asuntos Exteriores (Madrid, Spain). AM Bortoluci was supported by a grant from the Instituto Iberoamericano de Cooperación Internacional (Madrid, Spain).

Author information

Correspondence to A Orfao.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Tabernero, M., Bortoluci, A., Alaejos, I. et al. Adult precursor B-ALL with BCR/ABL gene rearrangements displays a unique immunophenotype based on the pattern of CD10, CD34, CD13 and CD38 expression. Leukemia 15, 406–414 (2001) doi:10.1038/sj.leu.2402060

Download citation

Keywords

  • precursor B-ALL
  • t(9;22)(q34;q11)
  • immunophenotype
  • patterns of expression

Further reading