Frequent allelic loss of the BCL10 gene in lymphomas with the t(11;14)(q13;q32)

TO THE EDITOR

The translocation t(11;14)(q13;q32) is the cytogenetic hallmark of mantle cell lymphomas (MCL), in which it can be detected in over 80% of cases. Additionally, this translocation has been observed in subsets of other B-lymphocytic neoplasms.1 At the molecular level, the t(11;14) juxtaposes the BCL1-locus in chromosome band 11q13 next to the immunoglobulin heavy chain (IgH) locus in chromosome band 14q32, resulting in overexpression of cyclin D1 (CCND1). Cyclin D1 protein plays a crucial role in cell cycle progression by promoting the G1-S phase transition. Though overexpression of CCND1 due to the t(11;14) is regarded as the primary event in the pathogenesis of mantle cell lymphomas, experimental data from transgenic mice suggest that cyclin D1 has minimal oncogenic potential, being insufficient to induce tumorigenicity by itself. Thus, the acquisition of secondary chromosomal aberrations appears to be crucial for the malignant transformation and clonal progression of CCND1-overexpressing lymphocytes. By karyotyping, such secondary chromosomal changes can be observed in more than 80% of B cell malignancies with t(11;14). Among the most frequently recurring secondary changes in these neoplasms are deletions in the short arm of chromosome 1 (1p). The common region of loss in cytogenetic as well as CGH studies encompasses 1p22, suggesting the existence of a tumor suppressor gene involved in the pathogenesis of t(11;14)-positive B cell in this chromosomal region.2 3 Chromosome region 1p22 harbors the BCL10 gene, which we and others recently cloned from the translocation t(1;14)(p22;q32) recurrent in mucosa-associated lymphoid tissue (MALT) lymphomas.4 5 The BCL10 gene encodes a caspase recruitment domain (CARD)-containing apoptosis signaling protein that is capable of promoting apoptosis and suppressing in vitro transformation of rat embryonic fibroblasts by synergistic oncogenes. BCL10 cDNAs from t(1;14)-positive MALT tumors contain a striking variety of mutations that abrogate the pro-apoptotic function of the normal protein.4 5 These data suggest that wild-type BCL10 may act as a tumor suppressor.

In a recent paper,6Bullinger et al screened 15 MCL, five of them with one copy of BCL10 deleted, for inactivating mutations. Except for well-established polymorphisms,4 5 no sequence alterations could be detected. We also recently presented a study7 aiming to determine whether the BCL10 gene might be the target of the 1p22 deletions found in MCL. From our series of 43 t(11;14) positive MCL 20 (47%) cases contained deletions of the short arm of chromosome 1 by standard chromosome analyses. Thereby loss of 1p35-p36 was observed in seven patients (16%), whereas 16 of the 43 patients (37%) showed loss of 1p21(-p31), including three patients with both regions affected. Interphase FISH with a BCL10-specific probe was performed on nine of these lymphomas, five of them with typical mantle cell lymphoma, four of them with high-grade (blastoid or pleomorphic) variants. In all cases, FISH with a BCL10-specific probe revealed a significant percentage (24–95%) of nuclei with a signal constellation indicative of BCL10 gene deletion (Figure 1a). Additionally, FISH of the t(11;14)-positive mantle cell lymphoma cell line Granta 519 which contains a derivative chromosome 1 with alterations that include the 1p22 region, also revealed loss of one copy of the BCL10 gene locus (Figure 1b). Thus, one BCL10 allele was consistently lost in our series of t(11;14)-positive lymphomas containing interstitial deletions in 1p22.

Figure 1
figure1

 Detection of BCL10 deletions in t(11;14)-positive lymphomas. (a) Interphase FISH with a BCL10-specific probe of a primary t(11;14)-positive mantle cell lymphoma revealing loss of one copy of the BCL10 gene in the nuclei of tumor cells (one red signal) in contrast to an accompanying normal cell (two red signals). (b) FISH with a BCL10-specific probe (detected with Cy3) and a 1p36-specific probe (detected with FITC) on a metaphase from the t(11;14)-positive cell line Granta 519. The intact chromosome 1 displays the expected signal constellation, with a red fluorescent signal from the BCL10 probe at 1p22 and a green fluorescent signal from the D1Z2 probe at 1p36. Loss of one copy of the BCL10 gene in this cell line is due to a complex alteration that generates a derivative chromosome 1 that also contains the 1p36-specific signal in an atypical position. According to R-banding analysis, this derivative chromosome most likely represents a der(1)t(1;5)(p36;q14)del(1)(p12p31)del(1)(q12q31) (Harder et al, unpublished data).

In order to determine whether the second allele of the BCL10 gene is also inactivated, seven primary cases with FISH-proven BCL10 deletions and at least 45% aberrant cells, as well as the cell line Granta 519, were subjected to genomic mutation screening of the complete BCL10 open reading frame by direct SSCP and sequencing analyses (primers were derived from the genomic BCL10 sequence, Acc. No. AF097732, sequences available upon request). Besides the mentioned polymorphisms no clonal mutations of the second allele of BCL10 were detected in any of the eight lymphomas.

Epigenetic mechanisms might also lead to inactivation of a candidate tumor suppressor by transcriptional silencing. For example, hypermethylation of CpG islands is a recurrent mode of transcriptional silencing and has been shown to be a mechanism of inactivation of some tumor suppressor genes like p16. Genomic analysis of the 5′ region of BCL10 revealed the existence of a CpG island that might possess regulatory influence on BCL10. Methylation-specific PCR was performed on bisulfite-modified DNA from the seven t(11;14)-positive primary cases with FISH-proven BCL10 deletion, and from peripheral blood leukocytes as a control (Figure 2). In all DNA samples investigated, amplification with the wild-type primers and the primers specific to the unmethylated state generated a specific product of 268 bp. In contrast, no product was obtained using the methylation-specific primers. Thus, our data provide no evidence that transcriptional silencing by methylation plays a major role for inactivation of the second BCL10 allele in t(11;14)-positive lymphomas. These findings were also supported by the presence of BCL10 mRNA in the Granta 519 cell line, which contains only one BCL10 allele (data not shown). If transcriptional silencing were to be the mechanism of inactivation of the second allele in this cell line, no BCL10 mRNA should be detectable. Remarkably, though we have not found any evidence for clonal genomic DNA mutations of BCL10 in Granta 519, the BCL10 mutation database contains 20 different transcript variants of BCL10 from this cell line, which were identified by sequencing of cloned cDNA (http://www.icr.ac.uk/haemcyto/bcldata/data.htm). Fifteen of these cDNA variants should result in truncated BCL10 protein. Therefore, non-templated mutations occurring during or after transcription might also affect BCL10 proteins integrity and function.

Figure 2
figure2

 Methylation-specific PCR of the BCL10 CpG island. M, 100 bp ladder; lanes 1–8, amplification of unmodified genomic DNA with wild-type primer set (5′cgcgtcgccgtcgacctcagaggcg3′ and 5′gtccttcttcacttcagtgagg3′); lanes 9–16, amplification of bisulfite-treated DNA (protocol as described by Intergen, Oxford, UK) with U-primer set (5′tgtgttgttgttgatgattttagaggtg3′ and 5′tccttcttcacttcaat- aaaatcc3′) specific for unmethylated status; 17–24, amplification of bisulfite-treated DNA with M-primer set (5′cgcgtcgtcgtcgatttt- agaggcg3′ and 5′tccttcttcacttcaataaaatcc3′) specific for methylated DNA; a–g, DNA from seven primary t(11;14)-positive lymphomas with FISH-proven monoallelic BCL10 deletion; h, peripheral blood leukocyte control DNA.

In summary, we found frequent monoallelic deletion of BCL10 in lymphomas containing t(11;14)(q13;q32). Nevertheless, the lack of clonal inactivating mutations or transcriptional silencing by hypermethylation of the second BCL10 allele questions whether the gene is indeed the target of the 1p22 deletions in t(11;14)-positive lymphomas. We cannot presently rule out that post-transcriptional silencing or non-templated mutations at the RNA level affect BCL10 function in these tumors, however. Future studies will be required to address these issues by investigating possible aberrations of BCL10 protein expression, structure and function in t(11;14)-positive lymphomas, as well as other tumors. On the other hand the possibility exists that haploinsufficiency may be sufficient to accelerate tumor progression due to dose dependent action of the BCL10 protein.

References

  1. 1

    Raffeld M, Jaffe ES . bcl-1, t(11;14), and mantle cell-derived lymphomas Blood 1991 78: 259–263

  2. 2

    Wlodarska I, Pittaluga S, Hagemeijer A, Wolf-Peeters C, Van Den Berghe H . Secondary chromosome changes in mantle cell lymphoma Haematologica 1999 84: 594–599

  3. 3

    Bea S, Ribas M, Hernandez JM, Bosch F, Pinyol M, Hernandez L, Garcia JL, Flores T, Gonzalez M, Lopez-Guillermo A, Piris MA, Cardesa A, Montserrat E, Miro R, Campo E . Increased number of chromosomal imbalances and high-level DNA amplifications in mantle cell lymphoma are associated with blastoid variants Blood 1999 93: 4365–4374

  4. 4

    Zhang Q, Siebert R, Yan M, Hinzmann B, Cui X, Xue L, Rakestraw KM, Naeve CW, Beckmann G, Weisenburger DD, Sanger WG, Nowotny H, Vesely M, Callet-Bauchu E, Salles G, Dixit VM, Rosenthal A, Schlegelberger B, Morris SW . Inactivating mutations and overexpression of BCL10, a caspase recruitment domain-containing gene, in MALT lymphoma with t(1;14)(p22;q32) Nat Genet 1999 22: 63–68

  5. 5

    Willis TG, Jadayel DM, Du MQ, Peng H, Perry AR, Abdul-Rauf M, Price H, Karran L, Majekodunmi O, Wlodarska I, Pan L, Crook T, Hamoudi R, Isaacson PG, Dyer MJ . Bcl10 is involved in t(1;14)(p22;q32) of MALT B cell lymphoma and mutated in multiple tumor types Cell 1999 96: 35–45

  6. 6

    Bullinger L, Leupolt E, Schaffner C, Mertens D, Bentz M, Lichter P, Döhner H, Stilgenbauer S . BCL10 is not the gene inactivated by mutation in the 1p22 deletion region in mantle cell lymphoma Leukemia 2000 14: 1490–1492

  7. 7

    Steinemann D, Siebert R, Martin-Subero I, Harder S, Kettwig G, Gesk S, Hinzmann B, Rosenthal A, Morris SW, Grote W, Schlegelberger B . Frequent allelic loss of the BCL 10 gene in lymphomas with the translocation t(11;14)(q13;q32) Eur J Hum Genet 2000 8: 505

Download references

Author information

Correspondence to D Steinemann.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Steinemann, D., Siebert, R., Harder, S. et al. Frequent allelic loss of the BCL10 gene in lymphomas with the t(11;14)(q13;q32). Leukemia 15, 474–475 (2001). https://doi.org/10.1038/sj.leu.2402037

Download citation

Further reading